Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

벼줄무늬잎마름병 신규 저항성 보유 유전자원 탐색

이샛별1, 허연재1, 조준현1, 이지윤1, 권영호1, 조수민1, 신동진1, 이종희1, 김태헌1, 강주원1, 박노봉2, 송유천2, 고종민1, 박동수1

Identification of Germplasm Harboring a Novel Gene Against Rice Stripe Virus Resistance

Korean Journal of Breeding Science 2019;51(4):285-289.
Published online: December 1, 2019

1국립식량과학원 남부작물부 논이용작물과

2국립식량과학원 영덕출장소

1Paddy Crop Research Division NICS, RDA, Milyang, Republic of Korea

2Yeongdeok Sub-station, NICS, RDA, Yeongdeok 36405, Republic of Korea

* Corresponding Author (E-mail: parkds9709@korea.kr, Tel: +82-55-350-1184, Fax: +82-55-352-3059)
• Received: June 12, 2019   • Revised: June 12, 2019   • Accepted: July 9, 2019

Copyright © 2019 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 138 Views
  • 0 Download
next
  • Rice stripe virus (RSV) is one of the major constraints in rice production which is transmitted by the small brown plant hopper, Laodelphax striatellus. Identifying new resistance genes from diverse sources is important for rice breeding programs to enhance the resistance level and/or to overcome the breakdown of resistance genes. This study was conducted to identify novel sources of resistance against RSV. We used five RSV resistant varieties that do not harbor Stv-bi. The presence of known genes for RSV resistance was identified using the InDel7 marker for Stv-bi, two Indel (Sid primer set) markers for Stv-b, and DNA sequence analysis for OsSOT1. We revealed that two varieties, 02428 (IT236925) and Tung Ting Wan Hien 1, are novel RSV resistance sources.
벼줄무늬잎마름병(Rice Stripe Virus: RSV)은 한국, 일본, 중국 등 동아시아 지역에서 발생하는 중요한 바이러스 병으로 알려져 있다(Toriyama 1995). 본 바이러스는 애멸구(Laodelphax striatellus Fallen; small brown plant hopper SBPH)에 의하여 전염되며(Ou 1972, Nault 1994), 자포니카 벼에서 많이 발생 된다(Falk & Tsai 1998). 우리나라에서 벼줄무늬잎마름병은 1935년에 경상도 (낙동강 유역)에서 처음 발생이 보고된 이래 지금까지도 남부지역 및 서해안 지역을 중심으로 피해를 주고 있다(Chung et al. 1971, Choi et al. 2010). 최근에는 저항성 품종 재배 확대 및 매개충인 애멸구에 대한 방제노력으로 발병이 감소추세에 있지만 해마다 기후변화에 따른 돌발적인 발병증가에 주의를 기울여야 하는 병해 중 하나이다. 벼줄무늬잎마름병에 감염된 벼는 초기의 잎에 연노랑색의 줄무늬가 형성되고 병징이 진전되면 황백색으로 변한다. 생육과 이삭형성이 저하되고 불임률이 상승하여 등숙률과 천립중이 저하되어 수량감소를 발생시킨다(Chung et al. 1974, Kwon et al. 2012a). 본 병에 대한 방제는 주로 바이러스 매개충인 애멸구를 간접적 방제 하는 것이 가능하나 화학적 방제는 방제 범위가 제한적이며 농약의 오남용 문제 등을 고려할 때 본 병에 대한 가장 경제적이고 친환경적인 방제방법으로 저항성 품종의 재배이다. 저항성 품종을 육성하고자 할 때 전통적인 육종 방법은 유용 유전자원도입을 위해서 대량의 유전자원 또는 계통에 대한 생물검정을 통해 저항성 여부를 판단해야 한다. 저항성 품종을 개발하기까지는 오랜 시간과 노력이 동반됨에 따라 저항성 품종 선발에 어려움이 있어 최근에는 분자 표지방법을 응용한 방법이 사용되고 있다. 현재까지 알려진 벼줄무늬잎마름병 저항성 유전자는 6번 염색체에 위치하는 Stv-a 및 11번 염색체에 위치하는 Stv-biStv-b (Washino et al. 1968, Hayano-Saito et al. 2000), 그리고 OsSOT1 (Wang et al. 2014) 등이다. 최근 연구에 따르면 Stv-a 유전자의 위치 확인을 위한 QTL 연구가 수행되었으나 Stv-a는 존재하지 않을 가능성이 높은 것으로 알려져 있다(Maeda et al. 2004, Lee et al. 2017). 우리나라의 벼줄무늬잎마름병 저항성 품종은 대부분 인디카형 품종인 ‘Modan’이 보유하고 있는 Stv-bi를 이용하고 있다. 단일 저항성 유전자만 가진 품종들을 지속적으로 보급할 경우 바이러스 변이로 인한 새로운 바이러스의 출현 따른 저항성의 붕괴 가능성에 노출 되어있어 저항성 유전자원의 다양화가 필요하다(Hibino et al. 1985, Pink et al. 1992). 본 연구는 벼 줄무늬 잎마름병 저항성 분자마커 및 유전자염기서열 분석을 통해 새로운 저항성 유전자를 보유한 유전자원을 선발하여 향후 저항성 육종에 이용할 것을 목적으로 수행하였다.
시험재료
본 연구에서는 Kwon et al. (2012b)에 의해 선발된 유전자원 5종(Dawdam, 02428 (IT236925), Erguailai, PadiAdongdumarat, TungTingWanHien1)을 사용하였다. 비교 품종으로는 벼줄무늬잎마름병에 감수성인 일품과 저항성인 Stv-b를 보유하고 있는 Zenith그리고 Stv-bi를 보유하고 있는 신광을 사용하였다. 이들 유전자원 5종은 Stv-bi 유전자를 판별할 수 있는 분자마커 Indel7을 이용한 유전자형 구분에서 Stv-bi 유전자를 보유하지 않음에도 생물검정에서는 저항성으로 나타난 자원이다.
벼줄무늬잎마름병 저항성 검정
벼줄무늬잎마름병 저항성 검정을 위하여 못자리용 상토가 들어 있는 모판에 품종당 30립의 종자를 파종하여 14일동안 생육시킨 후, 바이러스가 보독된 2~3령충의 애멸구를 식물체당 5~7마리 밀도로 5일간 접종한 후 온실에 이앙하였다. 벼줄무늬잎마름병 저항성 평가는 Wu et al. (2011)Kwon et al. (2012a)의 방법에 준하여 이앙 30일 후 이양한 식물체 수에 대한 건전주의 비율을 조사한 후 계통 또는 품종의 저항성을 확인하였다. 벼줄무늬잎마름병 저항성 평가 시 잎에 녹색 또는 흰색의 강한 줄무늬를 보이면서 생육이 정지한 개체는 감염주로, 약한 줄무늬를 보이나 정상적인 생육을 보이는 개체는 건전 주로 분류하였다. 품종별 저항성 및 감수성 여부는 저항성 품종인 신광벼 와 Stv-b를 보유하고 있는 Zenith (Lee et al. 2017), 감수성 품종인 일품을 비교품종으로 사용하여 품종별 건전주 비율을 참조하여 판단하였다. 저항성 검정은 6반복으로 수행하였다.
PCR 및 염기서열 분석
파종 후 30일된 잎으로부터 CTAB (cetyltrinethyl ammonium bromide)방법을 이용하여 Genomic DNA를 추출 하였고(Murray & Thompson 1980), 추출된 DNA는 Nanodrop (Thermo, Waltham, MA, USA)을 이용하여 DNA농도를 20ng/μl로 조절한 후 DNA분석에 사용 하였다. 유전자형 분석을 위한 프라이머는 Stv-b를 구분할 수 있는 2종의 Sid (Indel) 마커(Lee et al. 2017)Stv-bi를 구분할 수 있는 Indel7 마커(Kwon et al. 2012a)를 사용하였다(Table 1). PCR 반응은 Solg™ e-Taq DNA Polymerase (SolGent Co. Ltd., South Korea)를 사용하였으며, PCR 산물은 EtBr이 첨가된 3% agarose gel 을 이용하여 200V에서 1시간 동안 전기영동을 실시하여 유전형을 조사하였다. 일품, 신광 그리고 Zenith와 5개의 RSV 저항성 품종의 염기서열분석을 위해 Solgent (Solgent Co., Daejeon, Korea)에 OsSOT1유전자 시퀀싱을 의뢰하였다. 사용된 프라이머는 Wang et al. (2014)에 의해 설계된 마커(Se-STV11-F : TGAGCGACAATACTCCAGA, Se-STV11-R : AGATACTA GCTTGACACAT)를 분석에 사용하였다.
Table 1
Polymorphic markers used for qSTV11Z and qSTV11SG related markers.
Table 1
Gene Primer ID Forward primer (5´-3´) Reverse primer (3´-5´)
Stv-b Sid113 TGGTCCACACGTGCATATCT TGATGTAGTAGACTCCACGT
Sid115 ATTGCAACGAACACAACAGC CACTGCAGAAAAGGACACGA
Stv-bi Indel7 AAATTCCAATGCCCAAAACC TCCTCATGGAGCTCATCCAA
통계분석
통계분석은 생물검정 결과를 R program (version i386 3.1.0, R Foundation for Statistical Computing, Vienna, Austria, 2014)을 사용하여 분산분석(one-way analysis of variance)후 Duncan의 다중범위검정(Duncan’s multiple range test)으로 분석하였다. 5% 유의수준에서 품종간 유의차를 확인 하였다.
벼줄무늬잎마름병 생물 검정
유전자원 5종에대한 벼줄무늬잎마름병 생물검정 결과 품종간 고도의 유의한 차이가 인정된 반면, 반복간 유의성은 없었다(Table 2). Zenith (Stv-b)와 유사한 저항성을 나타내는 품종으로는 02428 (IT23692)이 있었고, Dawdam, Erguailai의 경우 각각 81.5%와 79.9%의 생존율을 나타냈다(Figs. 1, 2). PadiAdongdumarat, TungTingWanHien1은 일품보다 생존율이 높았지만 신광보다 생존율이 낮았다(Figs. 1, 2). 이는 Kwon et al. (2012b)이 새로운 RSV저항성원 탐색을 위해 유전자원 155종을 이용한 생물검정 및 유전형분석에서 Dawdam외 5종은 Stv-bi를 보유하지 않은 새로운 저항성 품종 후보로 분류한 결과와 유사하였다.
Table 2
One-way ANOVA of bioassay on RSV survival rate at Ilpum and resistance varieties.
Table 2
Source of variance Df Sum of square Mean of square F value Pr>F
Variety 7 29061 4152 154.949 0.000***z
Group 5 131 26 0.977 0.445
Residuals 35 938 27

z,***correlation is significant different from zero (p<0.001)

Fig. 1
Phenotypic response to rice stripe virus (RSV) disease on five rice cultivars comparing with check varieties. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
KJBS-51-285-f1.jpg
Fig. 2
Survival rate of the five rice cultivars according to rice stripe virus (RSV) infection comparing with check varieties. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
KJBS-51-285-f2.jpg
벼줄무늬잎마름병 저항성 관련 분자마커 및 염기서열 분석
InDel 7 마커는 Kwon et al. (2012a)에 의하여 개발되었으며 Stv-bi 보유 저항성품종을 구별 할 수 있는 마커로 자포니카형인 Nipponbare와 인디카형인 93-11 간의 LOC_Os11g31500 유전자 염기서열 분석에서 In/Del 부분을 기반으로 제작되었다. Stv-bi 유전자 유래가 아닌 다른 저항성으로 추정되는 유전자원 5종에 대해 InDel 7 마커를 이용하여 각 품종별 Stv-bi 연관 유전자형을 확인한 결과, 신광(200bp)을 제외한 Zenith와 유전자원 5종은 감수성인 일품과 동일한 대립유전자(160bp)를 나타내고 있어 Kwon et al. (2012)의 연구결과와 동일하였다(Fig. 3C). RSV 생물검정 결과에서 저항성으로 나타난 5개 유전자원은 Stv-bi 저항성 유전자를 보유하지 않은 것으로 판단된다. InDel 마커인 Sid113과 Sid115는 Lee et al. (2017)에 의해 개발되었으며 Zenith 유래의 Stv-b와 ‘신광’ 등이 보유한 Stv-bi를 구별할 수 있는 마커이다. 유전자원 5종에 대해 저항성 유전자 Stv-b 보유 여부를 확인하기 위해 Stv-b 유전자와 연관된 2종의 Sid (Indel) 마커를 이용하여 유전형 분석에 이용하였다. 그 결과 Dawdam, Erguailai, PadiAdongdumarat은 Zenith 와 같이 Stv-b 유전자를 보유하는 것으로 확인되었다(Table 3, Figs. 3A, 3B).
Table 3
The Classification of rice stripe virus (RSV) resistance on 5 rice cultivars by result of Stv-b related Sid (InDel) primer set and OsSOT1 sequence analysis.
Table 3
Classification Stv-b OsSOT1 Putative novel gene
Variety Dawdam, Erguailai PadiAdongdumarant Dawdam, Erguailai 02428 (IT236925) TungTingWanHien1
Fig. 3
The Classification of rice stripe virus (RSV) resistance genes using Stv-b and Stv-bi related markers on 5 rice cultivars. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
KJBS-51-285-f3.jpg
그러나 02428 (IT236925)과 TungTingWanHien1은 일품과 동일한 대립유전자(Sid113: 210bp, Sid115: 200bp)를 나타내어 Stv-b유전자를 보유하지 않는 것으로 확인 되었다(Table 3, Figs. 3A, 3B). 상기 유전자원 5종에 대하여 인도의 재래벼인 Kasalath의 저항성 QTL인 qSTV11KAS (Zhang et al. 2011)로부터 구명된 벼줄무늬잎마름병 저항성 유전자 OsSOT1 (Wang et al. 2014)의 보유 여부를 확인하기 위해 OsSOT1의 염기서열 분석을 수행 하였다. 그 결과, Dawdam, Erguailai는 Wang et al. (2014)이 제시한 OsSOT1 유전자 저항성 염기서열(서열번호 670~675 염기서열 deletion)과 동일하여 OsSOT1 유전자를 보유하는 것으로 확인되었다. 반면 02428 (IT236925), PadiAdongdumarat 그리고 TungTingWanHien1은 OsSOT1 의 감수성 유전자형의(서열번호 670~675 염기서열:GCGGCG) 로 나타나 OsSOT1 유전자를 보유하지 않는 것으로 확인되었다(Fig. 4).
Fig. 4
Sequence analysis of OsSOT1 gene on eight rice cultivars including check varieties.
KJBS-51-285-f4.jpg
신규 저항성 유전자 보유 유전자원 선발
공시한 벼 유전자원 5종에 대한 벼줄무늬잎마름병 저항성 관련 분자마커 및 OsSOT1 유전자 염기서열 분석 결과를 종합하면 다음과 같다. Dawdam, Erguailai은 OsSOT1 유전자와 Stv-b 유전자를 동시에 보유하며, PadiAdongdumarat는 Stv-b 유전자를 보유하는 것으로 확인되었다(Fig. 4, Table 3). 02428 (IT236925)과 TungTingWanHien1은 Stv-bOsSOT1 유전자를 보유하지 않는 저항성 품종으로 나타남에 따라, Stv-bi, Stv-bOsSOT1 이외의 새로운 저항성 유전자를 보유한 유전자원으로 확인되었다(Table 3, Fig. 3A, B). 이러한 결과를 바탕으로, 향후 02428 (IT236925)과 TungTingWanHien1종을 이용한 유전연구를 통해 새로운 저항성 유전자의 위치 등을 확인하고, 벼줄무늬잎마름병 저항성 유전자 다양화 등에 활용 가능 할 것이다.
벼줄무늬잎마름병은 우리나라를 포함한 동아시아 지역에서 가장 많은 피해를 끼치는 바이러스 병으로 저항성 유전자는 6번(Stv-a)과 11번 염색체(Stv-bi, Stv-bOsSOT1)등에 위치하는 것으로 알려져 있다. 벼줄무늬잎마름병 저항성 증진을 위한 유전자 탐색을 위하여, 벼줄무늬잎마름병 바이러스(Rice stripe virus, RSV)에 대한 새로운 저항성 품종을 구분하고, Stv-bi를 보유하지 않는 유전자원 5종에 대한 벼줄무늬잎마름병 저항성 관련 분자마커 및 OsSOT1 유전자 염기서열 분석을 실시하였다. Dawdam, Erguailai은 OsSOT1 유전자와 Stv-b 유전자를 동시에 보유하며, PadiAdongdumarat는 Stv-b 유전자를 보유하는 것으로 확인되었다. 02428 (IT236925)과 TungTingWanHien1은 Stv-bi, Stv-bOsSOT1 이외의 새로운 저항성 유전자원을 확인하였다. 향후 추가적인 연구를 통해 02428 (IT236925)과 TungTingWanHien1은 새로운 저항성 유전자의 정확한 위치를 확인하면 벼줄무늬잎마름병 저항성 유전자 다양화에 기여할 수 있을 것이다.
본 논문은 농촌진흥청 연구사업(세부과제명: 벼 줄무늬잎마름병 저항성 QTL탐색및 중간모본 개발, 세부과제번호: PJ01112701)의 지원에 의해 이루어진 것임.
  • 1. Chung BC, Lee SH. 1971. Studies on the damage of rice stripe virus disease. Korea Repub Nongch'on Jin Heung Chung Res Rep Plant Envir 14: 91-94.
  • 2. Chung BJ. 1974. Studies on the occurrence, host range, transmission, and control of rice stripe disease in Korea. Kor J Plant Protection 13: 181-204.
  • 3. Choi HS, Lee SH, Kim MK, Kwak HR, Kim JS, Cho JD, Choi GS. 2010. Occurrence of virus diseases on major crops in 2009. Res Plant Dis 16: 1-9.
  • 4. Falk BW, Tsai JH. 1998. Biology and molecular biology of viruses in the genus Tenuivirus. Annu Rev Phytopathol 36: 139-163.
  • 5. Hayano-Saito Y, Saito K, Nakamura S, Kawasaki S, Iwasaki M. 2000. Fine physical mapping of the rice stripe resistance gene locus, Stvb-i. Theor Appl Genet 101: 59-63.
  • 6. Hibino H, Cabauatan PQ, Omura T, Tsuchizaki T. 1985. Rice grassy stunt virus strain causing tungrolike symptoms in the philippines. Plant Dis 69: 538-541.
  • 7. Kwon TM, Lee JH, Park SK, Hwang UH, Cho JH, Kwak DY, Youn YN, Yeo US, Song YC, Nam JS, Kang HW, Park DS. 2012a. Fine mapping and identification of candidate rice genes associated with qSTV11SG, a major QTL for rice stripe disease resistance. Theor Appl Genet 125: 1033-1046.
  • 8. Kwon TM, Lee JH, Lee SB, Park SK, Kim SY, Hwang UH, Shin DJ, Cho JH, Song YC, Nam MH, Park DS. 2012b. Screening of Rice Stripe Resistance Germplasm to Develop New Resistance Allele in Rice. Kor J Breed Sci 44: 282-289.
  • 9. Lee SB, Hur YJ, Lee JH, Kwon TM, Shin DJ, Kim TH, Han SI, Cho JH, Yoon YN, Kiswara G, Song YC, Yeo US, Kwon YU, Kim KM, Park DS. 2017. Molecular mapping of a quantitative trait locus qSTV 11Z harbouring rice stripe virus resistance gene, Stv-b. Plant breed 136: 61-66.
  • 10. Maeda H, Sugisawa T, Nemoto H, Sunohara Y. 2004. QTL analysis for rice stripe resistance in the Japanese upland rice kanto72. Korean J Breed Sci 54: 19-26.
  • 11. Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic acids research 8: 4321-4326.
  • 12. Nault LR. 1994. Transmission biology, vector specificity and evolution of planthopper -transmitted plant viruses. Planthoppers 429-448.
  • 13. Ou SH. Diseases Rice.1972. Virus diseases. Commonwealth Mycological Institute, Surrey: pp. 14-22.
  • 14. Pink DAC, Lot H, Johnson R. 1992. Novel pathotypes of lettuce mosaic virus-breakdown of a durable resistance? Euphytica 63: 169-174.
  • 15. Toriyama S. 1995. Viruses and molecular biology of Tenuivirus. Pathogenesis and Host Specificity in Plant Dis. 3: pp. 211-223.
  • 16. Washio O, Ezuka A, Sakurai Y. 1968. Studies on the breeding of rice varieties resistant to stripe disease: II. Genetic study on resistance to stripe disease in Japanese upland rice. Japan J Breed 18: 96-101.
  • 17. Wang Q, Liu Y, He J, Zheng X, Hu J, Liu Y, Dai H, Zhang Y, Wang B, Wu W, Gao H. 2014. STV11 encodes a sulphotransferase and confers durable resistance to rice stripe virus. Nature Comm 5: 4768
  • 18. Wu X, Zuo S, Chen Z, Zhang Y, Zhu J, Ma N, Tang J, Chu C, Pan X. 2011. Fine mapping of qSTV11TQ, a major gene conferring resistance to rice stripe disease. Theor Appl Genet 122: 915-923.
  • 19. Zhang YX, Wang Q, Jiang L, Liu LL, Wang BX, Shen YY, Cheng XN, Wan JM. 2011. Fine mapping of qSTV11KAS, a major QTL for rice stripe disease resistance. Theor Appl Genet 122: 1591-1604.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Identification of Germplasm Harboring a Novel Gene Against Rice Stripe Virus Resistance
Korean. J. Breed. Sci.. 2019;51(4):285-289.   Published online December 1, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Identification of Germplasm Harboring a Novel Gene Against Rice Stripe Virus Resistance
Korean. J. Breed. Sci.. 2019;51(4):285-289.   Published online December 1, 2019
Close

Figure

  • 0
  • 1
  • 2
  • 3
Identification of Germplasm Harboring a Novel Gene Against Rice Stripe Virus Resistance
Image Image Image Image
Fig. 1 Phenotypic response to rice stripe virus (RSV) disease on five rice cultivars comparing with check varieties. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
Fig. 2 Survival rate of the five rice cultivars according to rice stripe virus (RSV) infection comparing with check varieties. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
Fig. 3 The Classification of rice stripe virus (RSV) resistance genes using Stv-b and Stv-bi related markers on 5 rice cultivars. A: Ilpum, B: Zenith (Stv-b), C: Shingwang (Stv-bi), D: 02428 (IT236925), E: Dawdam, F: Erguailai, G: PadiAdongdumarat, H: TungTingWanHien1.
Fig. 4 Sequence analysis of OsSOT1 gene on eight rice cultivars including check varieties.
Identification of Germplasm Harboring a Novel Gene Against Rice Stripe Virus Resistance

Polymorphic markers used for qSTV11Z and qSTV11SG related markers.

Gene Primer ID Forward primer (5´-3´) Reverse primer (3´-5´)
Stv-b Sid113 TGGTCCACACGTGCATATCT TGATGTAGTAGACTCCACGT
Sid115 ATTGCAACGAACACAACAGC CACTGCAGAAAAGGACACGA
Stv-bi Indel7 AAATTCCAATGCCCAAAACC TCCTCATGGAGCTCATCCAA

One-way ANOVA of bioassay on RSV survival rate at Ilpum and resistance varieties.

Source of variance Df Sum of square Mean of square F value Pr>F
Variety 7 29061 4152 154.949 0.000***z
Group 5 131 26 0.977 0.445
Residuals 35 938 27

The Classification of rice stripe virus (RSV) resistance on 5 rice cultivars by result of Stv-b related Sid (InDel) primer set and OsSOT1 sequence analysis.

Classification Stv-b OsSOT1 Putative novel gene
Variety Dawdam, Erguailai PadiAdongdumarant Dawdam, Erguailai 02428 (IT236925) TungTingWanHien1
Table 1 Polymorphic markers used for qSTV11Z and qSTV11SG related markers.
Table 2 One-way ANOVA of bioassay on RSV survival rate at Ilpum and resistance varieties.

correlation is significant different from zero (p<0.001)

Table 3 The Classification of rice stripe virus (RSV) resistance on 5 rice cultivars by result of Stv-b related Sid (InDel) primer set and OsSOT1 sequence analysis.