search for




 

Characterization of Watermelon (Citrullus lanatus) Accessions Introduced from USDA
미국 USDA에서 도입한 수박 유전자원의 특성
Korean J Breed Sci 2019;51(4):357-366
Published online December 1, 2019
© 2019 Korean Society of Breeding Science.

Kyung Jun Lee**, Jung-Ro Lee**, Gyu-Taek Cho, Myoung-Jae Shin, Seong-Hoon Kim, Sookyeong Lee, Sea-Hee Han, and Do Yoon Hyun*
이경준** · 이정로** · 조규택 · 신명재 · 김성훈 · 이수경 · 한세희 · 현도윤*

National Agrobiodiversity Center, National Institute of Agricultural Sciences (NAS), RDA, Jeonju, Jeollabuk-do, 54874, Republic of Korea
농촌진흥청 국립농업과학원 농업유전자원센터
Correspondence to: *(E-mail: dyhyun@korea.kr, Tel: +82-63-238-4912, Fax: +82-63-238-4859)
**Author Contributions: Kyung Jun Lee and Jung-Ro Lee contributed equally
Received August 30, 2019; Revised September 5, 2019; Accepted October 7, 2019.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
In this study, watermelon accessions introduced from the USDA were characterized for 12 morphological characteristics of leaf, flower, fruit, and seed, according to the National Agrobiodiversity Center descriptor list. In addition, to confirm the genetic composition of each watermelon accession, genetic profiling was performed using 20 simple sequence repeat (SSR) markers. A total of 154 watermelon accessions from the USDA were collected from 31 different countries, among which, 12.3% (19 accessions) were from Turkey. Morphological characterization revealed that the accessions displayed a large diversity. Genetic profiling using 20 SSR markers showed that six accessions (K192117, K192028, K193400, K192376, K192499, and K192800) were expected to be inbred lines among the 154 watermelon accessions. The 12 characters scored were analyzed using discriminant analysis of principal components (DAPC). The result revealed 68.1% of the total variability and indicated variations among accessions, mainly based on fruit stripes and fruit shape along the longitudinal section. The accessions were divided into eight groups according to DAPC, although the geographical origin was not a great source for the grouping. Our results will be helpful for the efficient management of germplasms and in understanding and selecting watermelon accessions for the breeding process.
Keywords : watermelon, morphological variation, discriminant analysis of principal components
서 언

수박(Citrullus lanatus)은 박과(Cucurbitaceae)에 속하는 주요 과채류 중 하나로 남아프리카가 원산지이며 재배종은 대부분 여름철에 생식으로 소비되고 지역에 따라 음료, 사료 또는 약용 등 다양하게 이용된다(Cho et al. 2014). 우리나라의 수박 재배 면적은 2017년 12,661ha이며, 생산량은 약 51만톤으로 매년 감소하는 추세지만 국내 수박 종자 시장은 과채류 중에서 6번째로 큰 것으로 알려져 있다(Kwon et al. 2015, Kim et al. 2016, KREI 2018).

수박 식물체의 각 부위는 소비자와 생산자가 원하는 유용한 형질들이 다르게 존재한다(Soltani et al. 2016). 수박 육종가들은 품종 육종의 기준으로 생산성과 품질의 우수성뿐만 아니라 환경이나 병에 대한 저항성 여부도 중요하게 여긴다. 또한 당도, 기능성 성분 등 변해가는 소비자의 요구에 따른 시장흐름에 맞추어 육종 방향을 설정하고 있으며 이와 더불어 세계종자시장은 그 규모가 거대해지고 또한 글로벌화 되고 있는 추세이다. 이와 같은 종자산업의 국내외 변화양상은 국내에서도 우수하고 다양한 종자 유전자원에 대한 연구개발 및 보급에 대한 위기를 확산시키고 있다(Cho et al. 2014).

수박은 약 91%가 수분으로 이루어져 있어 여름철 갈증 해소를 위하여 소비가 많이 되며, 라이코펜, 시트룰린 등 기능성 물질을 함유하고 있어 건강 식품으로 활용되고 있다(Lee et al. 2014, Lee et al. 2018). 국내에서 생산, 판매되는 수박은 F1이 대부분이며 종자회사가 주축이 되어 수박 품종을 육종하고 있다(Park & Cho 2012, Kim et al. 2016,). 종자회사의 경우 소비자의 선호도에 맞춰 육종 목표를 설정하기 때문에 품종의 다양성 보다는 상품성에 초점을 맞춰 품종을 개발할 수 밖에 없으며, 육종에 이용되는 종자회사 보유 유전자원의 한계성 때문에 개발되는 수박 품종은 유전적으로 매우 가까울 것이라 추정된다(Kwon et al. 2015, Kim et al. 2016). 이와 같이 작물에서 유전적 다양성이 낮을 경우 환경 변화, 병해충 등에 취약해질 수 있으며 아일랜드 대기근으로 대표되는 유전적 재난을 가져올 수 있기 때문에 재래종 및 야생 근연종, 유용한 유전자원의 도입을 통한 유전자원의 다양성 확보는 육종 프로그램에 있어 매우 중요하다(Ramanatha Rao & Hodgkin 2002).

유전적 다양성 분석은 교배 육종의 기본인 부모 세대의 유전적 배경 확인 등 품종 개발에 있어 중요한 역할을 한다(Kwon et al. 2002, Mazid et al. 2013). Chowdhury et al. (2002)은 유전적 다양성에 대해 자세히 아는 것이 유용한 자원을 선발하는 효율을 높일 수 있다고 보고하였다. 전통적으로 형태적 특성은 유전적 다양성을 분석하고 유전자원의 동정을 위해 활용이 되었으며 분자유전학적 분석 방법에 비해서는 낮은 수준이지만 정밀한 여타 방법 사용 이전에 큰 범주의 그룹화를 위해 주로 활용되었다(Malek et al. 2014). Khalid et al. (2010)에 따르면 식물 분류학에서는 아직도 형태학적 특성에 의존하고 있으며 이 방법은 여타 방법에 비해서 비용 및 시간 소모가 적으며 기술적 지식도 필요하지 않다.

수박 자원의 경우 미국, 터키, 중국, 남아프리카 등의 유전자원 관리기관에서 수집과 평가가 활발하게 진행되어 있다(Levi et al. 2017). 국내에는 농촌진흥청 국립농업과학원 농업유전자원센터에 1,240자원이 국가등록번호를 부여 받아 활용되고 있으며, 아직 등록되지 않은 임시자원 3,472자원이 보존되고 있다. 본 연구에서는 임시 자원들 중 미국 USDA에서 도입한 수박 154자원에 대하여 형태적 특성 및 Simple Sequence Repeat (SSR) 마커를 이용한 유전적 상태 확인을 통해 유전자원관리 효율성 증진 및 유용 육종 소재 선발을 위한 기초 자료를 얻고자 실험을 수행하였다.

재료 및 방법

식물재료 및 특성조사

공시된 수박 154자원은 USDA에서 도입하여 농촌진흥청 국립농업과학원 농업유전자원센터에 보관중인 자원을 분양 받아 실험을 수행하였다(Table 1). 2018년 농업유전자원센터 비닐하우스 시설을 이용하여 자원당 4~6개체씩 재배하였다. 형질특성조사는 농업유전자원센터 수박 특성조사기준을 참고하여 12개의 특성을 평가하였다(Table 2).

Watermelon accessions used in this study.

Acc No. USDA ID Originz Acc No. USDA ID Origin Acc No. USDA ID Origin
K193405 PI 543209 BOL K193367 PI 536448 MDV K192442 PI 176921 TUR
K193406 PI 543210 BOL K193369 PI 536450 MDV K192452 PI 177326 TUR
K193407 PI 543211 BOL K193371 PI 536452 MDV K192459 PI 178872 TUR
K193408 PI 543212 BOL K193372 PI 536453 MDV K192464 PI 179233 TUR
K193041 PI 441722 BRA K193374 PI 536457 MDV K192465 PI 179234 TUR
K193034 PI 435991 CHN K193376 PI 536459 MDV K192466 PI 179235 TUR
K193045 PI 464872 CHN K193378 PI 536462 MDV K192472 PI 179243 TUR
K193233 PI 512332 CHN K193379 PI 536463 MDV K192499 PI 182177 TUR
K193333 PI 532809 CHN K193380 PI 536464 MDV K192500 PI 182178 TUR
K193334 PI 532810 CHN K193036 PI 438673 MEX K192800 PI 345544 UKR
K193337 PI 532814 CHN K192971 PI 379240 MKD K192801 PI 345545 UKR
K193340 PI 532818 CHN K192972 PI 379241 MKD K193199 PI 502315 UKR
K193404 PI 542617 DZA K192973 PI 379242 MKD K192028 PI 600896 Un
K193316 PI 525098 EGY K192975 PI 379246 MKD K192030 PI 600903 Un
K193239 PI 512345 ESP K192976 PI 379247 MKD K192049 PI 629109 Un
K193240 PI 512346 ESP K192977 PI 379248 MKD K192051 PI 632753 Un
K193268 PI 512378 ESP K192980 PI 379251 MKD K192117 PI 635728 Un
K193269 PI 512379 ESP K193151 PI 490382 MLI K193227 PI 508441 Un
K193270 PI 512381 ESP K193153 PI 494527 NGA K193228 PI 508443 Un
K193278 PI 512390 ESP K193154 PI 494528 NGA K193229 PI 508444 Un
K193280 PI 512392 ESP K193155 PI 494529 NGA K193231 PI 508446 Un
K193282 PI 512394 ESP K193157 PI 494532 NGA K193481 PI 595200 Un
K193297 PI 512833 ESP K192595 PI 234603 NZL K193482 PI 595201 Un
K193393 PI 537461 ESP K192560 PI 217939 PAK K193483 PI 595202 Un
K193396 PI 537468 ESP K193381 PI 537265 PAK K193485 PI 600790 Un
K193026 PI 415095 HND K193386 PI 537270 PAK K193488 PI 612145 Un
K193046 PI 470247 IDN K193388 PI 537273 PAK K193509 PI 629105 Un
K193047 PI 470248 IDN K192783 PI 307748 PHL K192788 PI 314655 UZB
K193048 PI 470249 IDN K192784 PI 307749 PHL K193143 PI 487458 VEN
K192127 PI 179881 IND K192785 PI 307750 PHL K193144 PI 487459 VEN
K192243 Grif 5598 IND K192793 PI 325248 RUS K192024 PI 295848 ZAF
K192245 Grif 5600 IND K193050 PI 476324 RUS K192204 PI 532659 ZAF
K192383 PI 173888 IND K193052 PI 476326 RUS K193186 PI 500338 ZMB
K192506 PI 182933 IND K193055 PI 476330 RUS K193187 PI 500340 ZMB
K192512 PI 183124 IND K193298 PI 518606 RUS K193193 PI 500347 ZMB
K192513 PI 183125 IND K193300 PI 518608 RUS K193194 PI 500348 ZMB
K192651 PI 271466 IND K193301 PI 518609 RUS K193195 PI 500349 ZMB
K192571 PI 222715 IRN K193302 PI 518610 RUS K193196 PI 500350 ZMB
K192573 PI 222776 IRN K193304 PI 518612 RUS K193197 PI 500352 ZMB
K192574 PI 222778 IRN K193400 PI 538888 RUS K192026 PI 482343 ZWE
K192608 PI 251515 IRN K192610 PI 253174 SRB K193081 PI 482281 ZWE
K192799 PI 344395 IRN K193355 PI 534591 SYR K193082 PI 482284 ZWE
K193032 PI 435282 IRQ K192282 PI 167125 TUR K193085 PI 482288 ZWE
K192581 PI 227203 JPN K192368 PI 172793 TUR K193088 PI 482291 ZWE
K192584 PI 227206 JPN K192376 PI 172801 TUR K193095 PI 482305 ZWE
K192766 PI 279456 JPN K192388 PI 174103 TUR K193097 PI 482310 ZWE
K192767 PI 279458 JPN K192391 PI 174106 TUR K193099 PI 482314 ZWE
K192768 PI 279459 JPN K192392 PI 174107 TUR K193113 PI 482346 ZWE
K192491 PI 181742 LBN K192396 PI 175650 TUR K193116 PI 482349 ZWE
K192612 PI 254430 LBN K192412 PI 176485 TUR K193141 PI 482380 ZWE
K192613 PI 254431 LBN K192435 PI 176913 TUR
K193366 PI 536446 MDV K192439 PI 176917 TUR

zBOL, Bolivia; BRA, Brazil; CHN, China; DZA, Algeria; EGY, Egypt; ESP, Spain; HND, Honduras; IDN, Indonesia; IND, India; IRN, Iran; IRQ, Iraq; JPN, Japan; LBN, Lebanon; MDV, Maldives; MEX, Mexico; MKD, Macedonia; MLI, Mali; NGA, Nigeria; NZL, New Zealand; PAK, Pakistan; PHL, Pilipine; RUS, Russia; SRB, Serbia; SYR, Syria; TUR, Turkey; UKR, Ukraina; Un, Unknown; UZB, Uzbekistan; VEN, Venezuela; ZAF, Republic of South Africa; ZMB, Zambia; ZWE, Zimbabwe.


Morphological traits of watermelon used in this study.

Characteristics Degree/ Note
Leaf Degree of lobing 3, week; 5, medium; 7, strong
Marbling 1, absent or weak; 2, medium; 3, strong
Ovary Pubescence 3, week; 5, medium; 7, strong
Flower Time of female flowering 3, early; 5, medium; 7, late
(50% of plants with at least one female flower)
Fruit Shape in longitudinal section 1, circular; 2, broad elliptic; 3, elliptic; 4, elongated elliptic
Ground color of skin 1, white; 2, yellow; 3, green
Intensity of ground color of skin 1, very light; 2, very light to light; 3, Light; 4, light to medium; 5, Medium; 6, medium to dark; 7, dark; 8, dark to very dark; 9, very dark
Degree of grooving 1, absent or weak; 2, at basal half; 3, at apical half; 4, on whole fruit
Stripes 0, absent or weak; 1, present
Main color of flesh 1, white; 2, yellow; 3, orange; 4, pink; 5, pinkish red; 6, red;
Shape of apical part 1, flat; 2, flat to rounded; 3, rounded; 4, rounded to conical; 5, conical
Seed Ground color of testa 1, white; 2, cream; 3, green; 4, red; 5, red-brown; 6, brown; 7, black


DNA 추출

재배된 수박 유전자원의 어린잎에서 Qiagen DNA extraction kit (Qiagen, Hilden, Germany)를 사용하여 genomic DNA를 추출하였으며 추출방법은 kit 내 사용방법을 따랐다. 추출된 DNA는 1.0% agarose gel에 전기영동으로 확인을 하였고 Spectrophotometry(Epoch, BioTek, Winooski, VT, USA)로 농도를 측정한 후 20 ng/ul의 농도로 희석하여 SSR 마커 분석에 이용하였다.

유전적 상태 분석을 위한 PCR 수행

수박 유전자원의 유전적 상태를 알아보기 위하여 SSR 마커의 유전자형을 분석하였다. SSR primer set는 Zhu et al. (2016)이 보고한 마커 중 PIC값을 기준으로 선발하였다(Table 3). PCR 용액은 20 ng genomic DNA, 0.2 mM dNTPs (each 10 mM), 10X buffer with MgCl2, 0.5 uM F/R primer, 1U Taq (Inclone, Korea), 멸균수를 포함하는 총량 25 ul로 만들었다. PCR 조건은 95℃에서 5분간 pre-denaturation, 95℃에서 30초간 denaturation, SSR primer 별 최적 온도에서 30초간 annealing, 72℃에서 30초간 extension의 과정을 각 SSR primer에 최적의 cycle로 반복을 한 후, 10분간 72℃에서 최종 extension을 수행하였다. PCR 증폭이 확인된 PCR 산물들에 대해서는 ABI prism 3500 DNA sequence (ABI3500, Thermo Fisher Scientific Inc., Wilmington, DE, USA)를 이용하여 정밀한 유전자형 분석을 수행하였다. 유전자형 분석은 Gene Mapper Software (Version 4.0, Thermo Fisher Scientific Inc.)를 이용하여 PCR 증폭산물의 크기를 측정하였다.

List of 20 SSR markers used in this study.

Marker Forward Reverse
BVWS00433 TCTTTTAAGTTTTGAGGGAGAGC TTCCCAAGCTAGCCTTTTCA
CLSSR30621 ACCGTCGTAGATTGAGACCG TGTACGGATGACCAAATGGA
CLSSR29449 TAAAGAGATACCCATGCCCG CAAACGCCCTCCAAAAATAA
BVWS00155 TGGATCATTTGACAGATTTAGCGA CATCACAGTTAACGATCACAAGGC
CLSSR28112 TTCGAACCAAAAACCAAACC GGATCCAGCGAAACAAAGAA
CLSSR31249 ATTCGTGCGCTTCAACTTTT ATGGTCATTTTGCTCCAAGG
CLSSR19435 CAAGCTCAACCCACGATTTT AGCCACAAACAAGAAGCACC
CLSSR16425 TGCTCCCTCACATTTTTGTTT TTGGTGGATCACATCGAAAA
CLSSR13608 TAGTAAGTGAAAGGGCGGGA TGGGATGAAATCCGAAACAT
BVWS00209 TGCTTCAAAATCTATTCACAATTTGC TTCTTGGTTTCGGGTTTCTTTACA
CLSSR18153 TAGCAAGCGGCACCTTATTT TGATTCCTTCCCTCCTAACCT
CLSSR08123 AAAGTGGGAGGCAAAAATCA TGTTGGTCTCTCCCATGAAA
BVWS01897 TTCTTGAAACTCAACCCTCAAA AAAGCGTGTCGAGTGTGAGA
CLSSR09643 TTGTTTGACGAGATTCACGC GGACCGGAAAGATGAGACAG
CLSSR14501 TAAAACGCATGTTGGCTCTG TGTGGGGTTTTTATTTGGGA
CLSSR08243 CCACTCTTCACTCTCACACACA TTTTCCCTCTTCCTTCTCTTGA
CLSSR03020 CGACGAATCAATTTGAGCCT GGGACAAAAATAAATAATGGCTACG
BVWS00948 TCAAACCGACTGCCATATCA AGCTTGTCTTCCTGGCCTTT
CLSSR26852 TGAACAAGTACACTCGTGAAAATC CCACACTAAAATCAGAATCCAATG
BVWI00170 AACGCACGATAGTTAGAAGG TGACTAATTAAACTACACTCAGACT


통계분석

수박 유전자원의 다양성을 비교 분석하기 위하여 각 자원 당 4~6개체의 형태적 특성을 조사하고 그들의 분포는 Microsoft Excel을 이용하여 표현하였다. Discriminant analysis of principal components (DAPC) 분석은 R software의 adegenet 패키지를 이용하여 분석하였다(Ivandic et al. 2002, Jombart 2008).

결과 및 고찰

수박 유전자원 분포

USDA에서 도입한 수박 154자원은 대륙별로 아시아 원산 자원이 45.5% (70자원)로 가장 많았으며 그 뒤로 유럽 20.8% (32자원), 아프리카 10.4% (16자원) 순이며 15개의 자원(9.7%)은 원산지 미상이었다(Table 1). 국가별로는 터키에서 수집한 자원이 12.3% (19자원)로 가장 많았으며 스페인 11자원, 잠바브웨 11자원, 몰디브 10자원, 러시아 10자원 순이었다. USDA 정보를 토대로 자원을 구분해 보면 육성품종 23자원, 육성계통 10자원, 재래종 8자원이었으며, 113자원은 정보가 존재하지 않았다. 현재 USDA에 수집 보관 중인 수박(Citrullus lanatus)은 1,231자원이며 이 중 약 22.8% (281자원)가 터키에서 수집된 자원이며 마케도니아 10.2% (126자원), 인도 8.7% (107자원) 순으로 자원을 수집⋅보존하고 있다(USDA 2019). FAO (2017)의 통계에 따르면 터키는 전세계에서 수박 생산량이 4위(4,011,313톤), 재배면적은 6위(95,514ha) 수준으로 중국의 생산(79,486,961톤)과 재배면적(1,859,683ha)의 5%정도에 불과하다. 그러나 터키는 유럽, 아시아, 지중해에 걸쳐 위치한 국가로 무역의 중심지이며 다양한 기후대가 존재하고 이로 인해 수박 유전자원의 유전적 다양성이 높고 중요하다고 보고되어 있다(Sari et al. 2007).

수박 유전자원 형태적 특성

수박 유전자원의 형태적 특성은 생육특성과 과실특성을 조사하였다(Supplementary Table 1). 생육특성 중 엽절의 정도는 미조사 4자원을 제외한 150자원 중에서 약 90% (135자원)가 중간 정도의 엽절을 보였으며 엽절이 강한 자원은 8자원, 약한 자원은 7자원이었다(Fig. 1A). 잎의 대리석 무늬는 미조사 4자원을 제외하고 99% (149자원)가 무늬가 없거나 약한 것으로 조사되었으며 K192204만 강한 대리석 무늬를 보였다(Fig. 1B). 암꽃의 개화기(삼복꿀 기준, 중간 5)는 144자원이 중간 정도로 조사되었으며 3자원(K193047, K193155, K193483)이 이른 시기에 암꽃이 개화하였으며 8자원이 늦은 암꽃개화기를 보였다(Fig. 1C). 씨방의 솜털은 미조사 5자원을 제외하고는 털이 적음 32% (48자원), 중간 61% (90자원), 많음 7% (11자원)의 분포를 보였다(Fig. 1D). 수박의 엽절은 하엽까지의 태양광 투과 정도에 관여하여 광합성 효율에 영향을 주며 엽절이 깊을수록 가뭄 저항성이 높다고 보고되어 있다(Wei et al. 2017). 암꽃개화기는 영양생장에서 생식생장으로 넘어가는 과정으로 상업적 작물에 있어 더 짧은 시기에 작물을 생산할 수 있는 중요한 형질이다(McGregor et al. 2014). 또한 씨방의 솜털 유무는 곤충을 유혹하여 수정, 교배 성공률을 높이고 화기와 씨방에 피해를 주는 해충과 병원균으로부터 식물체를 보호하는 중요한 형질로 알려져 있다(Ciccarelli et al. 2007). 본 연구에서 조사한 USDA 도입 154자원 중에도 엽절이 깊은 8자원, 암꽃 개화가 빠른 3자원이 확인되었다. 특히 엽절이 깊고 개화가 빠른 자원(K193047)이 확인되었는데 이 자원은 수박 품종 개발에 활용성이 높을 것이다.

Fig. 1.

Distribution of growth habits in 154 watermelon accessions.



과실 특성 중 과실의 세로 모양은 원형이 125자원(81%), 넓은 타원형이 23자원(15%)이었으며 형태가 섞여 있는 6자원도 확인되었다(Fig. 2A). 과피의 바탕색은 녹색이 대부분이었으며(152자원, 99%), K193233은 흰색, K193239는 노란색을 보였다(Fig. 2B). 과피 바탕색의 강도는 짙음이 27% (42자원), 매우 옅음에서 옅음 사이가 26% (40자원), 중간 25% (38자원), 매우 짙음 12% (9자원) 순이었으며 K192452만 매우 옅은 과피 바탕색 강도로 조사되었다(Fig. 2C). 과실 줄무늬는 78자원(51%)이 없거나 약했으며 62자원(40%)이 있음으로 조사되었으며 14자원(9%)이 형질이 섞여서 나타난 것으로 조사되었다(Fig. 2D). 과실골의 분포는 92% (142자원)가 없거나 약한 특징을 보였으며 과실자루에서 1/2부위까지 있는 2자원, 꽃자리에서 1/2부위에 있는 4자원, 형질이 섞여 나온 6자원이 조사되었으며(Fig. 2E) 꽃자루 부위 모양은 둥근 형 138자원(90%), 약간 뾰족한 형 10자원(6%), 뾰족한 형 6자원(4%)으로 조사되었다(Fig. 2F).

Fig. 2.

Distribution of fruit skin characters in 154 watermelon accessions.



주요 과육의 색은 적색 28.6% (44자원), 적분홍 22.7% (35자원), 분홍 16.2% (25자원), 노랑 14.9% (23자원), 흰색 6.5% (10자원), 주황색 5.8% (9자원) 순으로 조사되었으며 8자원은 섞여 있는 것으로 확인되었다(Fig. 3A). 종자색은 44.2% (68자원)가 검정색이었으며 29자원(18.8%)이 갈색, 26자원(16.9%)이 크림색, 17자원(11.0%)이 적갈색, 6자원(3.9%)이 적색, 5자원(3.2%)이 흰색, 3자원(1.9%)이 녹색으로 조사되었다(Fig. 3B).

Fig. 3.

Distribution of fruit pulp characters in 154 watermelon accessions.



일반적으로 널리 알려진 수박은 줄무늬가 있고 붉은 과육 색을 띠며 검은색 또는 갈색 종자를 지니고 있는 형태이다(Cho et al. 2014). 최근 소비자의 수박 구매 경험에 대한 조사 결과를 보면 일반수박 외에도 과실크기가 작은 복수박, 과실이 노란 수박 등 다양한 형태의 수박을 접하고 구매를 하는 추세이다(KREI 2018). 수박 과육 색은 흰색, 노란색, 적색, 녹색 등 다양하며 이들은 각 색깔 별로 다양한 carotenoids 함량을 가진다고 보고되어 있다(Zhao et al. 2013). 본 연구에서 조사한 특성을 기반으로 USDA에서 도입한 수박 유전자원의 기능성 물질 등을 추가적으로 분석한다면 생산자 및 소비자의 기호를 충족시킬 수 있는 품종을 개발하는데 유용한 소재로 활용이 가능할 것이다.

형태적 특성을 활용한 군집 분석

USDA에서 도입한 수박 154자원의 군집분석을 위하여 DAPC를 수행한 결과 10개의 주성분(Principal Component)과 7개의 판별함수(Discriminant function, DF)가 최적이었으며 약 68.1% 정도의 분산이 보존되었고 이를 토대로 수박 자원은 8개의 그룹으로 나뉘어졌다(Fig. 4). 각각의 그룹은 X축(the first axis)을 기준으로 1,3,5,8그룹(D1-1)과 2,4,6,7 (D1-2)그룹으로 나뉘며 두 그룹은 과실 줄무늬가 없는 그룹(D1-1)과 있는 그룹(D1-2)으로 나뉜다. Y축(the second axis)을 기준으로도 1,2,3,4,6,8그룹(D2-1)과 5,7그룹(D2-2) 둘로 나뉘며 이들은 과실의 세로모양에 따라 구분이 되고 있으며 D2-1은 대체로 원형을 보였으며 D2-2는 넓은 타원형을 보였다. 많은 연구자들이 주성분분석(Principal Component Analysis), 요인분석(Factor Analysis), 주좌표분석(Principal Coordinate Analysis)등 다양한 다변량분석법을 활용하여 작물의 형태적 특성을 분석하였으며 특히 주성분분석을 주로 이용하였다(Solmaz & Sari 2009, Grahić et al. 2013, Huh et al. 2014, Gbotto et al. 2016, Soltani et al. 2016). 한편 Grahić et al. (2013)과 Nicoletti et al. (2014)은 DAPC 분석을 이용하여 초롱꽃속(Campanula) 식물과 강낭콩(Phaseolus vulgaris)의 형태적 특성을 분석하였으며 DAPC분석법은 자원을 구분하는데 효율적이라고 보고하였다. DAPC 분석은 지역, 배수성, 분류적 특성 등과 관련되어 분석 집단을 구분하는 데 효과적이다(Deperi et al. 2018). 본 실험에서는 수집지역과 관계없이 수박의 형태적 특징으로 8개의 그룹으로 나누어졌으며 특히 과실의 세로모양과 줄무늬 유무로 자원이 구분되는 것을 확인하였다.

Fig. 4.

Discriminant analysis of principal components (DAPC) for 154 watermelon accessions. The axes represent the first two Linear Discriminants (LD). Each circle represents a cluster and each dot represents an individual. Numbers represent the different subpopulations identified by DAPC analysis.



유전적 상태 구분

USDA에서 도입한 수박 154자원의 유전적 상태는 Table 4와 같이 네 가지 형태로 구분을 하였다. 분석에 사용한 20개의 SSR 마커의 증폭 산물이 동일한 패턴을 보이는 경우는 근교계(Inbred) 또는 F1, 다른 패턴을 보일 경우에는 F2 이후의 분리 세대 또는 종자 혼립의 4가지 형태로 자원을 구분하였다. 154자원 중 12자원이 동일한 마커 패턴을 보였으며 142자원이 다른 패턴을 보였다. 동일한 패턴을 보인 12자원 중에서 K192117, K192028, K193400, K192376, K192499, K192800은 20개의 SSR 마커에서 모두 동형접합형 대립유전자(homozygote allele)를 보여 근교계(Inbred)로 예측할 수 있다. 반면 K192512, K193316, K193026, K192368, K193381, K193052의 경우 1~3개의 마커에서 모두 이형접합형 대립유전자(heterozygote allele)를 보였으므로 이들은 F1일 것이라 예측하였다. 마커 패턴이 다른 142자원 중 39자원은 마커당 두 개 이하의 크기(size) 및 대립유전자(allele)를 보였으나 그 패턴이 다양하였고 이를 근거로 F2세대 이후 분리 세대로 예측하였으며 103자원은 하나의 마커에 3개 이상의 크기(size) 또는 대립유전자(allele)가 확인되어 혼립으로 예상하였다. 작물 육종에 있어 육종재료로 이용될 유전자원을 수집, 보존하는 것이 중요하며 이러한 자원들의 유전적 기초(genetic basis)를 확인하는 것 또한 중요하다(Pasam et al. 2012, Jang et al. 2013). 특히 타식성 작물의 경우 육종 소재로 활용을 위한 우수 자원 선발 및 선발된 자원의 유전적 고정이 필요하며 이를 위하여 유전적 다양성 분석, 계통유연관계 분석 및 집단구조 분석 등을 통한 유용 정보 확보가 중요하다(Jang et al. 2013).

###TALBE_4###

본 연구에서는 비록 USDA에서 도입한 자원들의 유전적 다양성 분석 등을 수행하지는 않았지만 SSR 마커를 활용하여 유전적 상태를 예측하였다. 이를 토대로 도입한 154자원 중 근교계(Inbred)로 예측되는 6자원을 확인할 수 있었으며 이 자원들은 수박 육종 프로그램에 직접 활용할 경우 자식 계통 육성 및 발굴을 위한 과정없이 육종 연한을 단축할 수 있을 것이다. 유전자원의 수집과 보존은 유전적 다양성 부족으로 인한 위험성으로부터 벗어나기 위해 중요하며 이러한 유전자원의 효율적 관리와 활용을 위해서는 원산지, 형태적 특성 및 유전적 다양성 분석 등의 다양한 정보가 필요하다(Kim et al. 2017). 본 연구에서는 USDA에서 도입한 수박 154자원의 형태적 특성을 조사하고 SSR 마커를 이용하여 그들의 유전적 상태를 구분하였다. 형태적으로는 균일한 자원들도 SSR 마커 분석 결과에서는 분리가 되거나 섞여 있을 것이라 예상되는 자원들이 나타났고, 육종 프로그램에 직접 활용할 수 있는 근교계(Inbred)로 예측되는 자원들도 확인되었다. 본 실험에서 확인한 형태적 특성과 유전적 상태 정보를 바탕으로 USDA에서 도입한 수박 자원들에 대한 농업형질, 성분분석, 유전적 다양성에 대한 연구를 추가적으로 수행하여 국내 수박 육종 프로그램에 활용 가능한 자원들에 대한 평가 및 선발이 필요할 것이다.

적 요

본 연구는 미국 USDA에서 도입한 수박 154자원에 대하여 12개의 형질들을 이용하여 형태적 특성을 조사하였으며 20개의 SSR 마커를 이용하여 그들의 유전적 상태를 구분하였다. USDA에서 도입한 수박 자원 중 유럽에서 수집한 자원이 32자원으로 가장 많았으며 그 중 19자원이 터키에서 수집한 자원이었다. 수박 자원들의 형태적 특성은 다양하였으며 DAPC 분석을 통하여 154자원을 8개 그룹으로 나눌 수 있었고 그들은 과실 줄무늬의 유무, 과실의 세로모양에 따라 구분할 수 있었다. SSR 마커를 이용한 유전적 상태 구분 결과 수박 154자원 중 142자원은 분리세대 또는 종자 혼립으로 예측되었고 6자원(K192512, K193316, K193026, K192368, K193381, K193052)은 F1으로 예측되었다. 그 외 6자원(K192117, K192028, K193400, K192376, K192499, K192800)은 20 SSR 마커에서 모두 동형접합형 대립유전자(homozygote allele)를 보였으며 이를 토대로 근교계(Inbred) 자원으로 예측할 수 있었다. 본 실험의 결과는 미국 USDA 도입 154자원의 활용을 위한 기초 정보를 제공하며 추가적으로 농업형질, 성분분석, 유전적 다양성에 대한 평가와 연구가 수행된다면 국내 수박 육종 프로그램에 활용 가능한 자원들의 선발이 가능할 것이다.

사 사

본 연구는 농촌진흥청 농업과학기반기술개발사업(과제번호: PJ01258001)의 지원에 의해 이루어졌음.

보충자료

본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

References
  1. Cho SM, Oh SA, Choi YS, Park SB. 2014. Effect of plant growth regulator on regeneration from the cotyledon explants in watermelon (Citrullus lanatus (thunb.) Matsum. & Nakai). Kor J Plant Res 27: 51-59.
    CrossRef
  2. Chowdhury MA, Vandenberg B, Warkentin T. 2002. Cultivar identification and genetic relationship among selected breeding lines and cultivars in chickpea (Cicer arietinum L.). Euphytica 127: 317-325.
    CrossRef
  3. Ciccarelli D, Garbari F., Pagni A.M. 2007. Glandular hairs of the ovary: a helpful character for Asteroideae (Asteraceae) taxonomy? Ann Bot Fennici 44: 1-7.
  4. Deperi SI, Tagliotti ME, Bedogni MC, Manrique-Carpintero NC, Coombs J, Zhang R, Douches D, Huarte MA. 2018. Discriminant analysis of principal components and pedigree assessment of genetic diversity and population structure in a tetraploid potato panel using SNPs. PLOS ONE 13: e0194398.
    Pubmed CrossRef
  5. FAO. 2017. http://www.fao.org.
  6. Gbotto AA, Koffi KK, Bi NDF, Bi STD, Tro HH, Baudoin J-P, Bi IAZ. 2016. Morphological diversity in oleaginous watermelon (Citrullus mucosospermus) from the Nangui Abrogoua University germplasm collection. Afr J Biotechnol 15: 917-929.
    CrossRef
  7. Grahić J, Gaši F, Kurtović M, Karić L, Đikić M, Gedžo D. 2013. Morphological evaluation of common bean diversity in Bosnia and Herzegovina using the discriminant analysis of principal components (DAPC) multivariate method. Genetika 45: 963-977.
    CrossRef
  8. Huh YC, Choi H, Solmaz I, Sari N, Kim S. 2014. Morphological characterization of Korean and Turkish watermelon germplasm. CNU J Agric Sci 41: 309-314.
    CrossRef
  9. Ivandic V, Hackett CA, Nevo E, Keith R, Thomas WTB, Forster BP. 2002. Analysis of simple sequence repeats (SSRs) in wild barley from the fertile crescent: associations with ecology, geography and flowering time. Plant Mol Biol 48: 511-527.
    Pubmed CrossRef
  10. Jombart T. 2008. adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics 24: 1403-1405.
    Pubmed CrossRef
  11. Jang J-S, Chang E-H, Sa KJ, Kim BW, Kim J-H, Lee JK. 2013. Analysis of population structure and association mapping among popcorn inbred lines using SSR markers. Kor J Breed Sci 45: 358-368.
    CrossRef
  12. Khalid M, Farahatullah, Khan NU, Din A, Khan MY, Akmal M, Ali N. 2010. Linkage of morphological markers in brassica. Pak J Bot 42: 2995-3000.
  13. Kim OG, Sa KJ, Lee JR, Lee JK. 2017. Genetic analysis of maize germplasm in the Korean Genebank and association with agronomic traits and simple sequence repeat markers. Genes Genom 39: 843-853.
    CrossRef
  14. Kim Y-S, Ko C-S, Yang H-B, Kang S-C. 2016. Genome-wide analysis of sequence variations in eight inbred watermelon lines. J Plant Biotechnol 43: 164-173.
    CrossRef
  15. KREI. 2018. Agricultural Outlook 2018 Korea.
  16. Kwon S-J, Ha W-G, Hwang H-G, Yang S-J, Choi H-C, Moon H-P, Ahn S-N. 2002. Relationship between heterosis and genetic divergence in ‘Tongil’-type rice. Plant Breed 121: 487-492.
    CrossRef
  17. Kwon Y-S, Hong J-H, Kim D-H, Kim D-H. 2015. Use of microsatellite markers derived from genomic and expressed sequence tag (EST) data to identify commercial watermelo cultivars. Kor J Hort Sci Technol 33: 737-750.
    CrossRef
  18. Lee ES, Kin J, Hong JP, Kim D-S, Kim M, Huh Y-C, Back C-G, Lee J, Lee H-E. 2018. Development of HRM markers based on SNPs identified from next generation resequencing of susceptible and resistant parents to gummy stem blight in watermelon. Kor J Breed Sci 50: 424-433.
    CrossRef
  19. Lee W-M, Kwon MJ, Song L-S, Kim S, Lee HJ, Yang E-Y, Choi H-S, Huh Y-C, Park DK, Yoon Mk. 2014. Screening of lycopene-rich germplasms using microplate method in watermelon (Citrullus Lanatus (thunb.) Matsum. & Nakai). Kor J Breed Sci 46: 037-043.
    CrossRef
  20. Levi A, Jarret R., Kousik S, Patrick Wechter W, Nimmakayala P, Reddy UK. 2017. Genetic resources of watermelon. In: Grumet R., Katzir N., Garcia-Mas J. (Eds) Genetics and genomics of cucurbitaceae. Plant Genetics and Genomics: Crops and Models, vol 20. Springer, Cham.
    CrossRef
  21. Malek MA, Rafii MY, Afroz MSS, Nath UK, Mondal MMA. 2014. Morphological characterization and assessment of genetic variability, character association, and divergence in soybean mutants. The ScientificWorld J Article ID 968796.
    Pubmed CrossRef
  22. Mazid MS, Rafii MY, Hanafi MM, Rahim HA, Shabanimofrad M, Latif MA. 2013. Agro-morphological characterization and assessment of variability, heritability, genetic advance and divergence in bacterial blight resistant rice genotypes. South Afr J Bot 86: 15-22.
    CrossRef
  23. McGregor CE, Waters V, Vashisth T, Abdel-Haleem H. 2014. Flowering time in watermelon is associated with a major quantitative trait locus on chromosome 3. J Am Soc Hort Sci 139: 48-53.
  24. Nicoletti F, Barberis G, De Benedetti L, De Maria G, Casazza G, Minuto L. 2014. Species distinction within Campanula sect. Heterophylla in the SW Alps: Molecular, morphological and chemotaxonomic evidences. Plant Biosys 148: 1138-1147.
    CrossRef
  25. Park Y, Cho S. 2012. Watermelon production and breeding in South Korea. Isr J Plant Sci 60: 415-423.
  26. Pasam RK, Sharma R, Malosetti M, van Eeuwijk FA, Haseneyer G, Kilian B, Graner A. 2012. Genome-wide association studies for agronomical traits in a world wide spring barley collection. BMC Plant Biol 12: 16.
    Pubmed CrossRef
  27. Ramanatha Rao V, Hodgkin T. 2002. Genetic diversity and conservation and utilization of plant genetic resources. Plant Cell Tissue Organ Cult 68: 1-19.
    CrossRef
  28. Sari N, Solmaz I, Yetisir H, Unlu. 2007. Watermelon genetic resources in Turkey and their characteristics. Acta Hortic 731: 433-438.
  29. Solmaz I, Sari N. 2009. Characterization of watermelon (Citrullus lanatus) accessions collected from Turkey for morphological traits. Genet Res Crop Evol 56: 173-188.
    CrossRef
  30. Soltani F, Ebadi M, Mostoufi Y, Azizzadeh SM. Evaluation of phenotypic variation of Iranian watermelon (Citrullus sp.) accessions by morphological markers. In, 2016. International Society for Horticultural Science (ISHS), Leuven, Belgium, pp. 129-132.
  31. Wei C, Chen X, Wang Z, Liu Q, Li H, Zhang Y, Ma J, Yang J, Zhang X. 2017. Genetic mapping of the LOBED LEAF 1 (ClLL1) gene to a 127.6-kb region in watermelon (Citrullus lanatus L.). PLOS ONE 12: e0180741.
    Pubmed CrossRef
  32. Zhao We, Lv P, Gu H. 2013. Studies on carotenoids in watermelon flesh. Agri Sci 4: 13-20.
    CrossRef
  33. Zhu H, Song P, Koo D-H, Guo L, Li Y, Sun S, Weng Y, Yang L. 2016. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis. BMC Genomics. 17: 557.
    Pubmed CrossRef


December 2019, 51 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information