Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 1.

List of CAPS markers on chromosome 4 used in bulked segregant analysis and genetic mapping of dwf1.

Marker name Position (bp) Primer sequence (5´ -3´) Restriction enzyme

Forward sequence Reverse sequence
J10401 5,112,849 GCAAGGTTCAAGAGCGATTC AGCATCAGCCTCGCTACAAC PvuⅡ
J10402 23,469,810 GCTCTGTCTTTTTCAGCA GCATGCAACTCAACATCT HinfⅠ
J10403 25,851,000 ACCTGTGTGGGAGAGGTGAG AGATCGATCGTTTTGCTTGC FokⅠ
J10404 28,260,138 TCAGGATTGGAGGGAAAAGA TTTCCTGCCCCTGCATATAA ClaⅠ
J10405 33,484,779 CGTCGATTTTAATCGGTCGT CTCGCTGGCTCACATATTCC AluⅠ
Korean J. Breed. Sci. 2020;52:9-19 https://doi.org/10.9787/KJBS.2020.52.1.9
© 2020 Korean J. Breed. Sci.