Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 1.

Primer sequences used for amplifying Md-ACS1, Md-ACO1, and Md-PG1 genes.

Primers Sequence (5'→3') Amplicon size (bp) Annealing Temp. (℃) Reference
Md-ACS1 ACS1-F ACS1-R CTCCTCCTTTCCTTCGTTGA ACCATGTCGTCGTTGGAGTAG 2 : 655, 1 : 489 58 Sunako et al. (1999)
Md-ACO1 ACO1-F ACO1-R ATCAATGATGCTTGTGAGAACTG GGTCTTCTTGTAGTGATCCTTGG 2 : 587, 1 : 525 65 Costa et al. (2005)
Md-PG1SSR10kd PG1-F PG1-R TTTCTTCCTTGGGTTTTTGG ACTCGTGCGCCAGATAGC 3 : 298, 2 : 291, 1 : 288 56 Longhi et al. (2013)
Korean J. Breed. Sci. 2020;52:322-31 https://doi.org/10.9787/KJBS.2020.52.4.322
© 2020 Korean J. Breed. Sci.