Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 1.

Polymorphic markers used for qSTV11Z and qSTV11SG related markers.

Gene Primer ID Forward primer (5´-3´) Reverse primer (3´-5´)
Stv-b Sid113 TGGTCCACACGTGCATATCT TGATGTAGTAGACTCCACGT
Sid115 ATTGCAACGAACACAACAGC CACTGCAGAAAAGGACACGA
Stv-bi Indel7 AAATTCCAATGCCCAAAACC TCCTCATGGAGCTCATCCAA
Korean J Breed Sci 2019;51:285-9 https://doi.org/10.9787/KJBS.2019.51.4.285
© 2019 Korean J Breed Sci