search for




 

Identification of Constitutive Promoters Derived from Brassica rapa
배추 유래 전신발현 프로모터의 동정
Korean J Breed Sci 2018;50(3):193-202
Published online August 31, 2018
© 2018 Korean Society of Breeding Science.

Jin Sun Kim§, Sun-Hyung Lim§, Young-Mi Kim, and Jong-Yeol Lee*
김진선§, 임선형§, 김영미, 이종열*

National Institute of Agricultural Science, RDA, Jeonju, 54874, Korea
농촌진흥청 국립농업과학원
Correspondence to: Corresponding Author (E-mail: jy0820@korea.kr, Tel.: +82-63-238-4616, Fax: +82-63-238-4604)
Received June 20, 2018; Accepted August 8, 2018.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Promoters are essential regulatory elements for efficiently expressing a gene of interest in a target tissue of a organism. Therefore, the identification of a suitable promoter is important in plant biotechnology. In this study, four promoters were selected and identified to be constitutively or tissue-specifically expressed in Brassica rapa bacterial artificial chromosome (BAC) clones using the results of transcriptomic analysis of Brassica rapa and open-source database information on Arabidopsis thaliana. The 2 kb region of the 5′ upstream was isolated from the Brassica rapa genomic DNA for each promoter. The four promoters were then fused to β-glucuronidase (gus) and green fluorescent protein (gfp) genes, and the recombinant transgenes were introduced into Arabidopsis. As a result of histochemical GUS staining, GFP fluorescence and RT-PCR, the gus gene was observed to be expressed constitutively in all tissues using all four promoters. A GUS activity assay using fluorescent 4-MUG revealed that the BR11 promoter showed similar activity to the CaMV35S promoter, while the BR4, BR15, and BR16 promoters showed 1.5, 4, and 18-fold higher activities than the CaMV35S promoter, respectively. These results indicate that these four promoters could be used to incorporate useful genes with enhanced function into crops of interest.

Keywords : Brassica rapa, constitutive promoter, GUS
서언

작물 형질 개량의 주요 목표는 질병 및 곤충 저항성, 제초제 내성 및 비생물적 스트레스 저항성과 같은 농업적 특성이 강화된 유전자의 도입으로 기능적 가치가 향상된 작물을 생산하는 것이다. 이러한 목표를 이루기 위해서는 유용한 형질을 암호화하는 유전자를 적절히 발현을 시켜야 하며, 유전자 도입을 위한 형질전환기법이 필요하다. 유전자 발현 조절을 적절한 수준으로 이루기 위해서는 유전자의 발현을 예상된 패턴 및 수준으로 정확하게 조절하기 위한 프로모터의 개발이 매우 중요하다(Cai et al. 2007, Yi et al. 2011).

전신 발현 프로모터는 식물의 생육 주기 동안 높은 수준의 도입 유전자 발현이 지속적으로 필요할 때 유용하다. 현재 생명 공학 작물의 80% 이상은 전신 발현 프로모터인 콜리플라워 모자이크 바이러스의 35S RNA 유전자의 프로모터(CaMV35S)를 사용하며 개발되었다(Odell et al. 1985). CaMV35S 프로모터 이외에 보고된 전신 발현 프로모터로는 대두 Gmubi 프로모터(Glycine max)(Hernandez-Garcia et al. 2009), 감자 ubi7 프로모터(Solanum tuberosum)(Rockhold et al. 2008), 애기장대 ubiquitin 프로모터(Callis et al. 1990)와 actin 프로모터(An et al. 1996), 담배 CUP 프로모터(Nicotiana tabacum)(Malik et al. 2002) 등이 있다. 이러한 전신발현 유도 프로모터들은 형질전환 식물체를 선발하는 용도로 이용되는 항생제나 제초제 저항성 유전자 및 리포터 유전자의 발현을 유도하기 위해 이용하거나, 목적하는 유전자의 식물체내 기능을 밝히고자 이용되고 있다.

일반적으로 CaMV35S 프로모터가 전신 발현에 많이 이용이 되고 있지만, 유전자의 기능성과 목적 형질의 특성에 따라 조직 별 또는 발현 시기별 프로모터를 써야 하는 경우가 있다. 예를 들어, 루테오 바이러스, 레오 바이러스 및 대부분의 geminivirus와 같은 많은 식물 바이러스는 도관 관련 조직에서 독점적으로 복제된다. 이러한 바이러스에 대한 저항성을 지닌 식물체를 개발하기 위해서는 도관 특이적인 프로모터의 개발이 바람직하다. 전신 발현 프로모터의 사용은 바이러스의 유전체가 다른 바이러스의 캡시드로 둘러싸이는 현상인 캡시드 전환이나 바이러스 재조합의 위험성을 불필요하게 야기시키고 증가시킬 수 있기 때문이다(Lemgo et al. 2013). 또한, 특정 조직에서만 유전자 발현 유도는 식물의 대사 부하를 감소시킬 수도 있는 장점이 있다(Latham & Wilson 2008). 최근에 도관을 따라 감염되는 병에 대한 저항성을 부여하기 위해서 포플러 유래 Lmx 프로모터(Hertzberg et al. 2001), 호박유래 PP2-type 유전자의 프로모터(Dinant et al. 2003)가 개발되어 목적 유전자의 발현을 도관에서만 한정하였다. 또한, RolCSh와 같은 도관 특이 프로모터를 이용한 Potato leafroll virus (PLRV) 저항성 식물체를 개발하였다(Graham et al. 1997). 현재까지 도관 특이 프로모터의 수는 매우 적으며, 작물마다 발현 효율성이 떨어지는 등의 단점이 있어 유전자 발현 효율이 우수한 도관 특이 프로모터의 개발이 필요한 실정이다.

가장 널리 사용되고 있는 CaMV35S 프로모터는 식물체의 발달단계의 모든조직에서 유전자 발현을 유도한다. 하지만 이배체 이상의 게놈을 지니거나(Mette et al. 1999) 식물체가 CaMV에 감염된 경우(Al Kaff et al. 1998)에는 프로모터의 활성이 감소되는 단점이 있다. 또한, 단자엽식물인 옥수수의 전신 발현 프로모터 Ubi-1의 경우, 리포터 유전자의 옥수수 원형질에서의 발현은 CaMV35S 프로모터보다 10배 이상 높았다. 그러나, 쌍자엽식물인 담배의 원형질체에서 일시적으로 발현되는 경우 Ubi-1 프로모터의 활성 수준은 급격하게 떨어지며, 단자엽 식물에서만 특이적 발현을 나타내어 전신 발현 프로모터의 작물 적용 범위를 제한하는 단점을 보고했다(Christensen et al. 1996).

따라서 본 연구에서는 작물에 널리 사용 할 수 있는 전신 발현 프로모터와 도관 조직에 특이적으로 발현하는 배추 유래의 신규 프로모터를 확보하고자 실시하였다. 배추 및 애기장대의 전사체 분석 결과를 수행하여서 전신 및 조직 별로 발현되는 프로모터 4종을 선발하였다. 선발된 4종의 프로모터에 대해 애기장대에 형질전환하여 각각의 프로모터 활성을 분석 하였다. 생육 시기별, 조직별 발현을 GUS 염색 및 GFP 형광 분석, RT-PCR 및 형광 분석법에 의한 GUS 활성 분석으로 신규 프로모터의 발현과 음성대조구 및 양성대조구의 발현 패턴을 비교 분석하였다.

재료 및 방법

배추의 조직 특이 및 전신 발현 프로모터 분리 및 클로닝

유전자의 발현을 조직별 혹은 전신에서 유도할 수 있는 프로모터를 확보하기 위하여 배추 조직별 마이크로어레이(microarray) 분석을 실시하였다. 분석 결과, 조직 특이적 발현을 나타내는 유전자의 개시코돈 상위의 약 2kb 영역의 서열을 배추 BAC클론 DNA를 활용하여 확보하였다(Kim et al. 2018). Genomic DNA PCR을 수행하여 배추에서 4종의 유전자 BR4, BR11, BR15, BR16의 프로모터 영역을 특이적으로 증폭하였다. 각각의 프로모터 영역을 증폭하는 프라이머는 Table 1에 나타내었다. 선발된 4종의 프로모터 영역과 CaMV35S 프로모터 영역은 Gateway cloning(VIB-Ghent University, Ghent, Belgium)을 위해서 재조합 핵산서열 부위의 어댑터 서열을 포함하는 프라이머를 이용하여 증폭하였다(Supplementary Table 1). PCR 조건은 95°C에서 10분간 변성 후 95°C에서 1분, 55°C에서 1분 및 68°C에서 2분간 반응을 1 사이클로 하여 30회 실시한 다음, 68°C에서 10분간 반응하였다. 증폭된 PCR된 산물은 BP반응을 실시하여 pDONR221 (Invitrogen Corporation) 운반체에 도입하여, 각각 pDONR-PBR4, pDONR-PBR11, pDONR-PBR15, pDONR-PBR16 및 pDONR- P35S 운반체를 제작 완료하였다. 클로닝된 운반체는 양방향 시퀀싱 분석을 통해 염기서열을 확인하였다. 식물발현 운반체로 옮기기 위하여 gfpgus 유전자가 연결된 형태의 리포터 시스템이 내재되어 있는 pBGWFS7(VIB-Ghent University, Ghent, Belgium) 운반체와 재조합 반응을 실시하였다(Katzen 2007). 제작된 식물발현용 운반체는 양방향 시퀀싱 분석을 통해 염기서열을 확인하였고, 최종적으로 pBGWFS7-BR4, pBGWFS7-BR11, pBGWFS7-BR15, pBGWFS7-BR16 및 pBGWFS7-CaMV35S으로 명명하였다.

Four promoter information and list of primers.

Promoter symbolBAC clone (NCBI accession No.)Arabidopsis locus IDForward primerReverse primerSize
BR4KBrH011O17-2 (AC189580.2)At5g64040TCCAAATAAACCGCCGTATTTAATATGTGTTGTTCCACTT1,999bp
BR11KBrH006P22 (AC189557.1)At3g53980TGCTGGTTACACATTTTGTTATGTTTTATGGGGGAAGATT1,999bp
BR15KBrS003K07-1 (AC189631.2)At5g05410TGGGGGTAATGAAACAGGACATCTTCTTCAGGGAAACAA2,000bp
BR16KBrB042L19 (AC189345.2)At3g07700AACAAAAAAAAAAGTTTTCTTAATAGTGCCGCCATTTCCA1,999bp

형질 전환 재료 및 생육 조건

제작된 식물 형질전환용 운반체는 아그로박테리아(Agrobacterium tumefaciens GV3101)에 Freeze-thaw 방법으로 형질 전환하였다(Weigel et al. 2006). 장일 조건 하(16시간 낮/8시간 밤, 22°C 온도)의 4주된 애기장대 식물체의 일차 꽃대를 제거하여 3-4개의 이차 꽃대를 유도한 후, 꽃봉우리 침지법(floral-dipping)으로 형질 전환을 실시하였다. 형질전환된 애기장대는 0.3% 바스타(Basta, Bayer CropScience)를 처리하여 유전자의 도입을 확인하였다. 이와 같은 방법으로 애기장대 형질전환체를 T2 세대까지 육성하고 프로모터 활성 검정에 이용하였다.

GUS 조직화학적 염색 및 GFP 형광 분석

각각의 프로모터가 도입된 애기장대 T2세대 종자를 파종하여 생육시기별로 GUS 조직화학적 염색을 실시하였다. 형질전환시키지 않은 애기장대 식물체 Col-0를 음성대조구로, 전신발현 프로모터인 CaMV35S가 도입된 애기장대 식물체를 양성대조구로 GUS 조직화학적 염색에 비교하였다. 7일째와 21일째의 식물체는 유식물체 전체를 GUS 조직화학적 염색에 사용하였고, 42일째의 성숙식물체는 잎, 줄기, 뿌리, 꽃, 꼬투리의 조직을 채취하여 GUS 조직화학염색에 사용하였다. 조직화학적 염색은 GUS 염색 용액(X-gluc (cyclohexyl ammonium salt) 20 mM, NaH2PO4H2O 100 mM, NaEDTA 10 mM, Triton X-100 0.1%, pH 7.5) 에 침지하여 37°C에서 24시간 침지한 후, GUS 염색 용액을 제거한 후, 70% 에탄올에 처리하여 엽록소를 제거한 후 실체 현미경으로 관찰하였다.

뿌리에서의 GFP형광을 분석하기 위해서 파종 후 7일째의 애기장대 형질전환체들을 이용하였다. 공초점 현미경(Leica TCS SP8)의 아르곤 레이저 488 nm excitation과 505–525 nm emission 파장으로 GFP 형광 분석을 실시하였다.

RNA 분리 및 RT-PCR

조직 별 gus 유전자의 발현을 확인하고자 애기장대의 조직 별로 샘플을 채취하여 total RNA를 추출하였다. cDNA는 5 μg의 total RNA와 SuperScriptIII (200 units/µl)를 이용하여 합성한 후 gus 특이적인 프라이머(GUS-Forward, 5’- ACC TGC GTC AAT GTA ATG TTC TGC -3’; GUS-Reverse, 5’- CTC CCT GCT GCG GTT TTT CA-3’)를 사용하여 RT-PCR을 수행하였다. 조직별 발현을 표준화하기 위해서 EF1α (elongation factor 1 alpha) 특이적인 프라이머(EF1α -Forward, 5’-CCG AGC GTG AAC GTG GTA T-3’; EF1α Reverse 5’-TAG TAC TTG GTG GTT TCG AAT TTC C-3’)를 사용하여 RT-PCR을 수행하였다. PCR 조건은 95°C에서 2분 변성 한 후 94°C에서 30초, 55°C에서 30초, 72°C에서 1분을 1회로 하여 총 30회를 수행하였다. PCR 산물은 1% 아가로오즈 겔에 전기영동하여 확인하였다.

GUS 활성 분석

GUS 활성은 GUS 조직화학적 염색과 동일하게 음성대조구와 양성대조구 애기장대를 이용하여 분석하였다. GUS 활성 분석은 42일째 애기장대 식물체의 조직별로 샘플을 채취한 후 단백질을 추출하여 실시하였다. 총 단백질은 추출 용액(50 mM sodium phosphate pH 7.0, 10 mM DTT, 1 mM EDTA, 0.1% sodium lauroyl sarcosine, 0.1% Triton X-100)을 이용하여 분리하고 Qubit 형광 측정기(Invitrogen)를 사용하여 단백질 농도를 측정하였다. GUS 활성은 형광 기질인 4-methylumbelliferyl-β-glucuronide (4-MUG)를 이용하여, GUS 촉매 반응에 의해 생성되는 형광 산물인 4-methylumbelliferone (4-MU)값을 측정하여 분석하였다. 3회 반복 실험을 통해 평균값을 계산하였다(Jefferson 1987).

결과 및 고찰

배추 유래 프로모터의 분리

특별 조직 별 혹은 전신에서 발현을 나타내는 유전자를 확보하기 위해서 공개된 애기장대의 전체 염기서열의 데이터 검색( http://www.weigelworld.org/)을 실시하였다. 전신발현 양상을 보이는 애기장대의 유전자들(At5g64040, At3g53980, At5g05410, At3g07700)의 서열과 유사성이 높은 배추유전자(AC189580.2, AC189557.1, AC189631.2, AC189345.2)를 탐색하였고, 배추 BAC 클론을 활용하여 프로모터 영역을 분리하고, 각각을 BR4, BR11, BR15, BR16으로 명명하였다. Table 1에서 표기한 프라이머를 이용하여 BR4, BR11, BR15, BR16의 프로모터를 증폭하였고, 각각의 크기는 1,999bp, 1,999bp, 2,000bp, 1,999bp였다. 증폭한 프로모터 영역은 GUS와 GFP 융합단백질을 포함하는 pBGWFS7 운반체에 클로닝을 수행하였고, 식물체내의 조직 별 발현 부위를 알아보기 위해서 애기장대에 형질전환 시켰다.

배추 유래 조직 특이 프로모터의 GUS 염색 및 GFP 형광 비교

4종의 프로모터가 형질전환 된 T2 세대의 애기장대는 생육시기별⋅조직 별 발현을 비교 분석하였다. 음성대조구로 형질전환을 실시하지 않은 애기장대를 사용하였고, 양성대조구로는 상시발현 프로모터인 CaMV35S 프로모터가 도입된 애기장대를 사용하였다.

생육시기별로 살펴보면, 파종 후 7일째의 애기장대 유식물체 GUS 염색 결과, 음성대조구에서는 GUS 염색이 관찰되지 않으나, 양성대조구에서는 전신에서 GUS염색이 관찰되었다. 4종의 프로모터가 도입된 형질전환체도 전신에서 GUS 염색이 관찰되었다(Fig. 1-A). GUS 염색 정도를 확인해보면, BR11, BR15, BR16 프로모터의 경우 양성대조구와 유사하게 GUS 염색이 확인되었으나, BR4 프로모터의 경우 다소 약한 GUS 염색이 확인되었다. 선발된 4종의 프로모터의 뿌리에서의 발현을 확인하고자, 7일째 유식물체에서 GFP 형광분석을 실시하였다. GUS 염색 결과와 동일하게 음성대조구에서는 GFP 형광이 관찰되지 않으나, 양성대조구에서는 뿌리에서 강한 형광이 관찰되었다. 4종의 프로모터가 도입된 형질전환체 모두 뿌리에서 GFP 형광이 관찰되었다.

Fig. 1.

GUS staining and GFP fluorescence results of four promoters by growth stages and tissues of the constitutive expression promoters derived from Brassica rapa. GUS expression was detected by X-Gluc solution from the 7days (A), 21days (B) and 42days (C) old transgenic plantlets. For negative control; wild type Col-0. For positive control; Arabidopsis transformed with the CaMV35S constitutive promoter. GFP fluorescence was analyzed in the 7days plant root using confocal microscopy. BF indicates photo taken using bright-field microscopy.


파종 후 21일째 식물체에서 GUS 염색을 실시한 결과, 선발된 4종의 프로모터는 7일째의 유식물체의 GUS 염색결과와 유사하게 잎, 뿌리, 줄기를 포함한 전신에서 GUS 염색이 확인되었다(Fig. 1-B).

성숙식물체에서의 다양한 조직에서의 프로모터 발현을 알아보고자 파종 후 42일째 잎, 줄기, 뿌리, 꽃, 꼬투리에서의 GUS 염색을 확인하였다. 음성대조구는 예상대로 모든 조직에서 GUS 염색이 관찰되지 않았으며, 양성대조구의 경우 모든 조직에서 GUS 염색이 확인되었다. 양성대조구인 CaMV35S프로모터의 경우 기존의 보고대로 식물의 발달시기별⋅조직별로 안정적으로 도입유전자의 발현에 영향함을 알 수 있다(Zheng et al. 2007).

선발된 4종의 프로모터도 꽃, 잎, 줄기, 꼬투리, 뿌리에서 모두 GUS 염색이 관찰되었고(Fig. 1-C), 이는 4종의 프로모터가 상시발현 프로모터인 CaMV35S 프로모터와 유사하게, 식물의 성장 전반에 걸쳐, 거의 대부분의 조직에서 안정적으로 발현이 이루어짐을 확인하였다. 유채는 중요한 유지(유료) 작물 중 하나이며, 유채의 종자 개량에 대한 관심이 높다. 그러나 유채 유래의 내재 프로모터나 조직 특이적 프로모터는 소수가 보고되었다(Slocombe et al. 1994, Rask et al. 1998). 종자 특이적 프로모터를 분리하고자, 기존의 보리 작물에서 종피특이적 발현을 보인 B 유전자의 프로모터을 이용하여 유채에서 상동성을 보인 EST의 프로모터를 분리하였다. 분리된 프로모터는 germin 유전자의 프로모터로 추정하여 BnPGPro (B. napus putative germin promoter)로 명명되었다. BnPGPro 프로모터를 조직별 활성을 확인해 본 결과, 종피 뿐만 아니라 뿌리, 잎, 줄기, 꽃, 꼬투리 및 배의 조직에서 높은 활성을 나타내었다. 상시발현 프로모터인 CaMV35S 프로모터보다 평균적으로 2배~3배 높은 활성을 나타내었다. 이러한 결과로 유채의 내재 프로모터인 BnPGPro는 유채 전신에서 외래유전자를 발현시키고자 하는 목적에 사용될 수 있으리라 생각된다(Wu et al. 2013). 또한 식물의 골격 형성 구성 성분이며 세포의 이동, 세포 내 물질의 이동 등에 필요한 기관인 미세소관(microtubules)을 이루는 beta tubulin (βT) 유전자의 프로모터는 식물 전체에 발현이 이루어지며, CaMV35S와 더불어 널리 사용되는 전신 발현 프로모터 중 하나이다. 배추 유래 βT 프로모터를 담배 식물체에서 발현시킨 결과 CaMV35S 프로모터와 유사한 GUS 염색 분석 결과를 나타내었고, 이는 상업화된 강력한 전신발현 프로모터들의 지적재산권에 따른 문제점을 대체할 수 있을 것으로 시사하였다(Mubeen et al. 2015). 따라서, 본 연구에서 확인된 4종의 프로모터는 배추, 유채, 무와 같은 십자화과 작물의 개량을 위해 목적 유전자를 지속적으로 전신에 발현하고자 할 때 이용성이 높다고 생각된다.

BR11 프로모터의 도관특이적 발현 특성

4종의 프로모터별 조직별 발현 양상을 자세히 살펴보았을 때, BR11이 도입된형질전환체에서는 음성대조구와 비교 했을 때 도관에서 GUS 염색이 특이적으로 관찰되었다(Fig. 2). 모든 조직에서 강한 GUS 염색이 관찰된 BR16과 비교하였을 때도, BR11는 유식물체 시기와 성숙식물체 시기에서도 도관에서 발현됨을 확인하였다. 도관 특이 프로모터의 이용 사례들을 보고한 연구결과 중 Arabidopsis sucrose-H + symporter AtSUC2는 체관 양분 수송체로 애기장대와 딸기에서 도관부 특이적 유전자 발현을 GUS 염색으로 관찰하였다(Truernit & Sauer 1995, Zhao et al. 2004). 이 AtSUC2 프로모터를 사용하여 백합목 수선화과에 속하는 갈란투스속 식물인 설강화에서 살충성을 지닌 lectin 유전자의 발현으로 도관 조직을 공격하는 병원균에 대한 저항성을 잠재적으로 부여 할 수 있었고, 감염 부위에서 유전자의 발현을 가능하게 하여 도관 내의 질환을 조절 할 수 있었다(Stöger et al. 1999). 애기장대 sucrose synthase 유전자의 Asus1 프로모터는 잎과 뿌리의 도관 조직에서 특이적으로 발현한다고 알려져 있고, Asus1 프로모터를 마늘 잎 lectin 유전자인 ASAL(Allium sativum L. leaf lectin)과 함께 발현 시켰을때 진딧물 및 식물체의 수액을 빨아 먹는 곤충들을 40% 통제 할 수 있었다(Sadeghi et al. 2007). 바나나 뭉치 바이러스 BBTV(Banana bunchy top virus)의 구성요소인 2개의 NSP(nuclear shuttle protein)와 CP(capsid protein)의 도관 특이 프로모터를 곤충 신경 독소(neurotoxin)인 Hvt 유전자와 같이 발현시켰을 때, 목화깍지벌레, 자두진딧물과 은빛잎가루이의 치사율이 100%에 가까웠으며, Hvt 유전자를 단독으로 발현했을 때 보다 더 빠른 방제속도 결과를 보고하였다(Javaid et al. 2016). 또한 배추나 무에서 주로 발병되는 시들음병 병원균인 Fusarium oxysporum f.sp. congutinans 또는 F. oxysporum f.sp. raphani은 뿌리에 침투한 후 도관에서 증식해 도관을 붕괴시켜 결국 식물체가 말라죽게 된다. 시들음병을 유발시키는 Fusarium oxysporum f. sp. lycopersici (Fol)에 저항성을 가진 I-3 유전자를 야생 토마토에서 분리하였고, I-3 유전자의 프로모터는 줄기 및 도관 특이적 발현을 보였다. I-3 paralogue인 S-receptor-like kinase (SRLK) 유전자의 한 family로 밝혀진 토마토 SpSRLK-6 유전자는 뿌리에서는 발현이 되지 않고 잎과 줄기에서 발현을 하여, I-3 프로모터를 같이 사용함으로써 HR(Hypersensitive response) 반응을 유도하지 않아 세포 괴사를 감소시킴으로써 시들음병 저항성을 보여준 사례가 보고되었다(Catanzariti et al. 2015). 그러나 현재까지 BR11처럼 잎, 줄기, 뿌리의 전체적인 발현을 보여준 도관 특이 프로모터는 알려지지 않아, 도관을 따라 감염되는 병에 대한 저항성 유전자 및 해충 저항성 유전자를 발현시켜 BR11 프로모터와 같이 발현시킨다면 작물 형질 개량에 이용할 수 있으리라 생각된다.

Fig. 2.

Analysis of the vascular tissue-specific and constitutive expression promoters in the pBGWFS7-PBR11 and pBGWFS7-PBR16 transgenic plants.


GUS 활성

4종의 프로모터가 도입된 형질전환식물체에서 조직 별로 GUS의 발현을 확인하기 위하여 RT-PCR 분석을 실시하였다. 예상대로 음성대조구에서는 gus 유전자가 증폭되지 않았으며, 양성대조구에서는 분석한 모든 조직에서 gus 유전자의 발현이 확인되었다. 4종의 프로모터가 도입된 형질전환체는 양성대조구와 마찬가지로 잎, 줄기, 뿌리, 꽃, 꼬투리에서 gus 유전자의 발현을 확인할 수 있었다(Fig. 3-A).

Fig. 3.

GUS expression and activity comparison of four promoters by MUG analysis. A. RT-PCR analysis of gus gene with various tissues. F, flower; L, leaf; St, stem; Si, silique; R, root. EF1α gene was used to normalize the used amount of cDNA. B. GUS activity was measured in the flower, leaf, stem, silique and root from transgenic Arabidopsis. Fluorometric quantification of GUS activity was different among transgenic lines. The GUS activity is expressed in nmol 4-MU/h/μg protein. Error bars represent SE within the three replicates.


프로모터의 활성 강도를 확인하고자 4종의 프로모터가 도입된 형질전환체의 다양한 조직에서 GUS활성을 분석하였다. 예상대로 음성대조구는 분석에 사용된 모든 조직에서 매우 낮은 GUS활성을 나타내나, 양성대조구는 매우 높은 GUS 활성을 나타내었다. 전체 조직의 GUS 평균 활성을 비교해보면 BR16, BR15, BR4, BR11 순으로 나타났다. BR4 프로모터는 양성대조구인 CaMV35S보다 약 1.5배 더 증가된 활성을 보였다. BR11 프로모터는 GUS 염색 결과와 유사하게 양성대조구보다 약한 활성을 보여주었지만, 음성대조구와 비교했을 때 약 3배이상 증가된 활성을 보여주었다. 이에 반해 BR15 및 BR16 프로모터는 양성대조구에 비해 각각 4배, 18배의 강한 GUS 활성을 나타냈다(Fig. 3-B). 특히 BR15와 BR16 프로모터는 다른 조직에 비해 꽃과 잎 조직에서 월등하게 높은 GUS 활성을 보여주었다. 꽃 조직에서, BR15와 BR16 프로모터는 양성대조구에 비해 각각 약 8배, 66배 강한 활성을 보였고, 잎 조직에서는 각각 약 11배, 35배 높은 활성을 보여주었다. 줄기 조직의 GUS 활성은 BR4, BR15, BR16이 양성대조구보다 각각 6배, 8배, 77배의 강한 활성을 나타내었고, BR11은 양성대조구와 유사한 활성을 나타내었다. 꼬투리 조직의 GUS 활성은 BR4, BR15, BR16이 양성대조구보다 각각 1.5배, 4배, 12배의 높은 활성을 나타내었고, BR11은 양성대조구와 유사한 활성을 나타내었다. 뿌리 조직에서는 BR4가 양성대조구에 비해 1.2배 높은 GUS 활성을 보여주었다.

꽃의 화색을 변경시키거나 안토시아닌 색소를 증가시킨 화훼류를 개발하기 위해서는 꽃에 특이적으로 강한 발현을 유도할 수 있는 프로모터가 필요하다. 가장 많이 사용되는 CaMV35S 프로모터로 꽃잎에서 도입유전자의 발현이 제대로 이루어지지 않은 경우, 같은 종에서 분리한 프로모터를 사용하여 이를 극복한 연구결과가 보고된 바 있다(Noda et al. 2013). CaMV35S 프로모터를 이용하여 파란색 델피니딘 색소를 생성하기 위한 필수 유전자인 F3’5’HDFR 유전자를 발현시키고, 장미의 내재 유전자인 DFR을 RNAi 기법으로 발현 억제함으로써 파란장미를 개발하였다(Katsumoto et al. 2007). 그러나 국화의 경우에는 장미의 경우에서처럼 CaMV35S 프로모터를 사용하여 파란색 국화를 개발하는 데는 성공하지 못하였다(Takatsu et al. 2000). 국화 내재 F3’H를 발현 억제는 CaMV35S 프로모터를 사용한 결과보다 페튜니아의 CHS 프로모터를 사용했을때 국화내의 빨간색의 시아니딘의 함량이 더 많이 줄어들었다(Brugliera et al. 2013). 파란색 카네이션의 개발에도 금어초 유래의 CHS 프로모터가 F3’5’H 유전자 발현시키는데 성공적으로 이용되었다(Tanaka & Brugliera 2013). 또한 도입유전자를 전신발현 프로모터인 CaMV35S 프로모터를 이용하여 형질전환체를 만들 경우 종종 의도하지 않는 현상이 보고되었다(Matzke et al. 2000, Cheon et al. 2004, Xu et al. 2006). 이는 콜리플라워 모자이크 바이러스 유래의 35S 프로모터가 외래유전자이기 때문에 숙주식물과의 호환성이 적고, 목적유전자의 과다발현으로 인해서 형질 전환 식물에서 화분 발달 장애, 생육 지연, 종자 생산량의 감소 또는 도입 유전자 침묵과 같은 결과를 초래하기 때문에 같은 종 유래의 프로모터를 사용하는 것이 바람직하다고 알려져 있다(Tyagi 2001).

식물체 잎을 이용하여 경구 백신을 생산하고자 하는 연구가 활발히 진행되고 있다(Streatfield & Howard 2003). 잎 특이적 프로모터의 개발은 유용 재조합 단백질의 잎 조직에서의 발현에 응용할 수 있다. 식물 잎 조직 특이 프로모터인 Rubisco small subunit promoter (tomato RbcS-3C)를 이용하여 상업용 cellulase로 사용 가능한 Acidothermus cellulolyticus endoglucanase E1의 발현을 증가시킨 결과, 형질전환 담배에서 생산된 E1은 생물학적으로 활성을 갖고 전체 수용성 단백질의 1.35% 수준으로 잎에 축적되는 것으로 밝혀졌다(Dai et al. 2000). 본 연구에서 분리한 4종 배추 프로모터도 채소류 및 화훼작물들에서 목표 유전자의 발현을 효율적으로 조절하는데 에 유용하리라 판단된다. 특히, CaMV35S 프로모터에 비교해서 상대적으로 강한 GUS 활성을 보여준 BR15와 BR16 프로모터는 목적 유전자의 발현을 전신에서 강하게 유도할 수 있을 것으로 생각된다. 본 연구에서 분리한 4종 프로모터를 십자화과 작물의 영양학적 또는 재배학적으로 유용한 유전자와 함께 적용하여 식물체에 도입한다면 형질 개량에 유용하게 이용될 수 있으리라 기대한다.

적요

프로모터는 목표유전자를 목적 조직에 효율적으로 발현시키기 필수 조절 요소이며, 프로모터의 동정은 생명공학을 활용한 작물형질개량 연구에 중요하다. 전신 발현 및 조직에 특이적으로 발현하는 프로모터를 배추에서 분리하고자, 배추 및 애기장대의 전사체 분석 결과와 공개된 생명정보DB를 활용하여 신규 프로모터 4종을 선발하여, 각각 BR4, BR11, BR15, BR16으로 명명하였다. 조직 특이적 발현을 나타내는 유전자의 상위의 약 2kb 영역의 서열을 배추 BAC 클론 DNA를 활용하여 확보한 후 클로닝하였다. 4종의 프로모터에 대해 각각 애기장대에 형질전환하여, 조직 화학적 GUS 염색법, 뿌리 조직의 GFP 형광분석, RT-PCR 및 GUS 활성 분석으로 특성을 관찰하였다. 4종의 프로모터 도입 형질전환체 모두 전신에서 GUS 염색이 관찰되었고, 유식물체 단계의 뿌리 조직에서도 모두 GFP 형광을 관찰하였다. 형광에 의한 GUS 활성 분석으로 BR11 프로모터는 CaMV35S 프로모터와 유사한 활성을 보여주었으며, BR4, BR15, BR16 프로모터들은 CaMV35S 프로모터에 비해 각각 1.5배, 4배, 18배 강한 GUS 활성도를 나타냈다. 본 연구에서 분리한 4종의 프로모터를 십자화과 작물의 기능성이 강화된 유용한 유전자와 함께 적용하여 식물체에 도입한다면 작물 형질 개량에 활용 가능할 것으로 판단된다.

보충자료

본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

사사

본 연구는 농촌진흥청 국립농업과학원 농업과학기술 연구개발사업(과제번호: PJ012458) 및 차세대바이오그린21사업(PJ011021 및 PJ011057) 지원에 의해 이루어진 것임.

Supplementary
References
  1. Al-Kaff NS, Covey SN, Kreike NM, Page AM, and Dale PJ. Transcriptional and post-transcriptional gene silencing in response to a pathogen. Science 1998;279:2113-2115.
    Pubmed CrossRef
  2. An YQ, Mcdowell JM, Huang S, Mckinney EC, Chambliss S, and Meagher RB. Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J 1996;10:107-121.
    Pubmed CrossRef
  3. Brugliera F, Tao GQ, Tems U, Kalc G, Mouradova E, Price K, Stevenson K, Nakamura N, Stacey I, Katsumoto Y, Tanaka Y, and Mason JG. Violet/blue chrysanthemums—metabolic engineering of the anthocyanin biosynthetic pathway results in novel petal colors. Plant Cell Physiol 2013;54:1696-1710.
    Pubmed CrossRef
  4. Cai M, Wei J, Li X, Xu C, and Wang S. A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific gene expression in transgenic plants. Plant Biotechnol J 2007;5:664-674.
    Pubmed CrossRef
  5. Callis J, Raasch JA, and Vierstra RD. Ubiquitin extension proteins ofArabidopsis thaliana. Structure, localization, and expression of their promoters in transgenic tobacco. J Biol Chem 1990;265:12486-12493.
    Pubmed
  6. Catanzariti AM, Lim GTT, and Jones DA. The tomatoI-3gene:a novel gene for resistance to Fusarium wilt disease. New Phytol 2015;207:106-118.
    Pubmed CrossRef
  7. Cheon BY, Kim HJ, Oh KH, Bahn SC, Ahn JH, Choi JW, Ok SH, Bae JM, and Shin JS. Overexpression of human erythropoietin (EPO) affects plant morphologies:retarded vegetative growth in tobacco and male sterility in tobacco and Arabidopsis. Transgenic Res 2004;13:541-549.
    Pubmed CrossRef
  8. Christensen AH, and Quail PH. Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 1996;5:213-218.
    Pubmed CrossRef
  9. Dai Z, Hooker BS, Anderson DB, and Thomas SR. Expression of Acidothermus cellulolyticus endoglucanase E1 in transgenic tobacco:biochemical characteristics and physiological effects. Transgenic Res 2000;9:43-54.
    Pubmed CrossRef
  10. Dinant S, Clark AM, Zhu Y, Vilaine F, Palauqui JC, Kusiak C, and Thompson GA. Diversity of the superfamily of phloem lectins (Phloem Protein 2) in angiosperms. Plant Physiol 2003;131:114-128.
    Pubmed KoreaMed CrossRef
  11. Graham MW, Craig S, and Waterhouse PM. Expression patterns of vascular-specific promoters RolC and Sh in transgenic potatoes and their use in engineering PLRV- resistant plants. Plant Mol Biol 1997;33:729-735.
    Pubmed CrossRef
  12. Hernandez-Garcia CM, Martinelli AP, Bouchard RA, and Finer JJ. A soybean (Glycine max) polyubiquitin promoter gives strong constitutive expression in transgenic soybean. Plant Cell Rep 2009;28:837-849.
    Pubmed CrossRef
  13. Hertzberg M, Aspeborg H, Schrader J, Andersson A, Erlandsson R, Blomqvist K, Bhalerao R, Uhlén M, Teeri TT, Lundeberg J, Sundberg B, Nilsson P, and Sandberg G. A transcriptional roadmap to wood formation. Proc Natl Acad Sci 2001;98:14732-14737.
    Pubmed KoreaMed CrossRef
  14. Javaid S, Amin I, Jander G, Mukhtar Z, Saeed NA, and Mansoor S. A transgenic approach to control hemipteran insects by expressing insecticidal genes under phloem-specific promoters. Sci Rep 2016;6:34706.
    Pubmed KoreaMed CrossRef
  15. Jefferson RA. Assaying chimeric genes in plants:The GUS gene fusion system. Plant Mol Biol Rep 1987;5:387-405.
    CrossRef
  16. Katsumoto Y, Fukuchi-Mizutani M, Fukui Y, Brugliera F, Holton TA, Karan M, Nakamura N, Yonekura-Sakakibara K, Togami J, Pigeaire A, Tao GQ, Nehra NS, Lu CY, Dyson BK, Tsuda S, Ashikari T, Kusumi T, Mason JG, and Tanaka Y. Engineering of the rose flavonoid biosynthetic pathway successfully generated blue-hued flowers accumulating delphinidin. Plant Cell Physiol 2007;48:1589-1600.
    Pubmed CrossRef
  17. Katzen F. Gateway(®) recombinational cloning:a biological operating system. Expert Opin Drug Discov 2007;2:571-589.
    Pubmed CrossRef
  18. Kim JS, Lim SH, Kang SH, Kim YM, and Lee JY. Identification of root-specific promoters derived fromArabidopsis thaliana. Korean J Breed Sci 2018;50:21-32.
    CrossRef
  19. Latham JR, and Wilson AK. Transcomplementation and synergism in plants:implications for viral transgenes?. Mol Plant Pathol 2008;9:85-103.
    Pubmed
  20. Lemgo GNY, Sabbadini S, Pandolfini T, and Mezzetti B. Biosafety considerations of RNAi-mediated virus resistance in fruit-tree cultivars and in rootstock. Transgenic Res 2013;22:1073-1088.
    Pubmed CrossRef
  21. Malik K, Wu K, Li X Q, Martin-Heller T, Hu M, Foster E, Tian L, Wang C, Ward K, Jordan M, Brown D, Gleddie S, Simmonds D, Zheng S, Simmonds J, and Miki B. A constitutive gene expression system derived from thetCUPcryptic promoter elements. Theor Appl Genet 2002;105:505-514.
    Pubmed CrossRef
  22. Matzke MA, Mette MF, and Matzke AJM. Transgene silencing by the host genome defense:implications for the evolution of epigenetic control mechanisms in plants and vertebrates. Plant Mol Biol 2000;43:401-415.
    Pubmed CrossRef
  23. Mette MF, van der Winden J, Matzke MA, and Matzke AJ. Production of aberrant promoter transcripts contributes to methylation and silencing of unlinked homologous promoters in trans. EMBO J 1999;18:241-248.
    Pubmed KoreaMed CrossRef
  24. Mubeen H, Bashir A, Shoaib MW, Raza S, and Hussains N. Cloning and characterization of beta tubulin gene promoter fromBrassica Rapaand its expression analysis. Intl J Sci Eng Res 2015;6:1447-1454.
  25. Noda N, Aida R, Kishimoto S, Ishiguro K, Fukuchi-Mizutani M, Tanaka Y, and Ohmiya A. Genetic engineering of novel bluer-colored chrysanthemums produced by accumulation of delphinidin-based anthocyanins. Plant Cell Physiol 2013;54:1684-1695.
    Pubmed CrossRef
  26. Odell JT, Nagy F, and Chua NH. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 1985;313:810-812.
    Pubmed CrossRef
  27. Rockhold DR, Chang S, Taylor N, Allen PV, McCue KF, and Belknap WR. Structure of twoSolanum bulbocastanumpolyubiquitin genes and expression of their promoters in transgenic potatoes. Am J Potato Res 2008;85:219-226.
    CrossRef
  28. Rask L, Ellerstrom M, Ezcurra I, Stalberg K, and Wycliffe P. Seed-specific regulation of the napin promoter inBrassica napus. J Plant Physiol 1998;152:595-599.
    CrossRef
  29. Sadeghi A, Broeders S, De Greve H, Hernalsteens JP, Peumans WJ, Van Damme EJM, and Smagghe G. Expression of garlic leaf lectin under the control of the phloem-specific promoter Asus1 from Arabidopsis thaliana protects tobacco plants against the tobacco aphid (Myzus nicotianae). Pest Manage Sci 2007;63:1215-1223.
    Pubmed CrossRef
  30. Slocombe SP, Piffanelli P, Fairbairn D, Bowra S, Hatzopoulos P, Tsiantis M, and Murphy DJ. Temporal and tissue-specific regulation of aBrassica napusstearoyl-acyl carrier protein desaturase gene. Plant Physiol 1994;104:1167-1176.
    Pubmed KoreaMed CrossRef
  31. Stöger E, Williams S, Christou P, Down RE, and Gatehouse JA. Expression of the insecticidal lectin from snowdrop (Galanthus nivalisagglutinin;GNA) in transgenic wheat plants:Effects on predation by the grain aphidSitobion avenae. Mol Breeding 1999;5:65-73.
    CrossRef
  32. Streatfield SJ, and Howard JA. Plant production systems for vaccines. Expert Rev Vaccines 2003;2:763-775.
    Pubmed CrossRef
  33. Takatsu Y, Hayashi M, and Sakuma F. Transgene inactivation inAgrobacterium-mediated chrysanthemum (Dendranthema grandiflorum(Ramat.) Kitamura) transformants. Plant Biotechnol 2000;17:241-245.
    CrossRef
  34. Tanaka Y, and Brugliera F. Flower colour and cytochrome P450. Philos Trans R Soc B 2013;368:20120432.
    Pubmed KoreaMed CrossRef
  35. Truernit E, and Sauer N. The promoter of theArabidopsis thaliana SUC2sucrose-H+symporter gene directs expression of β-glucuronidase to the phloem:Evidence for phloem loading and unloading by SUC2. Planta 1995;196:564-570.
    Pubmed CrossRef
  36. Tyagi AK. Plant genes and their expression. Curr Sci 2001;80:161-191.
  37. Weigel D, and Glazebrook J. Transformation of agrobacterium using the freeze-thaw method. CSH Protoc Array:pdb.prot4666.
  38. Wu L, El-Mezawy A, and Shah S. Isolation and evaluation of three novel native promoters inBrassica napus. Botany 2013;91:414-419.
    CrossRef
  39. Xu R, Zhao H, Dinkins RD, Cheng X, Carberry G, and Li QQ. The 73 kD subunit of the cleavage and polyadenylation specificity factor (CPSF) complex affects reproductive development in Arabidopsis. Plant Mol Biol 2006;61:799-815.
    Pubmed CrossRef
  40. Yi N, Oh SJ, Kim YS, Jang HJ, Park SH, Jeong JS, Song SI, Choi YD, and Kim JK. Analysis of the Wsi18, a stress-inducible promoter that is active in the whole grain of transgenic rice. Transgenic Res 2011;20:153-163.
    Pubmed CrossRef
  41. Zhao Y, Liu Q, and Davis RE. Transgene expression in strawberries driven by a heterologous phloem-specific promoter. Plant Cell Rep 2004;23:224-230.
    Pubmed CrossRef
  42. Zheng X, Deng W, Luo K, Duan H, Chen Y, McAvoy R, Song S, Pei Y, and Li Y. The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters. Plant Cell Rep 2007;26:1195-1203.
    Pubmed CrossRef


December 2018, 50 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information