:: Korean Journal of Breeding Science ::
Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer open access
ISSN : 0250-3360(Print)
ISSN : 2287-5174(Online)
Korean Journal of Breeding Science Vol.44 No.4 pp.567-578
DOI : https://doi.org/10.9787/KJBS.2012.44.4.567

보통 밀에서 i-type 저분자글루테닌 유전자 클로닝 및 동정

이종열1, 오기광1, 김효정1, 김영태1, 강천식2, 지원재3, 임선형1, 하선화1, 안상낙4*, 김영미1*

Characterization of Three i-type Low-Molecular-Weight Subunit Genes in Common Wheat

Sang-Nag Ahn4*, Jong-Yeol Lee1, Ki-Kwang Oh1, Hyo-Jung Kim1, Yeong-Tae Kim1, Chon-Sik Kang2, Won-Jae Chi3, Sun-Hyung Lim1, Sun-Hwa Ha1, Young-Mi Kim1*
4Department of Agronomy, Chungnam National University
1National Academy of Agricultural Science, RDA, 2National Institute of Crop Science, RDA, 3Department of Biological Science, Myongji University
Received on October 22, 2012, Revised on November 16, 2012, Accepted on November 22, 2012

Abstract

Three low molecular weight (LMW) glutenin subunit genes were isolated from hexaploid wheat cultivars (Triticumaestivum. L) using LMW-GS specific primers and designated as Jokyung II-2, CS III-5 and Keumkang 6-12, respectively. Allsequences were classified as LMW-i type genes based on the presence of an N-terminal isoleucine residue. All comprised offour regions, the signal peptide, N- and C- terminal domains, and a repetitive domain. Although they showed high similarity withother LMW-i type genes from hexaploid bread wheat, they also displayed unique features. Particularly, Keumkang 6-12 subunitcontained an extra cysteine residue in the C-terminus except for eight conserved cysteines, which resulted from a single-nucleotidepolymorphism (SNP) of the A–G transition, namely tyrosine-cysteine substitution at position 335 from the N-terminal end. Inaddition, a total of 15 SNPs and one insertions/deletions (InDels) were detected among Jokyung II-2, CS III-5 and JokyungHQ6199333 and 10 other LMW-i genes. Two dimensional gel electrophoresis and LC-ESI MS/MS analysis revealed that LMWi-type glutenin subunit of the Jokyung is Glu-A3c. The phylogenic analysis showed that LMW i-type genes were divided roughlyinto diploid and hexaploid groups and the hexaploid were further classified into 7 subgroups (Glu-A3a~g). We also found lengthpolymorphism in the repetitive domain showing 2~179 amino acid residues variation among the previously published LMW-itype glutenin subunits. The length polymorphism can be used as reliable genetic marker for use in marker-assisted breeding toselect for specific alleles of the quality-determining locus in wheat breeding program.

kjbs 44-4-18 f 1.jpg85.0KB

서 언

 곡류 중에서 특히 밀의 반죽(dough)은 점성, 탄성을 나타내며 이러한 특성으로 빵, 면, 쿠키, 케익과 같은 다양한 음식을 인류에게 제공해 왔다. 이러한 밀의 다양한 가곡적성은 글루텐 단백질의 함량과 구성 성분의 차이에 기인한다(Shewry et al. 1995). 글루텐 단백질은 알콜 수용액 [60-70%(v/v) ethanol 또는 50%(v/v) propan-1-ol]의 용해도에 따라 녹는 글리아딘과 녹지 않은 글루테닌으로 나눠지는데(Wieser 2007), 글리아딘은 시스테인 잔기가 없거나, 있어도 분자 내 이황화 결합(intra-disulfide bond)를 형성하며 monomer 형태로 존재한다. 글루테닌은 분자량 70,000-100,000 dalton인 고분자 글루테닌 서브유닛 [high-molecular-weight glutenin subunit(HMW -GS)]과 분자량 20,000-45,000 dalton인 저분자글루테닌 서브유닛 [low-molecular-weight glutenin subunit(LMW-GS)]으로 구성되며 이들은 분자 간 또는 분자 내 이황화 결합(inter- and intra-molecular disulfide bond)에 의해 거대 중합체(macropolymer)를 형성하게 된다(Shewry et al. 1992). 일반적으로 글루테닌은 탄성(elasticity), 글리아딘은 점성(viscosity) 및 신장성(extensibility)과 관련이 깊다. LMW-GS는 각각 1A, 1B 그리고 1D 염색체 단완(short arm)의 Glu-A3, Glu-B3 그리고 Glu-D3에 의해 암호화된다(Gupta and Shepherd 1990). 전형적인 LMW-GS는 시그널 펩타이드, N-말단 영역, 반복서열 영역, C-말단 영역 등 네 부분으로 구성되며 이들 유전자의 크기는 반복서열 영역의 결실 또는 추가에 따라 달라진다. LMW-GS는 이들의 N-말단 첫번째 아미노산에 따라 LMW-i(이소루신), LMW-m(메티오닌), 그리고 LMW-s(세린)의 세 종류로 분류된다(Cloutier et al. 2001; Lew et al. 1992). Ikeda et al.(2002)은 일본 연질 밀인 Norin 61의 cDNA library와 genomic DNA로 부터 LMW-GS 유전자를 클로닝하고 N-말단, C-말단에 보존되어 있는 아미노산 서열에 따라 12 그룹으로 분류하였다. 또한 Ikeda et al.(2006)은 12 그룹 특이적 프라이머를 제작하여 Chinese spring nullisomic-tetrasomic lines을 이용하여 이들의 염색체위치(loci)를 PCR로 확인하였으며, LMW-GS 유전자의 해당 단백질을 확인하기 위해 글루테닌 단백질을 추출하고 이차원 전기영동을 실시하여 각 스팟들은 N-말단 아미노산서열결정법으로 LMW-GS 단백질을 확인하고 위의 12 그룹으로 분류하였다. LMW-GS 단백질은 빵(Payne et al. 1987; Gupta et al. 1989; Gupta and MacRitchie 1994)과 파스타를 만드는 과정(Pogna et al. 1990; Ruiz and Carrillo 1995)에서 밀가루의 물리적 특성에 영향을 미친다고 알려져 있다. LMW 글루테닌 유전자 좌 구성성분이(allelic composition) 빵밀과 듀럼밀에서 반죽강도(dough strength) 그리고 신장성(extensibility)에 영향을 미친다. 이것은 LMW-GS와 HMW-GS가 중합체를 형성하고, 이 중합체가 monomeric 글리아딘과의 결합으로 물성의 변화가 생기는 것이다(Payne et al. 1987; Gupta et al. 1989, 1994; Nieto- Taladriz et al. 1994; Ruiz and Carrillo 1995; Sontag-Strohm et al. 1996). Glu-A3 위치에서 특정 LMW-GS 유전자 좌가 반죽강도(dough strength) 그리고 신장성에 영향을 미치는 것이 밝혀졌고, 여러가지 Glu-A3 유전자 좌와 밀반죽 품질(dough quality effects)의 관계를 서열화하였다(Gupta et al. 1989, 1990, 1991, 1994; Metakovsky et al. 1990). Rmax(maximum dough resistance) 값은 Glu-A3 유전자 좌에서 b>d>e>c, Glu-B3 유전자 좌에서 i>b=a>e=f=g=h>c 그리고 Glu-D3에서 e>b>a>c>d의 순서를 보였다. 신장성 부분에서는 Glu-3 bbb (각각 Glu-A3, Glu-B3 및 Glu-D3)의 조합일 때 최고의 값을 보이고, bbc 또한 좋은 값을 보였다(Cornish et al. 1993).Gupta and Shepherd(1990)은 밀 222 품종으로부터 LMW-GS Glu-A3 위치에 6개(a, b, c, d, e, f ), Glu-B3 위치에 9개(a, b, c, d, e, f, g, h, i) 그리고 Glu-D3 위치에 5개(a, b, c, d, e)등 20개의 유전자 좌를 SDS-PAGE로 확인하였다. 최근의 연구 결과로 새로운 유전자 좌인 Glu-A3g를 확인하였다(Zhang et al. 2004). 현재까지 SDS-PAGE가 LMW-GS의 allelic composition을 결정하는데 가장 보편적으로 사용되고 있지만 (Jackson et al. 1996), SDS-PAGE 상에서 밴드 패턴을 분석하기가 어렵고 글리아딘과의 구별이 어렵기 때문에 유전자 좌의 변이와 품질 관련성을 연구하기가 쉽지 않다(Gupta et al. 1994; Maruyama-Funatsuki et al. 2004; Masci et al. 1998). 이러한 이유로 LMW-GS 유전자 좌 변이를 구별 할 수 있는 DNA 마커에 대한 연구가 활발히 진행되어왔다. 특히 Zhang et al.(2004)은 Glu-A3 유전자 좌에서 Glu-A3a, b, c, d, e, f, g 7개의 유전자를 분리 동정하였고 이들 유전자 좌를 구별할 수 있는 allele specific PCR marker들을 개발하였다. 또한 Wang et al.(2010)은 Glu-A3 유전자들의 SNP를 이용해서 7개의 dominant allele-specific marker를 개발하였고, Glu-A3b + Glu-A3f, Glu-A3d + Glu-A3f, Glu-A3d + Glu-A3f 그리고 Glu-A3b + Glu-A3e를 구별할 수 있는 multiplex marker를 개발하였다. 개발한 마커 시스템은 141개의 CIMMYT 밀품종에서 검증하였다.

 본 연구에서는 국내 밀 품종인 조경, 금강 그리고 중국 품종인 Chinese spring으로부터 세 개의 새로운 i 타입 LMWGS 유전자(Glu-A3 allele)를 클로닝하여 분류 동정하였고 이들을 기존의 i 타입 LMW-GS 유전자들과 비교 분석하여 근연 관계를 확인하였으며, length polymorphism을 이용한 마커 개발의 가능성을 확인하였다. 또한 조경의 i 타입 LMW-GS 유전자의 protein product(Glu-A3c)를 확인하기 위해 글루테닌 단백질을 추출 후 이차원전기영동을 실시하였고 해당 스팟을 LC-ESI MS/MS를 실시하여 기존에 밝혀진 LMW i 타입 유전자(HQ619933)와 단백질의 관계를 확인하였다.

재료 및 방법

식물 재료

 Genomic DNA 추출을 위한 밀 종자 그리고 글루테닌 단백질 추출을 위한 밀가루는 국립식량과학원에서 육성된 조경 및 금강을 사용하였고, 중국 품종인 Chinese spring 종자 및 밀가루도 국립식량과학원 밀 연구실로부터 제공 받아 사용하였다.

Genomic DNA 추출 및 PCR 증폭

 밀 품종 조경, 금강과 Chinese spring의 genomic DNA는 어린 잎을 사용하여 DNeasy Plant Mini Kit(QIAGEN)를 이용해 추출하였다. LMW-GS 유전자 클로닝을 위한 LMW-GS 특이 프라이머는 Ikeda et al.(2002) 의 프라이머를 이용하였으며, 5’ 방향의 프라이머는 Glu4: GCAACTTTGATGATC AATCC, Glu4.2: GCAACTTTGATGATGAATCC그리고, 3’ 방향 프라이머는 Glu5: AAACAACGGTGATCCAACTAT, Glu5.4: AAACAAAGGTGATCCAACTAT 를 각각 사용하였다. PCR 증폭은  25U(5 ul / U)의 LA-Tag DNA Polymerase (TaKaRa), 100 ng genomic DNA, 10x LA PCR buffer II Mg2+ (TaKaRa), 2.5 mM dNTPs와 10 pmol 각 프라이머를 사용하여 총 50 ul가 되게 하여 반응시켰고, Gene Amp PCR system 9700을 이용하여, 94℃ 에서 2 분간 변성시킨 후, 94℃에서 30초, 55℃에서 1분, 72℃에서 1분의 단계로 35 회 반복 실시하고, 72℃에서 5분간 최종 증폭하였다. 증폭된 PCR 산물은 1% agarose gel에 전기영동하여 밴드를 확인하였고, Gel Extraction Kit(Qiagen)를 사용하여 정제하였다.

LMW-GS 유전자 클로닝 및 염기서열 분석

모든 PCR 산물은 T-blunt Vector(Solgent)에 클로닝하였고, E. coli DH5α Strain에 형질 전환하였다. 염기서열분석은 GenoTech Corp(Daejeon, Korea)에서 수행하였고, 각 클론은 오류를 줄이기 위해 2회 반복 수행하였다.

다중서열 분석 및 계통도 분석

 DNA 염기 및 아미노산 다중서열분석은 Lasergene version 7.0(DNASTAR)을 이용하였고 계통도 분석은 MEGA4을 이용하였다.

글루테닌 단백질 추출

 글루테닌 추출은 Singh et al.(1990) 방법으로 실시하였다. 미세하게 분쇄한 밀 500 mg에 50%(v/v) propanol을 25 ml 넣어 65℃에서 30분간 반응한 후 10,000 g에서 10분간 원심 분리 하여 상등액을 버리는 방법으로 글리아딘을 제거하였다. 글리아딘을 완전히 제거하기 위하여 상기의 propanol 추출을 한번 더 반복한 후 pellet에 50%(v/v) propanol 12.5 ml 넣고 10000 g에서 5분간 원심 분리하여 세정하였다. Pellet에 1% (w/v) Dithiothreitol(DTT)를 첨가한 50%(v/v) propanol, 0.08M Tris-HCl pH 8.0을 2.5 ml 넣고 65℃에서 30분간 반응하여 글루테닌을 추출하였다. 10,000 g에서 5분간 원심분리하고 단백질 알킬화를 위해 1.4%(v/v) 4-vinylpyridine을 첨가한 50% (v/v) propanol, 0.08M Tris-HCl pH 8.0을 2.5 ml 넣고 65℃에서 15분간 반응시킨 후 10,000 g에서 2분간 원심분리하여 상등액을 취하였다. Bradford(1976)법을 사용하여 글루테닌 단백질 분획을 정량하였다.

일차원 전기영동

 Glutenin 분획 단백질 5 ug을 5x sample buffer [60 mM Tris-HCl(pH 6.8), 25% glycerol, 2% SDS, 14.4 mM 2- mercaptoethanol, 0.1% bromophenol blue]와 혼합하여 97℃에서 3분간 변성하였다. 12.5% SDS-polyacrylamide gel을 이용하여 Tris glycine buffer(0.025 M Tris, 0.192 M Glycine, 0.1% SDS)로 100V 전압으로 전기영동하였다.

이차원 전기영동 및 LC-ESI MS/MS 분석

 Glutenin 분획 단백질을 15%(v/v) TCA/Acetone으로 -20℃에서 침전시켜 pellet을 rehydration buffer [7M Urea, 2M Thiourea, 2% CHAPS, 0.5% IPG buffer(pI 6-11, GE healthcare), 18 mM DTT]에 녹였다. 이것을 정량 한 후 100 ul rehydration buffer와 혼합하여 18 cm IPG strip(pI 6-11, GE healthcare)에 로딩하고 IPGphor system(Amersham Biosciences)을 이용하여 20℃에서 15시간 rehydration 시켰다. Isoelectric focusing(IEF)은 200V 에서 1시간 유지한 후 1시간 동안 500V까지, 이후 1시간 동안 1,000 V 까지, 3시간 동안 8,000 V까지 전압을 상승시킨 후 7시간 30분 동안 8,000 V로 고정하여 전체 전압 85.7 KVh가 되도록 하였다. Focusing된 IPG strip을 Equilibration buffer(6M Urea, 75 mM Tris-HCl(pH8.8), 29.3% glycerol, 2% SDS, 1% DTT)에 15분간 처리한 후 DTT를 제외하고 2.5% Iodoacetamide를 첨가한 Equilibration buffer에서 15분간 처리하여 10% SDS-polyacrylamide gel을 이용하여 2차원 전기영동 하였다. 전기영동 후 Coomassie Brilliant Blue R-250으로 젤을 염색하고 Glu-3A에 해당하는 단백질 스팟을 잘라내었다. 잘라낸 스팟은 트립신으로 in-gel digestion 시키고 LC-MS/MS(reversed phase capillary HPLC directly coupled to a Finnigan LCQ ion trap mass spectrometer) 로 분석하였다(Zuo et al. 2001). 검출된 MS/MSion은 MASCOT 검색엔진(Matrix science)을 이용하여 해당 단백질을 확인하였다.

결과 및 고찰

LMW 글루테닌 유전자 PCR 증폭

 LMW-GS 유전자는 intron이 없기 때문에 genomic DNA를 template로 LMW-GS 특이 프라이머(Ikeda et al. 2002)를 사용하여 PCR을 수행하였다. 조경 밀은 5’ 방향의 프라이머 Glu 4.2 3’ 방향의 프라이머 Glu 5 Chinese spring은 5’ 방향의 프라이머 Glu 4.2 3’ 방향의 프라이머 Glu 5.4 그리고 금강은 5’ 방향의 프라이머 Glu 4 3’ 방향의 프라이머 Glu 5.4를 이용한 결과, 조경 밀과 Chinese spring에서 각각 약 1.2 kb과 약 0.7 kb의 PCR 산물을 얻었고(Fig. 1), 염기서열 분석결과 이들은 유추 아미노산 N-말단 도메인이 이소루신으로 시작하는 LMW-i유전자임을 확인하였다. Ikeda et al.(2002)의 N- 말단과 C-말단에 의한 12분류법에 의해 분석한 결과 타입 VI 의 그룹 11 또는 12였다. 이들의 분리된 유전자는 각 각 조경 II-2, CS III-5 그리고 금강 6-12로 명명하였다. 이들 각 유전자 들은 NCBI GenBank에 accession no KC136285, KC136286 그리고 KC136287로 등록하였다.

Fig. 1. PCR amplification products of LMW-GS genes from genomic DNA of three common wheat cultivars. Lane 1 DNA marker,lanes 2-4 PCR products of Jokyung, Chinese spring and Keumkang.

3품종 유래의 LMW-i 글루테닌 유전자 동정

 조경 II-2와 CS III-5의 open reading frame(ORF)는 1173 bp 로 동일하였고 이들의 유추 아미노산 서열을 분석한 결과, 20개의 시그널 펩타이드와 이소루신으로 시작하는(ISQQQQQPPFSQQ) 13개의 N-말단 부분, 그리고 글루타민이 많은 179개의 반복도메인 및 178개의 C-말단 부분으로 구성되어 있었으며 전형적인 LMW-GS i-type 유전자의 특성인 C-말단에 8개의 시스테인 잔기가 존재함을 알 수 있었다(Fig. 2, Table 2). 조경 II-2와 CS III-5의 유추 아미노산은 두 군데에서만 차이를 보여 거의 동일하였고 AB062868(Ikeda et al. 2002), FJ755303(Dong et al. 2010)의 아미노산 서열과 가장 높은 상동성(99%)을 보였다. 금강 6-12의 open reading frame (ORF)는 669 bp이며, 아미노산 서열을 분석한 결과 20개 잔기의 시그널 펩타이드, 이소루신으로 시작하는 13개 잔기의 N-말단 부분, 10개 잔기의 반복도메인 그리고 178개 잔기의 C-말단 부분으로 구성되어 있으며 C-말단에 전형적인 LMWGS i-type 유전자보다 시스테인 잔기가 하나 더 많은 9개의 시스테인 잔기가 존재하였다(Fig. 2, Table 2). 일반적으로 전형적인 LMW-GS i-type 유전자들은 C-말단의 상당히 보존된 위치에 8개의 시스테인 잔기가 존재하며 첫번째와 일곱번째 시스테인 잔기는 inter-molecular disulfide bond를 형성하고 나머지 시스테인들은 intra-molecular disulfide bond를 형성한다(D'Ovidio and Masci 2004). 금강 6-12의 여분의 시스테인 잔기는7번째 시스테인 잔기의 11잔기 앞에 존재하며 이것은 TAT(타이로신)가 TGT(시스테인)로 바뀐 결과이다(Data not shown). 금강 6-12의 염기서열은 Triticum monococcum 유래의 FJ41112와 가장 높은 상동성(97% identity)을 보였다.

Fig. 2. Multiple alignment of the deduced amino acid sequences of 16 LMW i-type glutenin genes including Jokyung II-2, Jokyung HQ 619933, Chinese spring III-5, keumkang 6-12 and other 12 LMW i-type glutenin genes. Signal peptide, N-terminal domain,repetitive domain and C- terminal which is further divided into C-terminal I (C-ter I), C-terminal II (C-ter II) and C-terminal III (C-ter III) are indicated. Cysteines are boxed by real lines.

Table.2. Comparison of primary structure properties of three LMW-i genes identified in this study with those previously published.

LMW-i 글루테닌 유전자의 SNP와 InDel 확인

 LMW-i 타입 글루테닌 유전자들 간의 SNP와 InDel을 확인하기 위해서 본 연구에서 클로닝된 조경 II-2, CS III-5 그리고 본 연구팀에서 이미 보고한 조경 HQ619933(Lee et al. 2010)과 기존 문헌에 나와 있는 6배 체 밀 유래의 X07747 (Pitts et al. 1988), AY542896(Cloutier et al. 2001), AB062878 (Ikeda et al. 2002), AY453154, AY453155, AY453156, AY453157, AY453158, AY453159 및 AY453160(Zhang et al. 2004)등 10개의 LMW-GS i 타입 유전자들과 다중염기서열 분석을 실시하였고, 이들 사이에서 15개의 SNP와 1개의 insertion이 확인되었다(Table 1). 조경 II-2와 CS III-5 는 AB062878(Ikeda et al. 2002)과 높은 상동성을 보였고, 이들 3종의 유전자와 다른 LMW-i 타입 글루테닌 유전자들 사이에는 11개의 SNP가 보였다. 조경 II-2와 CS III-5 그리고 나머지 LMW-i 타입 글루테닌 유전자들 사이에는 2개의 SNP가 있었고, CS III-5 와 조경 HQ619933는 각각 나머지 LMW-i 타입 글루테닌 유전자들 사이에 각각 1개의 SNP가 발견되었다. 조경 II-2, CS III-5및 AB062878와 다른 나머지 MW-i 타입 글루테닌 유전자들 사이에 염기서열 171-179 bp에서 insertion이 있음을 확인하였다. 15개의 SNP중 12개의 염기전이(A-G 또는 C-T)와 3개의 염기전환(A-T, A-C, C-G 또는 G-T)이 확인되었다. 이들 SNP에서 아미노산 변이(nonsynonymous SNP)는 조경 II-2, CS III-5 그리고 AB 062878와 나머지 LMW-i 타입 글루테닌 유전자들 사이에 6개, 조경 II-2 그리고 CS III-5와 나머지 LMW-i 타입 글루테닌 유전자들 사이에 1개, 조경 HQ6199333와 나머지 LMW-i 타입 글루테닌 유전자들 사이에 2개, CS III-5와 나머지 LMW-i 타입 글루테닌 유전자들 사이에 1개 등 총 10개를 확인하였다.

Table.1. The Positions of SNPs and InDels identified in the three novel LMW-i genes.

Glu-A3 유전자 좌와 단백질과의 상관관계

 이전 연구에서(Lee et al. 2010) 조경 밀 품종에서 milky stage의 종자의 mRNA 를 추출, cDNA를 합성하였고 이 cDNA를 주형으로 LMW-GS 특이 프라이머를 이용하여 LMW-GS유전자를 분리하여 Ikeda 분류법으로 이들의 N-말단과 C-말단 아미노산 서열로 이들을 12개 그룹으로 분류하였다. 또한 종자에서 글루테닌 단백질을 추출하여 2DE을 실시하고 이들의 각 스팟을 N-말단아미노산서열결정 실험을 실시하여 LMW -GS 유전자와 단백질의 관계를 확인하였다. N-말단 아미노산 서열분석 결과, Glu-B3와 Glu-D3 유전자 좌의 LMW-S 또는 LMW-m 타입의 저분자글루테닌 단백질들만 확인할 수 있었다. 이는 이차원전기영동 시 Glu-A3 유래의 단백질로 추정되는 스팟이 단일 스팟이 아닌 여러 개로 혼재하여 특정 N-말단 아미노산서열 분석 결과를 얻을 수 없었다. 조경밀 cDNA에서 클로닝된 Glu-A3 유전자 [HQ6199333, Lee et al.(2010)]의 Nucleotide BLAST결과 미국 밀품종 Chenyenne의 Glu-A3c와 99% 상동성을 보였다. Park et al.(2011)의 조경 Glu-A3의 유전자 좌는 Glu-A3c로 보고된 바 있어 본 연구에서는 밀 품종 조경의 Glu-A3 단백질을 동정하기 위해 글루테닌을 추출 이차원전기영동을 하고 Glu-A3c 위치의 스팟을 절취하여 트립신 in-gel digestion한 후 LC-ESI MS/MS 분석을 수행 하였다(Fig. 4). 분자량, pI값, MASCOT 점수 값을 확인한 결과 gi|41445895와 MASCOT 점수 값이 77로 가장 높았다. gi|41445895 단백질은 LMW-GS i 타입이며 Cheyenne의 Glu-A3c 와 조경 HQ619933와 전체 아미노산 수는 376개로 같으며 한 개의 아미노산 구성만 달랐다. 따라서 조경의 Glu-A3 유전자 좌는 Glu-A3c으로 설명 할 될 있다.

Fig. 3. Phylogenic tree showing the relationship among LMW i-type genes from common wheats and wheat realtives. Numbers at branch points indicate bootstrap support (1000 replicates).

Fig. 4. Profiles of glutenin fraction from the wheat cultivar Jokyung for LC-ESI MS/MS identification. A, Two dimensional gel electrophoresis; B, SDS-Polyacrylamide gel electrophoresis. Spot of the Glu-A3c are indicated.

 Ikeda et al.(2006)은 Norin 61과 Cheynne, Chinese spring, Gabo, Glenlea, Insignia, Rescue 그리고 Orca등 8개 보통 밀품종에서 글루테닌 단백질을 추출하여 이차원전기영동을 실시하였고 각 품종의 LMW-GS 스팟들을 N-말단 아미노산 분석하여 이들의 N-말단 아미노산 서열을 기준으로 이들 단백질을 분류한 바있다. Norin 61(Glu-A3d)의 LMW-GS i타입에 해당되는 세 개의 스팟을 확인하였고 이들은 그룹 11 이 한개, 그룹 12이 두 개였다. Cheynne(Glu-A3c), Chinese spring(Glu-A3a), Gabo(Glu-A3b), Glenlea(Glu-A3g), Insignia(Glu-A3e) 그리고 Rescue(Glu-A3 f ) 는 그룹 11 이 각각 1개씩, 그리고 Orca(Glu-A3d )는 그룹 11 한 개 그룹 12두 개를 확인하였다. Norin 61이외의 7개 품종의 Glu-A3 유전자 좌는 SDS-PAGE로 밝혀졌지만(Gupta and Shepherd 1990; Zhang et al. 2004), Glu-A3 allele(LMW-GS i 타입)의 단백질을 동정한 것은 Ikeda 그룹이 처음이다. Ikeda et al.(2006)의 연구결과에서 알 수 있듯이 Glu-A3d 유전자 좌는 다른 유전자 좌들을 비해 스팟 수(3개)가 많으며, 또한 이러한 Glu-A3d 유전자 좌를 가진 품종들은 좋은 SDS 침강계수 및 신장성을 가진다는 연구 결과가 보고되었다(Branlard et al. 2001; Gupta and MacRitchie. 1991). 위의 연구들에서 반복 도메인이 아주 짧은 short type i 타입 LMW-GS의 단백질이 확인되었는지는 명확하지 않다. 하지만 이러한 short type i 타입 LMW-GS 단백질이 종자 단백질의 발달 단계에서 글루텐 폴리머 형성 중에 반응 종결자(chain terminator)로서 역할을 하는 것으로 추정되고 있으나 추후 더 많은 연구가 진행되어야 할 것이다.

LMW-i 글루테닌 유전자의 계통도 분석

 LMW-i 타입 글루테닌 유전자들의 연관 관계를 분석하기 위해 본 연구에서 분리 한 조경 II-2, CS III-5, 금강 6-12 그리고 조경 HQ6199333(Lee et al. 2010)와 Genebank DB의 35개의 LMW-i 타입 글루테닌 유전자의 유추 아미노산 서열을 CLUSTAL W 알고리즘을 이용하여 다중서열 분석을 하고 MEGA 4 프로그램을 이용하여 Phylogenic tree를 완성하였다. 이들 유전자들은 6배체 밀(T. aestivum) 유래의 X07747(Pitts et al. 1988), AY542896(Cloutier et al. 2001), AB062876 그리고 AB062878(Ikeda et al. 2002), AY453154, AY453155, AY453156, AY453157, AY453158, AY453159 그리고 AY453160(Zhang et al. 2004), FJ549928, FJ549929, FJ549930, FJ549931, FJ549932, FJ549933 그리고 FJ549934 (Wang et al. 2010), U86030(Colot et al. 1989), FJ876819, FJ876820, FJ876821, FJ876822 이고, 4배체 밀(T. turgidum) 유래의 유전자는 DQ217661, 이배체 밀(T. onococcum) 유래의 유전자는 FJ441107, FJ441110, FJ441111, FJ441112, FJ441113, FJ441114(Vaccino et al. 2009), DQ307388, DQ307389, DQ345499(An et al. 2006), DQ307386, EF536037 포함하였다. 이들 39개의 계통도 분석 결과 이배체 밀인 T.monococcum과 4배체 밀의 T. turgidum의 LMW-i 타입 글루테닌이 육배체 밀의 LMW-i 타입 글루테닌과 크게 나눠지는 것을 확인하였다. 이것은 육배체 밀의 A 염색체가 이배체밀로부터 유래했다는 것을 의미한다. 또한 육배체 밀의 LMW-i타입 글루테닌들은 GluA3a부터 GluA3g까지 7개 subgroup으로 나눠지는 것을 확인하였다. 금강 6-12는 GluA3a와 GluA3c사이에 존재하였고 조경 II-2와 CS III-5는 GluA-3d 와 일본 연질 밀인 농림 61의 AB062878과 같은 subgroup에 존재하였고 다중서열분석결과에서도 동일한 결과를 얻었다(Fig 2).Phyiogenic tree 분석결과 조경 HQ6199333은 Glu-A3c subgroup에 위치하였고 이것은 다중서열분석결과와 Park et al.(2010)의 SDS-PAGE 결과와도 일치하며 본 연구에서 실시한 이차원전기영동실험에서 Glu-A3c 위치의 스팟의 LC-ESI MS/MS의 결과 값이 Glu-A3c(gi|41445895)와 일치하는 것을 볼 때 조경 HQ6199333이 조경밀의 Glu-A3c임을 제시한다.

LMW-i 글루테닌 유전자의 구조와 마커 개발

 Zhang et al.(2004)은 Glu-A3 유전자들의 반복 도메인의 length polymorphism을 이용하여 Glu-A3a, b, c, d, e, f, g 7개의 대립유전자를 구별할 수 있는 PCR marker와 multiplex marker를 개발하였다. SDS-PAGE를 이용하여 Glu-A3유전자 좌를 구별하는 것은 매우 어렵기 때문에 이러한 Glu-A3 유전자 좌 특이 마커는 밀가루 가공적성을 개량하기 위한 밀육종 프로그램에는 반드시 필요하다. Fig. 2와 Table 2에서 볼 수 있듯이 LMW-i 타입 글루테닌 유전자의 반복 도메인은 length polymorphism은 179~149개 정도의 long 타입과 91, 51, 10, 2개의 short 타입으로 나눠지고 이것은 long 타입과 short 타입 LMW-i 타입 글루테닌 유전자를 구분 할 수 있는 마커 개발을 위한 근거가 된다. Ikeda et al.(2006)이 여러 빵밀 품종에서 LMW-i 타입 글루테닌 단백질을 확인 하였지만 아직 LMW-i 타입 글루테닌 유전자들(Glu-A3 allele들)의 protein product들을 완벽히 확인하고 동정한 연구는 거의 없다. 이들 다양한 length polymorphism의 LMW-i 타입 글루테닌 단백 질들이 식물 발달 단계 또는 글루텐 고분자 형성 시 역할을 하리라고 생각된다.

LMW-i 글루테닌 단백질 구조와 가공적성과의 관계

 Fig. 5에서 볼 수 있듯이 금강 6-12를 제외한 LMW-i 글루테닌 서브유닛은 상당히 conserved 된 위치에 8개의 시스테인 잔기가 존재하며 이들은 모두 C-말단 부위에 위치한다. 이것은 8개의 시스테인 잔기가 N-말단 부위 또는 반복도메인에 존재하는 LMW-m, LMW-s 타입의 글루테닌 서스유닛 시스테인 잔기의 위치에 있어서 큰 차이를 보인다. 이러한 시스테인 잔기의 위치와 개수의 차이가 가공성의 차이를 보일 수 있다(특히 LMW-i subunit에서) (D’Ovidio and Masci 2004). 잘 알려진 대로 첫번째와 일곱번째 시스테인 잔기는 intermolecular disulfide bond를 형성하고 나머지 시스테인들은 intra-molecular disulfide bond를 형성하는데 이러한 차이로 인해 LMW-i 글루테닌 서브유닛은 LMW-m, LMW-s 타입의 글루테닌 서브유닛과 확연히 다른 이차, 삼차 단백질 구조를 취하고 이러한 구조의 차이는 가공성의 차이로 이어진다는것이다(Lew et al. 1992; Masci et al. 1998; D’Ovidio and Masci 2004). Cloutier et al.(2001)은 LMW-m, LMW-s 타입과는 다르게 C-말단 부위에 위치하는 시스테인 잔기들 중 특히 두 번째와 세 번째 시스테인 잔기 간에 형성된 disulfide bond loop가 글루테닌 단백질의 점탄성(viscoelastic properties)에 영향을 미친다고 설명하고 있다. 또한 Ikeda et al.(2002)은 LMW-i 타입 글루테닌 서브유닛은 LMW-m, LMW-s 타입 글루테닌 서스유닛과 달리 분자 내 이황화 결합에 관여하는 시스테인 잔기가 C-말단에 존재하기 때문에 분자 내 이황화 결합을 형성하지 못하고 polymerizatinon 형성 시 chainterminator의 역할을 하게 되어 궁극적으로는 글루텐 폴리머 크기를 줄이고 약한 글루텐 성질을 나타낼 것으로 추측하였다. 아직 LMW-i 타입 글루테닌 서브유닛의 가공적성에 관련하여 상세한 메커니즘은 밝혀지지 않았다. 이 타입의 시스테인 결합의 역할에 대한 in vivo, in vitro 실험 등 보다 자세한 분석이 필요하다.

Fig. 5. Diagrams representing the structures of typical LMW-GS as deduced from their encoding genes. Inverted triangle and encircled inverted triangle indicate the position of cysteine involved in intra- and inter-molecular disulfide bond, respectively.

적 요

 국내 밀 품종 조경, 금강 그리고 중국 밀 품종인 Chinese spring의 genomic DNA를 주형으로 LMW-GS 특이 프라이머세트를 이용하여 3개의 새로운 LMW-GS i 타입 유전자를 분리하였고 이들의 분리된 유전자는 각 각 조경 II-2, CS III-5 그리고 금강 6-12로 명명하였다. 이들의 유추 아미노산을 분석한 결과 20개의 시그널 펩타이드, 이소루신으로 시작하는 N-말단 부분 그리고 글루타민이 많은 반복도메인 그리고 C-말단 부분으로 구성되어 있으며 조경 II-2와 CS III-5는 전형적인 LMW-GS i-type 유전자처럼 C-말단에 8개의 시스테인 잔기가 있었다. 금강 6-12는 특이하게도 하나 더 많은 9개의 시스테인 잔기가 존재하였는데 이 여분의 시스테인 잔기는7번째 시스테인 잔기의 11잔기 앞에 존재하며 TAT(타이로신)이 TGT(시스테인)로 바뀐 결과이다. LMW-i 타입 글루테닌 유전자들 간의 SNP와 InDel을 확인하기 위해서 본 연구에서 클로닝 된 조경 II-2, CS III-5 그리고 이전에 본 그룹에서 확인된 조경 HQ619933와 기존 문헌에 나와 있는 6배체 밀 유래의 10개의 LMW-GS i 타입 유전자들과 다중염기서열 분석을 실시하였고, 이들 사이에서 15개의 SNP와 1개의 insertion이 확인되었다. 밀 품종 조경의 Glu-A3 단백질을 동정하기 위해 글루테닌을 추출 이차원전기영동을 하고 Glu-A3c 위치의 스팟을 절취하여 in-gel digestion한 후 LC-ESI MS/MS 분석을 수행한 결과 조경의 i 타입 LMW-GS 유전자좌는 Glu-A3c로 확인되었다. LMW-i 타입 글루테닌 유전자들의 연관 관계를 분석하기 위해 본 연구 그룹에서 클로닝 한 조경 II-2, CS III-5, 금강 6-12 그리고 조경 Q6199333와 Genebank DB의 35개의 LMW-i 타입 글루테닌 유전자의 유추 아미노산 서열을 이용하여 Phylogenic tree를 완성하였다. 이들 39개의 계통도 분석 결과 이배체 밀과 4배체 밀의 LMW-i 타입 글루테닌이 육배체 밀의 LMW-i 타입 글루테닌과 크게 나눠지는 것을 확인하였으며, 육배체 밀의 LMW-i 타입 글루테닌들은 Glu-A3a부터 GluA-3g까지 7개 subgroup으로 나눠지는 것을 확인하였다. 금강 6-12는 GluA-3a와 GluA-3c 사이에 존재하였고 조경 II-2와 CS III-5는 GluA-3d와 일본 연질 밀인 농림 61의 AB062878과 같은 subgroup에 존재하였고 조경 HQ6199333은 Glu-A3c subgroup에 위치하였다. LMW-i 타입 글루테닌 유전자들의 유추 아미노산 다중서열분석결과 반복 도메인은 length polymorphism은 179~149개 정도의 long 타입과 91, 51, 10, 2개의 short 타입으로 나눠지고 이것은 long 타입과 short 타입 LMW-i 타입 글루테닌 유전자를 구분 할 수 있는 마커의 근거가 된다.

사 사

 본 연구는 농촌진흥청 국립농업과학원 농업과학기술 연구개발사업(과제번호:PJ907133, PJ006680)의 지원에 의해 이루어진 것임.

Reference

1.An X, Zhang Q, Yan Y, Li Q, Zhang Y, Wang A, Pei Y, Tian J, Wang H, Hsam SLK, Zeller FJ. 2006. Cloning and molecular characterization of three novel LMW-I glutenin subunit genes from cultivated einkorn (Triticum monococcum L.). Theor Appl Genet 113: 383-395.
2.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248-254.
3.Branlard G, Dardevet R, Saccomano F, Lagoutte F, Gourdon J. 2001. Genetic diversity of wheat storage proteins and bread wheat quality. Euphytica 119: 59-67.
4.Cornish GB, Burridge PM, Palmer GA, Wrigley CW 1993. Mapping the origins of some HMW and LMW glutenin subunit alleles in Australian germplasm. Proceedings of the 42nd Australian Cereal Chemistry Conference, Sydney, pp.255-260.
5.Cloutier S, Rampitsch C, Penner GA, Lukow OM. 2001. Cloning and expression of a LMW-i glutenin gene. J. Cereal Sci. 33: 143-154.
6.Colot V, Bartels D, Thompson R, Flavell R. 1989. Molecular characterization of an active wheat LMW glutenin gene and its relation to other wheat and barley prolamin genes. Mol Gen Genet 216: 81-90.
7.D'Ovidio R, Masci S. 2004. The low-molecular-weight glutenin subunits of wheat gluten. J Cereal Sci 39: 321-339.
8.Dong L, Zhang X, Liu D, Fan H, Sun J et al. 2010. New insights into the organization, recombination, expression and functional mechanism of low molecular weight glutenin subunit genes in bread wheat. PLoS ONE 5: e13548.
9.Gupta RB, MacRitchie F. 1991. A rapid one-step onedimensional SDS-PAGE procedure for analysis of subunit composition of glutenin in wheat. J Cereal Sci 14: 105-109.
10.Gupta RB, MacRitchie F. 1994. Allelic variation at glutenin subunit and gliadin loci, Glu-1, Glu-3, and Gli-1, of common wheats. II. Biochemical basis of the allelic effects on dough properties. J Cereal Sci 19: 19-29.
11.Gupta RB, Singh NK, Sheperd KW. 1989. The cumulative effects of allelic variation in LMW and HMW glutenin subunits on physical dough properties in the progeny of two bread wheats. Theor Appl Genet 77: 57-62.
12.Gupta RB, Bekes F, Wrigley CW. 1990. Predicting values of LMW glutenin alleles for dough quality of bread wheat. In: Bushuk W, Tkachuk R (eds) Gluten proteins 1990. American Association of Cereal Chemists, St. Paul, Minnesota, USA, pp.615-621.
13.Gupta RB, Bekes F, Wrigley CW. 1991. Prediction of physical dough properties from glutenin subunit composition in bread wheats: correlation studies. Cereal Chem 68: 328-333.
14.Gupta RB, Paul JG, Cornish GB, Palmer GA, Bekes F, Rathjen AJ. 1994. Allelic variation at glutenin subunit and gliadin loci, Glu-1, Glu-3, and Gli-1, of common wheats. I. Its additive and interaction effects on dough properties. J Cereal Sci 19: 9-17.
15.Gupta RB, Shepherd KW. 1990. Two-step one-dimensional SDS-PAGE analysis of LMW subunits of glutenin. I. Variation and genetic control of the subunits in hexaploid wheats. Theor Appl Genet 80: 65-74.
16.Jackson EA, Morel M-H, Sontag-Strohm T, Branlard G, Metakovsky, Radaelli R. 1996. Proposal for combining the classification systems of alleles of Gli-1 and Glu-3 loci in bread wheat (Triticum aestivum L.) J Genet Breed 50: 321-336.
17.Lee JY, Kim YT, Kim BM, Lee JH, Lim SH, Ha SH, Ahn SN, Nam MH, Kim YM. 2010. Cloning of Lowmolecular-weight Glutenin Subunit Genes and Identification of their Protein Products in Common Wheat (Triticum aestivum L.) Kor J Breed Sci 42: 547-554.
18.Ikeda TM, Araki E, Fujita Y, Yano H. 2006. Characterization of low-molecular-weight glutenin subunit genes and their protein products in common wheats. Theor Appl Genet 112: 327-34.
19.Ikeda TM, Nagamine T, Fukuoka H, Yano H. 2002. Identification of new low-molecular-weight glutenin subunit genes in wheat. Theor Appl Genet. 104: 680-687.
20.Lew EJL, Kuzmicky DD, Kasarda DD. 1992. Characterization of low molecular weight glutenin subunits by reversed-phase high-performance liquid chromatography, sodium dodecylsulfate-polyacrylamide gel electrophoresis, and N-terminal amino acid sequencing. Cereal Chem 69: 508-515.
21.Maruyama-Funatsuki W, Takata K, Nishio Z, Tabiki T, Yahata E, Kato A, Saito K, Funatsuki H, Saruyama H, Yamauchi H. 2004. Identification of lowmolecular-weight glutenin subunits of wheat associated with bread-making quality. Plant Breed 123: 355-360.
22.Masci S, D'Ovidio R, Lafiandra D, Kasarda DD. 1998. Characterization of a lowmolecular-weight glutenin subunit gene from bread wheat and the corresponding protein that represents a major subunit of the glutenin polymer. Plant Physiol 118: 1147-1158.
23.Metakovsky EV, Wrigley CW, Bekes F Gupta RB. 1990. Gluten polypeptides as useful genetic markers of dough quality in Australian wheats. Aust J Agric Res 41:289-306.
24.Nieto-Taladriz MT, Perretant MR, Rousset M. 1994. Effect of gliadins and HMW and LMW subunits of glutenin on dough properties in the F1 recombinant inbred lines from a bread wheat cross. Theor Appl Genet 88: 81-88.
25.Park CS, Kang CS, Jeung JU and Woo SH. 2011. Influence of allelic variations in glutenin on the quality of pan bread and white salted noodles made from Korean wheat cultivars. Euphytica 180: 235-250.
26.Payne PI, Seekings JA, Worland AJ, Jarvis MG, Holt LM. 1987. Allelic variation of glutenin subunits and gliadins and its effect on bread making quality in wheat: analysis of F5 progeny from Chinese Spring (Hope 1A). J Cereal Sci 6: 103-118.
27.Pitts EG, Rafalski JA, Hedgcoth C. 1988. Nucleotide sequence and encoded amino acid sequence of a genomic gene region for a low molecular weight glutenin. Nucleic Acids Res 16: 11376.
28.Pogna NE, Autran JC, Mellini F, Lafiandra D, Feillet P. 1990. Chromosome 1B-encoded gliadins and glutenin subunits in durum wheat: genetics and relationship to glutenin strength. J Cereal Sci 11: 15-34.
29.Ruiz M, Carrillo JM. 1995. Separate effects on gluten strength of Gli-1 and Glu-3 prolamine genes on chromosomes 1A and 1B in durum wheat. J Cereal Sci 21:137-144.
30.Shewry PR, Halford NG, Tatham AS. 1992. High molecular weight subunits of wheat glutenin. J Cereal Sci 15: 105-20.
31.Shewry PR, Tatham AS, Barro F, Barcelo P, Lazzeri P. 1995. Biotechnology of bread-making, unraveling and manipulating the multi-protein gluten complex. Biotechnology 13: 1185-1190.
32.Singh NK, Shepherd KW and Cornish GB. 1990. A simplified SDS-PAGE procedure for separating LMW subunits of glutenin. J Cereal Sci 14: 203-208.
33.Sontag-Strohm T, Payne PI, Saovaara H. 1996. Effect of allelic variation of glutenin subunits and gliadins on baking quality in the progeny of two biotypes of bread wheat cv. Ulla. J Cereal Sci 24: 115-124.
34.Vaccino P, Becker HA, Brandolini A, Salamini F, Kilian B. 2009. A catalogue of Triticum monococcum genes encoding toxic and immunogenic peptides for celiac disease patients. Mol Genet Genomics 281: 289-300.
35.Wieser H. 2007. Chemistry of gluten proteins. Food Micro 24: 115-119.
36.Wang LH, Li G, Pena RJ, Xia X, He Z. 2010. Development of STS markers and establishment of multiplex PCR for Glu-A3 alleles in common wheat (Triticum aestivum L.). J Cereal Sci 51: 305-312.
37.Zhang W, Gianibelli MC, Rampling L, Gale KR. 2004. Characterisation and marker development for low molecular weight glutenin genes from Glu-A3 alleles of bread wheat (Triticum aestivum. L) Theor Appl Genet. 108: 1409 -1419.
38.Zuo X, Echan L, Hembach P, Tang HY, Speicher KD, Santoli D and Speicher DW. 2001. Towards global analysis of mammalian proteomes using sample prefractionation prior to narrow pH range two-dimensional gels and using one-dimensional gels for insoluble large proteins. Electrophoresis 22: 1603-1615.