Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 4.

List of 61 SNP markers that were developed into HRM marker type. These markers were polymorphic between ‘920533’ and ‘PI 189225’ using HRM analysis.

Marker namez Chromosome SNP position (bp)y Forward primer (5’→3’) Reverse primer (5’→3’)
WGRS002 1 1,043,418 GGTGGTACCCAATTTGTCCCT AACAGGAAGCCGGCTAGAAA
WGRS006 1 3,819,913 GCGATCAAGAGACAAACGGG TGCGAAGGATGCTTGGTTCT
WGRS011 1 9,325,855 AGGTGCTTAGGAGGTGGAGA CCGCCATGAGAGGAGGTTAG
WGRS017 1 20,202,103 ACGGCAAGCAGTGAAGGTAT GGGGAGAGATGATCGAGCAC
WGRS018 1 22,049,812 TGGGAACTGAGAAGACTGCC GACTTCCACTTCCAACCCCT
WGRS028 1 30,705,477 TGGATATTCCCTCGCTCCAA TTGCTGCTCTTCAAATGGGC
WGRS030 1 33,601,876 GGACAAACCTGGCCCACTAA TCGAAAAGCAGCAGAGGCA

WGRS039 2 13,988,030 AACGGAGCTAATCGACGACC ACAAGGCCCAAGAGATTTAGGA
WGRS046 2 26,782,186 GCCCTGTCAGTGAACCATCA ACAGACCTGAGAATCACTAGCT
WGRS048 2 29,195,322 AGCGTGTGGTTTTGACTTGAG AGATGTAATGCGATGCAGTTGC

WGRS054 3 3,074,543 CGTCTCCAACTCCATCTCCG CTGAGGGGGTTGATGACGAG
WGRS061 3 11,069,946 GTGGGAGGGGAAAACGGATT CATTTTCTTCGGAGCTGGCG
WGRS066 3 20,298,449 TGCAGCCCATGAAAGTGCTA GTGTTTATTGTTCCGCCAGCT
WGRS072 3 25,926,099 GCTCTTCCATTGCTCCTGGA GCAGGGTTCTATGGTCGAGT
WGRS074 3 26,809,484 CGCTATCAGCCGACAAAAGC TCGAGGAAGCTTGCACCAAT

WGRS091 4 5,970,325 TGTGCTGATTGTGGACCTCC AGCTTGCTCATTCCTCTCGT
WGRS095 4 8,233,892 GGTGGCCTCACTATTACCGG GGTTTAGAGGTGGAAGGGGTG
WGRS098 4 10,824,802 TAAGACCCAACCGAACTGCC GCAGGCTGCTCTAACAAAGC
WGRS100 4 13,147,227 TGGTAGAAAATGGCAACGCG GATCAAGGACGGGAATGGGA
WGRS101 4 15,102,363 GGCAAAAGCAGACCCTGTTG CCAGTTCCACCAAGCAAACC
WGRS107 4 17,910,257 TGCCAAGAGAATGCAACACG ATGGAGGACATTGCTTGCCA

WGRS121 5 1,577,748 GGGGTTCCATTCCCTAAGGG GGCGAGATGGTCAAACTCCT
WGRS122 5 2,108,735 AGAACCCCCAACCAAAGCTT TCCCCTGCCTTTGCTTGATT
WGRS124 5 4,255,857 CCAGGCATCCAATCGAGGAA CGTCCATAAAGTTGTGGCCC
WGRS126 5 6,580,137 AGTCCGTTGTCCAGTTTCGA AACAGTAGCCCAAGAGCTGG

WGRS148 6 36,471 GTGCTGCTCCTGGTCTCTAA ACTCAATGGGTGCTTGTGGT
WGRS151 6 1,670,897 GCCATTTGATTCCTCACCGC GAGCTGCCCGTAATGCAATG
WGRS152 6 2,870,018 GCTGCGATCGTGTTCACATC CAGAGGCCAAGACCCAGAAT
WGRS170 6 18,074,367 GCTGTGCTTCTTGTGGCAAA AGAGAACATCAACACGGCGT
WGRS171 6 19,159,722 AGAGCTTTTCGTCATGGCCA TCCAGGTTTGGTTTCCGACA
WGRS172 6 20,013,243 TAGGTCAGCCCTCCCTCAAA CGTTCGAGTAATCCTCCGGG
WGRS174 6 21,093,377 TGGAGTGTTTGACTGTGGGG TCTCCATCTCCAGCCATCCT
WGRS177 6 22,055,693 AAGTGGCAATACCTGACCCC ACTACTCTGCAGCTCATGGC
WGRS186 6 26,890,432 CCTGCTTGTGGACCTGGAAT GCAACCATGCGCACATAACT

WGRS190 7 3,830,477 ATCCGCAGATTCACAGGGAG GGCGCTTAAATCTGGTTCCC
WGRS194 7 6,714,580 CGTTGTTTGCAAGCTCCCAA GCCTCCGCTTCCGATTCTTA
WGRS200 7 16,377,893 AGAATCTTGCCACCTTAGGG TCGGTGGTGACTGAGAAACA
WGRS203 7 21,480,403 AATTGGAGGGTCAAGGGGTG TGCTCGTTTCATCAAAAGCCA
WGRS208 7 26,134,906 TGGGCTACATTGTTCTGCCT GCTTCAAGTTTCCTTGCCTGT
WGRS209 7 27,405,979 TGGTGGTGGAGGCAATCAAA GGGGGTTATGCCTGAAACAA
WGRS212 7 30,620,572 TGCTTGGGTTGTATCACTGACA TGGTGTGGCAGGTAATTGGA
WGRS213 7 31,054,142 AATTCTTTGCGCACTCGTGG ATCCACTCTGAGCAATTGGC

WGRS220 8 7,024,617 AACAGTCAACACCCAGCCTT TTGAGGTGGTCTTTCCGAGC
WGRS221 8 7,889,760 GTGACAACCAAGCAGCACTG TCCTGCCCAACTTGTTCCTC
WGRS225 8 10,733,107 CTTCTGCCATTAAACGCCCA GGGTTCAATCATTGTGGTCACC
WGRS226 8 11,279,464 TGCTGGCCCCACTCAATAAA AGGACCGGGTCTCAATCTCA
WGRS227 8 11,656,539 AGTTCTAACGACACGAGGGC TTGTACCAGACTGCGAGCAA
WGRS229 8 15,003,269 CCTTGTGCAACCAAAGCTGT GACAGCGGTTGCATCAGTTC
WGRS233 8 17,637,101 GTAGACACTCTTAGCCGGGC TCCTGCATTGTGTGGTTCCA
WGRS235 8 18,473,596 ACTGTGTGCACTCACCTGTT CGGACATCTGCTGAGGAGTT
WGRS240 8 20,663,001 ACGGCTGGTCTCATGTTCAA TAGGGTTTGGTGCTGGTGAC

WGRS254 9 4,555,267 TGGCTAACCATGGGTTGCAT AGTTTGTTCCAGCGCCATTG
WGRS263 9 16,573,290 GAGTGCTGATGGAAGCTGGA TGCTCCATATGGAAGCAAGTCA
WGRS271 9 29,654,845 TGCACATTGTGTCACTCTACGA CATTGCCTAGAATTTGCCGGG
WGRS272 9 30,799,073 CTAGATTCCTGCGGATGCCT ACCCATACCTTCTCGCGAAA

WGRS281 10 6,101,884 GCCGGTAGTTTCTGACCCAA AGGTTCAAGAAGTGGCGGAG
WGRS287 10 14,082,501 ACAATGCCTCCACCTTTCCA GTAGCAGCAACAGTGGCAAA
WGRS297 10 27,692,702 TGGCAGTGTTGTACTTGGGT AGGGCTTGGAGACTTTTGCA

WGRS307 11 6,959,074 GAGGGTGAGTTTCTGGTGGG CACGCACACTTCACGCTTAA
WGRS316 11 14,891,680 GTGCCTCTGCTTCTCAGGTT TGGCAGTTTTAGGCTTTTCAGT
WGRS326 11 24,272,773 CAGGTTCCTGAAGCAGCTGA GCTGAATCTACCAGGCAACA

SNP (HRM) markers developed in this study and WGRS is the abbreviation for watermelon gummy stem blight resistance SNP.

Position of SNP on reference genome.

Korean J Breed Sci 2018;50:424-33 https://doi.org/10.9787/KJBS.2018.50.4.424
© 2018 Korean J Breed Sci