Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 2.

Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.

No. Amplification region Primer name Primer sequence (5'->3') Length Tmz (℃) GC (%)
1 trnL-trnF trnL-F AAAATCGTGAGGGTTCAAGTC 21 53 42.9
trnF-R GATTTGAACTGGTGACACGAG 21 53.7 47.6
2 ITS1 ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS1R GAGAGTCGTTTTGGATACATGTGAAAGAAG 30 57.5 40.0
3 ITS2 ITS2F CTGCCTGGGTGTCACGCATCGTTGCCCCAC 30 70.6 66.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0
4 ITS (ITS1+5.8S rDNA +ITS2) ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0

zTM value: https://sg.idtdna.com/calc/analyzer

Korean J. Breed. Sci. 2021;53:16-31 https://doi.org/10.9787/KJBS.2021.53.1.16
© 2021 Korean J. Breed. Sci.