search for


Reddish Brown Rice Variety ‘Superhongmi’ with High Taxifolin Content
탁시폴린 고함유 적갈색미 신품종 ‘슈퍼홍미’
Korean J Breed Sci 2019;51(2):91-98
Published online June 1, 2019
© 2019 Korean Society of Breeding Science.

Tae-Ho Ham1,3, Da-Eun Im2, Soon-Wook Kwon2, Su-Noh Ryu3,*
함태호1,3, 임다은2, 권순욱2, 류수노3,*

1Institute of Life and Environment, Konkuk University, Seoul 05029, Republic of Korea,
2Dept. of Plant Bioscience, Pusan National University, Miryang 50463, Republic of Korea,
3Dept. of Agricultural Science, Korea National Open University, Seoul 03087, Republic of Korea
1건국대학교 생명환경연구소,
2부산대학교 생명자원과학대학 식물생명과학과,
3한국방송통신대학교 자연과학대학 농학과
Correspondence to: (E-mail:, Tel: +82-2-3668-4631, Fax: +82-2-3673-2381)
Received February 27, 2019; Revised March 2, 2019; Accepted March 15, 2019.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

‘Superhongmi’, a reddish brown rice cultivar, was derived from a cross between CG2-3-5-1-6-1 (Heugjinju/Suwon 425) producing blackish purple rice and ‘Daeribbyeo 1’ producing large white grains. A promising line, SR28721-7-5-2-1-2-1, was obtained using the pedigree breeding method from 2003 to 2015 and designated as ‘KNOU6R’. This variety headed on September 5, and its culm length is 94.7 cm. The panicle length of ‘Superhongmi’ is 19.8 cm. The number of panicles per hill and grain per panicle is 5.4 ea and 154.9 ea, respectively. The fertility ratio of ‘Superhongmi’ is approximately 91.0% and 1000-grain weight (TGW) is approximately 26.8 g, which is similar to that of ‘Superjami’; however, the number of panicles per hill is half of that of ‘Superjami’. The content of taxifolin and total polyphenol extracted from whole grains of ‘Superhongmi’ is 67.7 and 248 mg/100g seed weight, respectively (Registration No. 7365).

Keywords : Pigmented rice, Reddish brown rice, Polyphenol, Taxifolin
서 언

도정률을 조정하여 쌀에서 일부만 제거한 현미의 미강(과피, 종피, 호분층)은 풍부한 식이섬유는 물론 다양한 유용성분이 포함되어 있다는 사실이 알려져 기능성 소재의 원료로서 각광을 받고 있다. 쌀의 여러가지 생리적 효능이 규명되면서 쌀을 주식으로 하는 동양뿐만 아니라 밀을 주식으로 하는 서양에서도 쌀에 대한 관심이 높아지고 있다. 미국 암연구소에서는 암 예방 식품 41가지를 선정하며 현미를 포함하여 발표하기도 하였다(The University of Texas MdAnderson Cancer Center 2015). 특히 유색미 품종의 미강은 일반 벼 품종의 미강에 함유된 성분 보다 높은 항산화 활성을 바탕으로 다양한 기능성이 보고된 바 있다(Cho et al. 1996, Kim et al. 2011, Xia et al. 2003).

유색미는 현미 미강이 붉은색 혹은 자색이 대부분이다. 자색계열은 주로 안토시아닌계 색소로 구성되며 특히 cyanidin 3-glucoside (C3G) 형태가 가장 많고(Terahara et al. 1994), 이외에 peonidin 3- glucoside (P3G), cyaniding 3-rhamnoside, malvidin 3-galactoside, pelargonidin 그리고 selphinidin 등 다양한 성분으로 구성되어있다(Park et al. 2008, Reddy et al. 1995, Ryu et al. 1998). 안토시아닌은 항산화활성(Han et al. 2004, Kim et al. 2010, Osawa 1992), 항염효과(Wang et al. 1997), 항암효과(Dai et al. 2009), 항아토피효과(Han et al. 2007, Han et al. 2009), 항당뇨효과(Kim et al. 2010) 및 심혈관계 질병 등의 예방과 치료 효과가 있는 것으로 밝혀졌다(Verlangieri et al. 1985).

유색미는 흑자색계열뿐만 아니라 tannin을 주 색소로 하는 적갈색계열 품종으로도 다양하게 개발되었다. ‘홍진주’는 페놀릭산과 플라보노이드 함량이 기존 유색미 보다 많이 함유되어 있다고 보고되었고(Yang et al. 2011), ‘건강홍미’는 다른 적갈색미 보다 폴리페놀 함량이 높고 항산화활성이 높다고 보고되었다(Song et al. 2017).

최근 ‘슈퍼홍미(품종보호권등록번호: 제7365호, 2018.09.13)’ 품종에서는 탁시폴린(Taxifolin)이라는 항당뇨 효과가 있는 쿼세틴 성분이 밝혀지면서 관심이 모아지고 있다(Sun et al. 2014, Ryu 2018). 본 연구에서는 적갈색계 기능성 품종으로 개발된 ‘슈퍼홍미’ 벼 품종의 작물학적 특성과 품질 특성 및 분자마커 특성을 구명하고, 이를 활용하여 기능성 식품소재 개발을 위한 기초자료로 활용코자 수행하였다.

재료 및 방법


본 시험에서는 ‘슈퍼홍미’ 품종을 2012년~2014년까지 3년간 중부평야 지역에서 ‘슈퍼자미’를 대조품종으로 보통기, 보비재배로 하여 주요농업형질과 기능성 성분 함량을 비교 검토하였다. 공시 품종은 5월 2일에 파종하여 6월 4일에 이앙하였으며, 재식거리 30 × 15 cm로 주당 1본으로 하였다. 시비량 및 질소분시방법은 농촌진흥청 표준재배법에 준하였다.


1. 지방산(fatty acid)

분말을 시료를 동결건조하여 곱게 가루로 만든 후 일정량의 시료를 Teflon cap이 있는 튜브에 넣었다. Methylation mixture (MeOH:Benzen:DMP:H2SO4 = 39:20:5:2)를 340μL heptane 200μL를 넣어 흔든 후 80°C에서 2시간 추출하였다. 추출 후 상온 냉각하여 형성된 두 층 중 상등액을 일정량 추출 후 Gas Chromatography (GC) 분석하였다. GC 조건은 250°C에 컬럼은 DB-23 (Agilent, 60 mm × 0.25 mm × 0.25 um)로 하여 분광광도계 FID (280°C, H2 35, Air 350, He 35 ml/min)를 이용하여 측정하였다(Rafael & Mancha 1993).

2. 총 폴리페놀(Total Polyphenol) 함량

총 폴리페놀 함량은 Folin-Ciocalteu 방법으로 측정하였다(Singleton et al. 1965). 시료 용액 50 uL에 증류수 5 mL을 넣은 후 Folin Ciocalteu’s phenol reagent 0.5 mL을 첨가하여 교반하였다. 5분 후 Na2CO3용액 1.5 mL을 가하고 증류수로 희석하여 총 volume이 10 mL이 되도록 한 다음 교반하였다. 실온에서 2시간 방치 후 분광광도계(DU 800 series, Beckman Coulter, USA)를 이용하여 765 nm에서 흡광도를 측정하였다. 총 페놀화합물 함량은 gallic acid로 표준 검량곡선을 작성하여 계산하였으며 100 g 건식 중량에 대한 mg gallic acid equivalents (GAE)로 나타내었다.

3. 탁시폴린(Taxifolin) 함량

종피에 함유된 탁시폴린 성분 추출을 위해 유색미 종자를 제현 후 곱게 마쇄한 분말 1 g에 10 mL MeOH을 혼합한 후 40°C에서 150 rpm 으로 2시간 추출하였다. 추출액을 원심분리(8,000 rpm, 4°C, 30 min)한 후 상등액을 Whatman No. 1 필터로 여과하였다. 여과액을 감압농축하여 분석하였다. HPLC 분석은 40°C에 ODS-80TM (TOSOH 4.6 × 150) column을 사용하였고, 295 nm 파장으로 검량하였다. 이동상 A는 증류수를 B는 60% Me-OH (pH 2.4 Phosphoric acid)를 사용하였고, 유속은 1.0 mL/min으로 하였다.

DNA 분석

DNA 추출은 각 종자를 파종 후 20일경 키운 어린잎을 따서 NucleoSpin® Plant Ⅱ kit (MACHEREY-NAGEL, Germany)를 이용하여 추출하였고 추출된 DNA는 nanodrop (Thermo, USA)으로 정량하여 10 ng/μL로 희석하여 사용하였다. 10 ng/μL의 DNA를 5 μL, 10x reaction buffer를 2 μL, 2.5 mM d-NTP를 1.6 μL, 10 pmol forward primer와 reverse primer를 각 1 μL, taq enzyme을 0.5U 혼합한 후 증류수로 총량을 20 μL로 맞추어 PCR을 진행하였다(Table 1).

PCR condition for DNA analysis.

Marker PCR condition (Restrict enzyme treatment) Electrophoresis
SSR marker 95℃ 5 min, 95℃ 30 sec, 58℃ 30 sec, 72℃ 60 sec, 35 cycle Fragment Analyzer (8.0 kv, 90 min)
CAPS_DFR 98℃ 2 min, 98℃ 15 sec 60℃ 15 sec 68℃ 30 sec, 37 cycle, 72℃ 10 min (Taqα165℃,8 h) 1.5% Agarose gel (100 v, 20 min)
CAPS_Ra 94℃ 5 min, 94℃ 45 sec 55℃ 45 sec 72℃ 90 sec, 37 cycle, 72℃ 10 min (BamH137℃,8 h) 1.5% Agarose gel (100 v, 40 min)
Rc3s20/Rc3s21 94℃ 5 min, 94℃ 35 sec 55℃ 35 sec 72℃ 60 sec, 35 cycle, 72℃ 10 min Fragment Analyzer (8.0 kv, 90 min)

SSR marker와 색소합성관련 유전자의 CAPS marker 와 InDel marker (Lim & Ha 2013, Table 2)를 적용하여 슈퍼홍미의 품종구분과 색소합성관련 DFR, Ra 그리고 Rc 유전자를 분석하였다.

Primer sequence of SSR marker, CAPs marker and InDel marker for genes related with pigment synthesis in rice.

Marker name Primer sequence (5’ – 3’) Expected sizez Remark
Rc3s20/Rc3s21 Fw AAAGGTACCAAAGATCGCAG N & B:424, R:438 14bp deletion

N: Normal colored pericarp, B: Blackish colored pericarp, R: Reddish colored pericarp

결과 및 고찰


2003년 ‘흑진주벼’와 ‘수원425호’ 교배 후대 계통 중 C3G 함량이 높은 계통(C3GHi)과 백미 대립종인 ‘대립벼 1호’를 인공교배한 F2세대에에서 초형이 우수하고, 유색현미 개체를 선발하였다. ‘슈퍼홍미’는 2003년 동계온실에서 세대진전 후 2009년까지 매년 계통재배하면서 포장에서 선발을 실시하였다. 유색미 선발 계통 중 목표에 부합된 적갈색계통을 선발하여 KNOU6R이라 명명하였다. 2012년부터 2014년까지 재배시험을 통해 기본농업형질인 출수기, 간장, 현미천립중 등을 조사하였다. 2015년과 2016년 포장에 1주 1본으로 이앙하여 균일성을 조사한 결과 전체적으로 균일하고 이형주가 발견되지 않았다(Figs. 1, 2).

Fig. 1.

Pedigree diagram of ‘Superhongmi’.

Fig. 2.

Genealogical diagram of ‘Superhongmi’.

출수기 및 주요 농업적 특성

’슈퍼홍미’ 품종의 출수기는 중부평야 보통기 재배에서 9월 5일로 ‘슈퍼자미’ 품종보다 8일 늦은 만생종이다. 또한 ‘슈퍼홍미’ 품종의 간장은 94.7 cm으로 ‘슈퍼자미’보다 20 cm 가량 크다. 수장은 19.8 cm로 ‘슈퍼자미’와 비슷하다. 포기당 이삭수는 5.4개로 ‘슈퍼자미’의 절반수준이다. 이삭당 벼알 수는 154.9개로 ‘슈퍼자미’의 110.2개 보다 많다. ‘슈퍼홍미’의 임실률은 91.0% 수준이고, 현미 천립중은 26.8 g으로 ‘슈퍼자미’보다 가볍다(Table 3).

Major agronomic traits and yield components.

Cultivar Year Heading date Culm Length (cm) Panicle length (cm) No. of panicle per hill No. of grain per panicles Ratio of Fertility (%) Brown rice 1000 grain weight (g)
Superjami 2012 Aug. 29 76.8 19.3 10.8 104.2 83.4 25.9
2013 Aug. 28 74.8 19.7 10.5 115.1 83.0 26.3
2014 Aug. 26 73.0 20.6 10.4 111.3 82.1 32.1
Averagez 74.9 ±1.9 19.9 ±0.7 10.6 ±0.2 110.2 ±5.5 82.8 ±0.7 28.1 ±3.5

Superhongmi 2012 Sep. 5 96.4 20.5 5.2 139.4 92.0 27.4
2013 Sep. 7 92.5 19.3 5.6 170.4 92.8 27.2
2014 Sep. 3 95.2 19.5 5.4 154.9 88.3 25.8
Averagez 94.7 ±2.0 19.8 ±0.7 5.4 ±0.2 154.9 ±15.5 91.0 ±2.4 26.8 ±1.0

Values are expressed as means±SD

도정 및 품질특성

정현비율은 81.7%로 ‘슈퍼자미’와 비슷하고, ‘슈퍼홍미’의 현미 장폭비는 2.01의 장원형으로 대표적인 흑자색미 품종인 ‘흑진주벼’에 비해 길이와 폭이 각각 12%, 30%로 증가되었다(Table 4). 지방산조성 분석 결과 슈퍼홍미에는 불포화지방산 중 올레산(C18:1)과 리놀레산(C18:2)의 함량이 높았고, 포화지방산은 함량이 낮았다(Table 5). ‘슈퍼홍미’ 품종에서는 총폴리페놀 함량과 탁시폴린 함량이 탁월하게 높았다. 기존의 적갈색 품종인 적진주, 홍진주 그리고 건강홍미에서 탁시폴린은 검출되지 않거나 미량이었다(Tables 6, 7).

Grain appearance and milling properties of ‘Superhongmi’.

Cultivar Rough rice (mm) Brown rice (mm) Dehulling recovery (Brown/Rough) (%)

Length Width L/W ratio Length Width L/W ratio
Heugjinju (a) 7.63 3.11 2.45 5.77 2.46 2.35 75.6
Superjami (b) 8.54 3.84 2.22 5.85 2.95 1.98 76.8
Superhongmi (c) 9.05 3.91 2.31 6.44 3.21 2.01 81.7
(c) / (a) 1.18 1.25 1.12 1.30

Fatty acid compositon in ‘Superhongmi’ (%).

Cultivar Saturated fatty acid (SFA) Unsaturated fatty acid (USFA) SFA USFA

C16:0 C18:0 C18:1 C18:2 C18:3
Heugjinju 21.6 3.1 38.9 38.9 1.9 27.4 75.3
Superjami 20.1 2.6 38.8 37.1 1.4 22.7 77.3
Superhongmi 19.2 3.1 38.2 38.0 1.2 22.3 77.4

Total polyphenol contents of the 70% ethanolic extracts from pigmented rice varieties.

Varieties Total polyphenol contents (mg/100g seed weight)
Heugjinju 109.31±1.36
Sueperjami 231.32±1.83
Superhongmi 248.31±2.21

Values are expressed as mean±SE

The result of Taxifolin content analysis on reddish browon rice varities.

Varieties Taxifolin content (mg/100g)

2015 yr 2016 yr
Jeogjinju - -
Hongjinju - -
Geonganghongmi - 0.82
Superhongmi 67.72 24.16

The result of DNA analysis by 5 SSR marker in colored rice.

1N 2N 3B 4B 5B 6R 7R 8R 9R
RM333 201 174 154 168 154 154 165 168 162
a b f c f f d c e
RM5916 180 177 138 138 177 177 138 138 177
a b c c b b c c b
RM7285 146 170 174 158 170 170 166 170 170
e b a d b b c b b
RM7511 174 178 182 194 178 178 178 182 182
d c b a c c c b b
RM481 181 163 154 163 163 163 163 181 142
a b c b b b b a d

Rice cultivars (1) Hwayoung, (2) Daeribbyeo 1, (3) Heugjinju, (4) Suwon425, (5) Superjami 2, (6) Superhongmi, (7) Geonganghongmi, (8) Jeogjinju, (9) Hongjinju

N: Normal colored pericarp, B: Blackish colored pericarp, R: Reddish colored pericarp

Different letters indicate significant differences in PCR band size

*Heugjinju, Suwon 425 and Daeribbyeo 1 are parents of ‘Superhongmi’ variety

Ryu (2018)는 중부지역과 남부지역의 재배시험을 통해 ‘슈퍼홍미’는 남부지역에 조기 이앙하여 재배기간을 늘리는 것이 성분햠량과 수량 등에 유리하다고 하였으며 전형적인 만생종 특징을 보였다고 하였다.

DNA 다형성 검정

DNA 다형성 검정에서 다섯 개의 SSR marker (RM333, RM481, RM5916, RM7511, RM7285)를 이용하여 DNA를 분석하였을 때 ‘슈퍼홍미’는 모본인 ‘흑진주벼’, ‘수원 425호’ 및 ‘대립벼 1호’의 교배후대임을 보여주었다. 5개 마커에서 슈퍼자미2호와 슈퍼홍미는 동일한 패턴을 보였다. RM333에서는 모본인 흑진주의 대립유전자를 보였고, RM5916, RM7285, RM7511 및 RM481에서는 모본인 ‘대립벼 1호’의 대립유전자를 보였다. 기존 적갈색미인 적진주, 홍진주, 건강홍미와 RM333 마커로 구분되었으며, RM5916과 RM7511 조합 또는 RM5916과 RM481의 조합으로도 구분이 가능하였다(Fig. 3).

Fig. 3.

PCR product patterns of two white rice cultivars (1 and 2), three blackish purple rice cultivars (3 to 5) and four reddish brown rice cultivars (6 to 9) amplified by SSR markers. Rice cultivars (1) Hwayoung, (2) Daeribbyeo 1, (3) Heugjinju, (4) Suwon425, (5) Superjami 2, (6) Superhongmi, (7) Geonganghongmi, (8) Jeogjinju, (9) Hongjinju were used as templates for PCR reaction.

색소생합성관련 유전자마커 분석결과 슈퍼홍미는 기존의 적갈색미(적진주, 홍진주, 건강홍미)가 가지는 Rc 유전자가 탐색되지 않았으며, CAPs_Ra를 이용한 분석에서는 흑자미와 동일 패턴을 보였다. Dihydroquercetin을 전구물질로 leucoanthocyanidins를 합성(Porter & Foo 1982) 하는 dihydroflavonol 4-reductase (DFR)의 유전자에서 ‘슈퍼홍미’는 기존의 흑자미와 적갈색미와는 다른 양상을 보이고 오히려 백미품종과 같은 패턴을 보여주었다(Fig. 4). 기존의 보고에 적갈색 유색미는 Rc/Rd 유전자에 표현형이 조절되어 나타난다고 하였으나(Nagao & Takahashi 1947), ‘슈퍼홍미’의 경우는 흑자색미에서 DFR 유전자의 변이에 의한 것으로 판단되었다.

Fig. 4.

PCR product patterns of two white rice cultivars (1 and 2), three blackish purple rice cultivars (3 to 5) and four reddish brown rice cultivars (6 to 9) amplified by CAPS and InDel markers. Rice cultivars (1) Hwayoung, (2) Daeribbyeo 1, (3) Heugjinju, (4) Suwon425, (5) Superjami 2, (6) Superhongmi, (7) Geonganghongmi, (8) Jeogjinju, (9) Hongjinju were used as templates for PCR reaction.

적 요

전통적인 교배육종을 통하여 탁시폴린(Taxifolin) 함량을 높인 ‘슈퍼홍미’ 품종의 작물학적 특성과 품질특성을 조사 분석한 결과, 중부평야지에서 출수기는 9월 5일로 만생종이며, 간장은 94.7 cm 정도로 장간종이다. 임실률은 91.0%이고 현미천립중은 26.8 g 정도인 품종이다. ‘슈퍼홍미’의 현미 장폭비는 2.01의 장원형으로 흑진주벼에 비해 길이와 폭이 12%, 30%로 증가된 대립종이다. ‘슈퍼홍미’ 품종의 종자 100 g 당 탁시폴린 함량은 2015년에는 67.7 mg, 2016년에는 24.2 mg으로 분석되었다.

사 사

이 논문은 농촌진흥청 차세대바이오그린21사업(PJ01314002)의 지원에 의해 이루어진 것임.

  1. Cho MH, Paik YS, Yoon HH, Hahn TR. 1996. Chemical structure of the major color component from a Korean pigmented rice variety. Agr Chem & Biotech 39: 304-308.
  2. Dai J, Gupet A, Gates L, Mumper RJ. 2009. A comprehensive study of anthocyanin-containing extracts from selected blackberry cultivars: Extraction methods, stability, anticancer properties and mechanisms. Food and Chemical Toxicology 47: 837-847.
    Pubmed CrossRef
  3. Han SJ, Kim JS, Chae SW, Kang SS, Ryu SN, Hyun JW, Son KH, Shon HY, Chan HW. 2004. Biological screening of extracts from the colored rice cultivars. Kor J Pharmacogn 35: 346-349.
  4. Han SJ, Ryu SN, Trinh HT, Joh EH, Jang SY, Han MJ, Kim DH. 2009. Metabolism of cyanidin-3-O-beta-D- glycoside isolated from black rice and its anti-scratching behavioral effect in mice. J of Food Science 74: H253-H258.
    Pubmed CrossRef
  5. Han SJ, Trinh HT, Hong SS, Ryu SN, Kim DH. 2007. Antipruritic effect of black colored rice. Natural Product Science 13: 373-377.
  6. Kim DJ, Choi SM, Kim HY, Kim JH, Ryu SN, Han SJ, Hong SG. 2011. Evaluation of biological activities of fermented rice bran from novel black colored rice cultivar SuperC3GHi. Kor J Crop Sci 56: 420-426.
  7. Kim HY, Kim JH, Lee SA, Ryu SN, Han SJ, Hong SG. 2010. Antioxidative and anti-diabetic activity of C3GHi, novel black rice breed. Kor J Crop Sci 55: 38-46.
  8. Lee SH, Won JS, Ahn DJ, Choi KY, Lee WG, Park SD, Son JK. 2005. Comparison of rice quality according to agroclimatic regions in Gyeoungbuk province. Kor J Crop Sci 50(s): 94-98.
  9. Lim SH, Ha SH. 2013. Marker development for the identification of rice seed color. Plant Biotechnol Rep 7: 391-398.
  10. Nagao S, Takahashi M. 1947. Ein Beitrag zu einer genotypishen Analyse der Farbeigenshaften der Spelze und der anderen Pflanzenteile bei der Reispflanze. Jap J Genet Supp 1: 1-27.
  11. Osawa T, Ramarathnam N, Kawakishi S, Namiki M. 1992 Phenolic Compounds in Food and Their Effects on Health II. Antioxidants & Cancer Prevention. Washington, American Chemical Society.
  12. Park YS, Kim SJ, Chang HI. 2008. Isolation of anthocyanin from black rice (Heugjinjubyeo) and screening of its antioxidant activities. Kor J Microbiol Biotechnol 36: 55-60.
  13. Rafael G, Mancha M. 1993. One-Step Lipid Extraction and Fatty Acid Methyl Esters Preparation from Fresh Plant. Tissues. Analy. Biochem 211: 139-143.
    Pubmed CrossRef
  14. Reddy VS, Dash S, Reddy AR. 1995. Anthocyanin pathway in rice (Oryza sativa L.): Identification of a mutant showing dominant inhibition of anthocyanins in leaf and accumulation of proanthocyanidins in pericarp. TAG 91: 301-312.
    Pubmed CrossRef
  15. Ryu SN. 2018. Environmental variation of taxifolin content in a rice variety 'Superhongmi'. Korean J Breed Sci 50: 45-49.
  16. Ryu SN, Park SZ, Ho CT. 1998. High performance liquid chromatographic determination of anthocyanin pigments in some varieties of black rice. Journal of Food and Drug analysis 6: 729-736.
  17. Singleton VL, Orthofer R, Lamuela-Raventos RM. 1999. Analysis of total phenol and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. Methods in Enzymology 299: 152-178.
  18. Sun X, Chen RC, Yang ZH, Sun GB, Wang M, Ma XJ, Yang LJ, Sun XB. 2014. Taxifolin prevents diabetic cardiomyopathy in vivo and in vitro by inhibition of oxidative stress and cell apoptosis. Food Chem Toxicol 63: 221-232.
    Pubmed CrossRef
  19. Terahara N, Saigusa N, Ohba R, Ueda S. 1994. Composition of anthocyanin pigments in aromatic red rice and its wine. J Japanese Soc Food Sci Technol 41: 519-522.
  20. University of Texas MD Anderson Cancer Center. 2015. 41 foods that may reduce your cancer risk
  21. Verlangieri A, Kapeghian J, el-Dean S, Bush SM. 1985. Fruit and vegetable consumption and cardiovascular mortality. Med. Hypotheses 16: 7-15.
    Pubmed CrossRef
  22. Wang H, Cao G, Prior RL. 1997. Oxygen radical absorbing capacity of anthocyanins. J Agri Food Chem 45: 304-309.
  23. Xia M, Ling WH, Ma J, Kitts DD, Zawistoski J. 2003. Supplementation of diets with the black rice pigment fraction attenuates atherosclerotic plaque formation in Apolipoprotein E Deficient Mice. J Nutr 133: 744-751.
    Pubmed CrossRef

June 2019, 51 (2)
Full Text(PDF) Free

Social Network Service

Cited By Articles
  • CrossRef (0)

Funding Information