Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 4.

List of 61 SNP markers that were developed into HRM marker type. These markers were polymorphic between ‘920533’ and ‘PI 189225’ using HRM analysis.

Marker namezChromosomeSNP position (bp)yForward primer (5’→3’)Reverse primer (5’→3’)
WGRS00211,043,418GGTGGTACCCAATTTGTCCCTAACAGGAAGCCGGCTAGAAA
WGRS00613,819,913GCGATCAAGAGACAAACGGGTGCGAAGGATGCTTGGTTCT
WGRS01119,325,855AGGTGCTTAGGAGGTGGAGACCGCCATGAGAGGAGGTTAG
WGRS017120,202,103ACGGCAAGCAGTGAAGGTATGGGGAGAGATGATCGAGCAC
WGRS018122,049,812TGGGAACTGAGAAGACTGCCGACTTCCACTTCCAACCCCT
WGRS028130,705,477TGGATATTCCCTCGCTCCAATTGCTGCTCTTCAAATGGGC
WGRS030133,601,876GGACAAACCTGGCCCACTAATCGAAAAGCAGCAGAGGCA

WGRS039213,988,030AACGGAGCTAATCGACGACCACAAGGCCCAAGAGATTTAGGA
WGRS046226,782,186GCCCTGTCAGTGAACCATCAACAGACCTGAGAATCACTAGCT
WGRS048229,195,322AGCGTGTGGTTTTGACTTGAGAGATGTAATGCGATGCAGTTGC

WGRS05433,074,543CGTCTCCAACTCCATCTCCGCTGAGGGGGTTGATGACGAG
WGRS061311,069,946GTGGGAGGGGAAAACGGATTCATTTTCTTCGGAGCTGGCG
WGRS066320,298,449TGCAGCCCATGAAAGTGCTAGTGTTTATTGTTCCGCCAGCT
WGRS072325,926,099GCTCTTCCATTGCTCCTGGAGCAGGGTTCTATGGTCGAGT
WGRS074326,809,484CGCTATCAGCCGACAAAAGCTCGAGGAAGCTTGCACCAAT

WGRS09145,970,325TGTGCTGATTGTGGACCTCCAGCTTGCTCATTCCTCTCGT
WGRS09548,233,892GGTGGCCTCACTATTACCGGGGTTTAGAGGTGGAAGGGGTG
WGRS098410,824,802TAAGACCCAACCGAACTGCCGCAGGCTGCTCTAACAAAGC
WGRS100413,147,227TGGTAGAAAATGGCAACGCGGATCAAGGACGGGAATGGGA
WGRS101415,102,363GGCAAAAGCAGACCCTGTTGCCAGTTCCACCAAGCAAACC
WGRS107417,910,257TGCCAAGAGAATGCAACACGATGGAGGACATTGCTTGCCA

WGRS12151,577,748GGGGTTCCATTCCCTAAGGGGGCGAGATGGTCAAACTCCT
WGRS12252,108,735AGAACCCCCAACCAAAGCTTTCCCCTGCCTTTGCTTGATT
WGRS12454,255,857CCAGGCATCCAATCGAGGAACGTCCATAAAGTTGTGGCCC
WGRS12656,580,137AGTCCGTTGTCCAGTTTCGAAACAGTAGCCCAAGAGCTGG

WGRS148636,471GTGCTGCTCCTGGTCTCTAAACTCAATGGGTGCTTGTGGT
WGRS15161,670,897GCCATTTGATTCCTCACCGCGAGCTGCCCGTAATGCAATG
WGRS15262,870,018GCTGCGATCGTGTTCACATCCAGAGGCCAAGACCCAGAAT
WGRS170618,074,367GCTGTGCTTCTTGTGGCAAAAGAGAACATCAACACGGCGT
WGRS171619,159,722AGAGCTTTTCGTCATGGCCATCCAGGTTTGGTTTCCGACA
WGRS172620,013,243TAGGTCAGCCCTCCCTCAAACGTTCGAGTAATCCTCCGGG
WGRS174621,093,377TGGAGTGTTTGACTGTGGGGTCTCCATCTCCAGCCATCCT
WGRS177622,055,693AAGTGGCAATACCTGACCCCACTACTCTGCAGCTCATGGC
WGRS186626,890,432CCTGCTTGTGGACCTGGAATGCAACCATGCGCACATAACT

WGRS19073,830,477ATCCGCAGATTCACAGGGAGGGCGCTTAAATCTGGTTCCC
WGRS19476,714,580CGTTGTTTGCAAGCTCCCAAGCCTCCGCTTCCGATTCTTA
WGRS200716,377,893AGAATCTTGCCACCTTAGGGTCGGTGGTGACTGAGAAACA
WGRS203721,480,403AATTGGAGGGTCAAGGGGTGTGCTCGTTTCATCAAAAGCCA
WGRS208726,134,906TGGGCTACATTGTTCTGCCTGCTTCAAGTTTCCTTGCCTGT
WGRS209727,405,979TGGTGGTGGAGGCAATCAAAGGGGGTTATGCCTGAAACAA
WGRS212730,620,572TGCTTGGGTTGTATCACTGACATGGTGTGGCAGGTAATTGGA
WGRS213731,054,142AATTCTTTGCGCACTCGTGGATCCACTCTGAGCAATTGGC

WGRS22087,024,617AACAGTCAACACCCAGCCTTTTGAGGTGGTCTTTCCGAGC
WGRS22187,889,760GTGACAACCAAGCAGCACTGTCCTGCCCAACTTGTTCCTC
WGRS225810,733,107CTTCTGCCATTAAACGCCCAGGGTTCAATCATTGTGGTCACC
WGRS226811,279,464TGCTGGCCCCACTCAATAAAAGGACCGGGTCTCAATCTCA
WGRS227811,656,539AGTTCTAACGACACGAGGGCTTGTACCAGACTGCGAGCAA
WGRS229815,003,269CCTTGTGCAACCAAAGCTGTGACAGCGGTTGCATCAGTTC
WGRS233817,637,101GTAGACACTCTTAGCCGGGCTCCTGCATTGTGTGGTTCCA
WGRS235818,473,596ACTGTGTGCACTCACCTGTTCGGACATCTGCTGAGGAGTT
WGRS240820,663,001ACGGCTGGTCTCATGTTCAATAGGGTTTGGTGCTGGTGAC

WGRS25494,555,267TGGCTAACCATGGGTTGCATAGTTTGTTCCAGCGCCATTG
WGRS263916,573,290GAGTGCTGATGGAAGCTGGATGCTCCATATGGAAGCAAGTCA
WGRS271929,654,845TGCACATTGTGTCACTCTACGACATTGCCTAGAATTTGCCGGG
WGRS272930,799,073CTAGATTCCTGCGGATGCCTACCCATACCTTCTCGCGAAA

WGRS281106,101,884GCCGGTAGTTTCTGACCCAAAGGTTCAAGAAGTGGCGGAG
WGRS2871014,082,501ACAATGCCTCCACCTTTCCAGTAGCAGCAACAGTGGCAAA
WGRS2971027,692,702TGGCAGTGTTGTACTTGGGTAGGGCTTGGAGACTTTTGCA

WGRS307116,959,074GAGGGTGAGTTTCTGGTGGGCACGCACACTTCACGCTTAA
WGRS3161114,891,680GTGCCTCTGCTTCTCAGGTTTGGCAGTTTTAGGCTTTTCAGT
WGRS3261124,272,773CAGGTTCCTGAAGCAGCTGAGCTGAATCTACCAGGCAACA

SNP (HRM) markers developed in this study and WGRS is the abbreviation for watermelon gummy stem blight resistance SNP.

Position of SNP on reference genome.

Korean J Breed Sci 2018;50:424-33 https://doi.org/10.9787/KJBS.2018.50.4.424
© 2018 Korean J Breed Sci