search for




 

Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples
사과 저장성 연관 Md-ACS1, Md-ACO1, Md-PG1 분자표지의 활용성 평가
Korean J. Breed. Sci. 2020;52(4):322-331
Published online December 1, 2020
© 2020 Korean Society of Breeding Science.

Young Soon Kwon, Soon-Il Kwon*, Jeong-Hee Kim, Moo Yong Park, Jong Taek Park, and Seon Ae Kim
권영순⋅권순일*⋅김정희⋅박무용⋅박종택⋅김선애

Apple Research Institute, National Institute of Horticultural and Herbal Science, RDA, Gunwi 39000, Republic of Korea
국립원예특작과학원 사과연구소
Correspondence to: (E-mail: topapple@korea.kr, Tel: +82-54-380-3130, Fax: +82-54-380-3109)
Received August 6, 2020; Revised August 14, 2020; Accepted October 4, 2020.
Abstract
The purpose of this study was to examine the potential utility of marker-assisted selection (MAS) based on storability-associated molecular markers in apple breeding and to provide genotype information for the markers Md-ACS1, Md-ACO1, and Md-PG1 in apple genetic resources as basic data for the use of breeding materials. We analyzed 750 apple genetic resources to assess the allelic composition of Md-ACS1 and Md-ACO1, which play roles in the ethylene biosynthesis pathway, and Md-PG1, which is involved in cell wall degradation. For 108 of the genetic resources used for genotyping, we measured fruit firmness using a texture analyzer (10 mm plunger) at harvest and after 20 days of room temperature (20~25℃) storage. Md-ACS1 and Md-PG1 were found to be associated with changes in fruit firmness (the difference between firmness at harvest and after storage), with ACS1-2/2, PG1-1/1, and PG1-2/2 showing the lowest changes in fruit firmness. In addition, we found that changes in fruit firmness were smallest in late-harvest species, even for the same genotype. In contrast, Md-ACO1 appeared to be unrelated to the storability of fruit. Of the 750 apple genetic resources screened, the genotypes ACS1-2/2, and PG1-1/1 or PG1-2/2 were detected in 3.6% of accessions, including ‘Fuji’, bud mutation cultivars of ‘Fuji’, ‘Chubu’, and ‘Iwakami’. The Md-ACS1 and Md-PG1 markers could have potential utility in assessments of storability and applied in MAS to improve the efficiency of apple breeding.
Keywords : Apple, Ethylene, Firmness, Marker Assisted Selection
서 언

사과(Malus domestica Borkh.)는 전 세계적으로 가장 중요한 과수류 중 하나이며(Hummer & Janick 2009), 10,000 품종 이상 존재하는 것으로 알려져 있지만 상업적으로 재배되는 품종은 소수에 불과하다(Janick et al. 1996). 국내 사과 재배면적은 2019년 기준 32,954 ha이며, 품종별 점유율은 Fuji (67.9%), Hongro (16.5%), Tsugaru (4.3%) 순으로(KREI 2020), 특정 품종이 편중 재배되고 있다. 일본에서 1962년 최종 선발 된 만생종 Fuji는 과육이 아삭하며 당도가 높고 저장성이 좋아 생산자, 소비자, 유통업자 모두가 선호하는 품종이다(Seojima et al. 1998). 외국 품종인 Fuji의 편중 재배를 해소하고 재배 품종의 다양화를 위하여 저장성이 매우 우수한 고품질의 사과 품종 개발이 요구되고 있다. 사과 유전자원은 품종개량에 있어서 유전적 다양성의 증가와 목표 형질의 개발을 가능하게 하므로 매우 중요한 자원이 된다(Potts et al. 2012). 국내 사과 유전자원은 농촌진흥청 사과연구소에서 품종, 야생 수집종, 대목 등 Malus 속 1,400여점을 수집, 보존 하고 있으며 정밀한 특성 검정 및 분류를 통해 활용성을 증대하고 있다(Kim et al. 2019).

사과는 성숙이 진행됨에 따라 에틸렌에 의해 호흡량이 현저하게 증가하는 호흡급등형 과실이다. 에틸렌은 과실의 호흡량 증가, 조직 연화 등 성숙과 노화를 촉진하여 저장이나 유통 중 상품성을 떨어뜨리는 원인이 된다(Yang et al. 2013). 사과의 에틸렌 생합성 과정에 관여하는 유전자 중 가장 잘 알려진 1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE 1 (Md-ACS1)와 AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1 (Md-ACO1)는 PCR 분석을 통하여 대립유전자형을 구분할 수 있으며 대립유전자형에 따라 에틸렌 발생량의 차이를 보인다(Sunako et al. 1999, Harada et al. 2000, Oraguzie et al. 2004, Zhu and Barritt 2008). Md-ACS1의 경우 ACS1-2/2 (655 bp)가 가장 적고 ACS1-1/2는 중간 정도이며 ACS1-1/1 (489 bp)는 가장 많이 발생하며, Md-ACO1의 경우 ACO1-1/1 (525 bp)가 가장 적고 ACO1-1/2는 중간 정도이며 ACO1-2/2 (587 bp)는 가장 많이 발생하는 것으로 알려져 있다(Wakasa et al. 2006). Md-ACS1Md-ACO1는 에틸렌 생합성 과정 상에서 각각 독립적으로 작용하며, Md-ACO1에 비해 Md-ACS1가 과실의 에틸렌 발생에 미치는 영향이 더 큰 것으로 보고 되었다(Costa et al. 2005). 사과의 저장 중 상품성 유지와 연관 된 과육 연화는 에틸렌 발생에 의한 세포벽분해효소의 활성과 조절에 관련이 있으며, POLYGALACTURONASE 1 (Md-PG1) 유전자는 성숙하는 동안 에틸렌의 직접적인 영향에 의해 펙틴을 분해하여 조직을 연화하고 경도를 감소시키는 것으로 알려져 있다(Mann et al. 2008). Longhi et al. (2013)이 보고한 Md-PG1 SSR marker에 따른 대립유전자형과 과실 경도는 PG1-1/1 (288 bp)와 PG1-2/2 (291 bp)의 경우 경도가 가장 높았고, PG1-3/3 (298 bp)은 가장 낮았으며 PG-1/3PG-2/3인 경우 중간 정도라고 하였다. 저장성이 좋고 과육이 아삭한 Fuji는 ACS1-2/2, ACO1-1/1, PG1-1/1인 것으로 확인되었다(Kwon et al. 2017, Longhi et al. 2013). ACS1-1/1, ACO1-2/2, PG1-3/3는 높은 에틸렌 발생량 및 낮은 과육 경도와 관련이 있고, ACS1-2/2, ACO1-1/1, PG1-1/1, PG1-2/2는 낮은 에틸렌 발생량 및 높은 과육 경도와 관련 있다(Nybom et al. 2013, Costa et al. 2014). 사과와 같이 자가 불화합성이며 유전적 조성이 매우 복잡하고 긴 유년성을 가진 작물은 분자표지를 사용하여 유용형질을 조기에 선발하는 것이 특히 효과적일 것이다. 또한 과수육종에서 분자표지의 개발은 교배 실생의 유지비용을 절감할 수 있는 핵심 기술이다(Hur et al. 2014).

국내외에서 사과의 육종 효율 향상을 위하여 저장성, 병저항성, 품질과 연관 된 QTL (Quantitative trait loci) 분석과 GWAS (Genome Wide Association Study) 연구를 진행 중에 있으며(Khan et al. 2006, Costa et al. 2014, McClure et al. 2018), 국외에서는 실제 사과 육종 과정 중 교배실생 단계에서 저장성, 화상병 분자표지를 활용하여 목표 형질을 조기 선발 하고 있다(Zhu et al. 2009, Kellerhals et al. 2017). 그러나 국내 사과 육종과정에서는 저장성 등 주요한 형질과 관련 된 다양한 분자표지를 MAS에 적용하고 있지 못한 실정이다. 에틸렌 발생 및 과육의 경도와 관련 된 사과의 저장성은 수확 시기, 수확 후 저장 방법 및 여러가지 환경요인에 따라 달라지지만 본래의 유전적 요인이 가장 큰 영향을 미친다(Johnson et al. 2002). 따라서 본 연구는 사과 유전자원의 Md-ACS1, Md-ACO1, Md-PG1 대립유전자형과 수확일 및 저장 후 과실 경도를 조사하여 Md-ACS1, Md-ACO1, Md-PG1 분자표지를 이용한 사과의 저장성 예측 및 국내 저장성 강한 사과 품종 개발의 효율 향상을 위한 MAS 적용 가능성을 검증하고자 하였다. 또한 사과 유전자원들의 육종 소재 활용을 위한 Md-ACS1, Md-ACO1, Md-PG1 유전자형에 대한 자료를 제공하고자 한다.

재료 및 방법

실험 재료 및 DNA 추출

2019년 경상북도 군위군에 위치한 농촌진흥청 사과연구소의 유전자원 보존포에 재식 된 Hongro 등 750점을 Md-ACS1, Md-ACO1, Md-PG1 유전자형 분석을 위한 실험재료로 사용하였고 그 중 108점에 대하여 수확일과 저장 후 과실의 경도 분석을 실시하였다. 실험에 사용 된 모든 사과나무는 M.26 이중대목에 접목하여 세장방추형 표준재배법에 의해 관리되었다. genomic DNA는 신초를 채취하여 TissueLyser Ⅱ (Qiagen Co., 독일)를 이용해 마쇄한 후 DNeasy plant mini kit (Qiagen, 미국)를 사용하여 제조사의 프로토콜에 따라 추출하였다. 추출한 DNA는 0.8% agarose gel에 전기영동하여 순도를 확인하고 분광광도계(BioTek, 미국)로 정량분석 하였다. PCR 분석에 이용하기 위하여 DNA를 20 ng⋅μL-1의 농도로 희석하였다.

Md-ACS1, Md-ACO1, Md-PG1 primer를 이용한 PCR 분석

Md-ACS1, Md-ACO1, Md-PG1 유전자형 분석을 위하여 Sunako et al. (1999), Costa et al. (2005), Longhi et al. (2013)이 보고한 primer를 실험에 사용하였다(Table 1). PCR 반응은 250 μM dNTP, 1 x PCR reaction buffer, 2.5 unit의 i-StarTaq DNA polymerase가 포함 된 Maxime PCR Premix kit (iNtRON Biotechnology, 한국)를 이용하여 gDNA 20 ng, primer 10 μM, distilled water 17 μL를 첨가하여 총 20 μL 반응액으로 수행하였다. PCR은 C1000 thermocycler (Bio-Rad, 미국)를 사용하여 95℃에서 1분간 초기 변성 후 95℃에서 15초, primer에 따라 각각 ACS1은 58℃, ACO1은 65℃, PG1은 56℃에서 15초, 72℃에서 1분으로 35회 반복하고 72℃에서 10분간 처리 후 반응을 종료하였다. PCR 산물은 DNA fragment analyzer (Advanced Analytical Technologies Inc., 미국)을 사용하여 자동전기영동 하였고 PRO Size 2.0 software (Advanced Analytical Technologies Inc., 미국)로 유전자형을 확인하였다.

Primer sequences used for amplifying Md-ACS1, Md-ACO1, and Md-PG1 genes.

Primers Sequence (5'→3') Amplicon size (bp) Annealing Temp. (℃) Reference
Md-ACS1 ACS1-F ACS1-R CTCCTCCTTTCCTTCGTTGA ACCATGTCGTCGTTGGAGTAG 2 : 655, 1 : 489 58 Sunako et al. (1999)
Md-ACO1 ACO1-F ACO1-R ATCAATGATGCTTGTGAGAACTG GGTCTTCTTGTAGTGATCCTTGG 2 : 587, 1 : 525 65 Costa et al. (2005)
Md-PG1SSR10kd PG1-F PG1-R TTTCTTCCTTGGGTTTTTGG ACTCGTGCGCCAGATAGC 3 : 298, 2 : 291, 1 : 288 56 Longhi et al. (2013)


경도 조사 및 통계 분석

과실의 경도는 수확일 및 상온(20~25℃) 저장 20일 후 각각 조사하였다. 수확은 과실의 중앙 적도면을 칼로 잘라 2등분 한 후 자른면에 요오드용액을 스프레이 하여 전분지수(전분소실율 30% 미만: 1, 30~50%: 2, 50~70%: 3, 70~90%: 4, 90%이상: 5)가 4~5일 때로 하였다. 경도는 10 ㎜ plunger를 장착한 Texture analyzer (Zwick Roel, 독일)를 이용하여 과실 당 적도면 3부분을 측정하였고, 과실 3개를 1반복으로 총 3반복 조사하여 평균값을 사용하였다. 과실의 경도 측정 부분은 과피만 얇게 벗겨내고, 측정부 반대편을 평평하게 잘라 표면에 닿는 면적을 넓고 고르게 하였다. 저장기간 중 경도 변화는 수확일에서 저장 후 과실의 경도 값의 차이로 나타내었다. 통계분석은 Statistic Analysis System (SAS v 9.4 Institute Inc., 미국)을 이용하여 p<0.05 수준에서 Duncan’s multiple range test를 실시하여 유의성을 검증하였다.

결과 및 고찰

사과 유전자원의 Md-ACS1, Md-ACO1, Md-PG1 유전자형

사과 유전자원 750점에 대한 Md-ACS1, Md-ACO1, Md-PG1 유전자형을 분석한 결과는 Table 2와 같다. ACS1의 대립유전자형은 ACS1-1/1이 48.3%로 가장 많았고 ACS1-1/2 39.4%, ACS1-2/2 12.3%이었다. ACO1ACO1-2/2가 62.1%로 가장 많았고 ACO1-1/2 27.6%, ACO1-1/1 10.3%이었다. PG1PG1-3/3이 34.5%로 가장 많았고, PG1-1/1 19.0%, PG1-1/2 0.5%이었으며, PG1-1/3PG1-2/3이 45.9%이었다. 높은 에틸렌 발생량 및 낮은 과육 경도와 관련 있는 유전자형인 ACS1-1/1, ACO1-2/2, PG1-3/3 모두를 가지고 있어 저장성이 약할 것으로 예측 되는 자원들이 전체의 16.4%(123점)로 가장 많았다. 이 그룹에는 ‘Arkansas Black’, ‘Beverly Hills’, ‘Earliblaze’ 등이 포함되어있다. 낮은 에틸렌 발생량 및 높은 과육경도와 관련 있어 저장성이 우수할 것으로 생각되는 ACS1-2/2, ACO1-1/1, PG1-1/1 또는 PG1-2/2인 자원들은 Fuji와 Fuji의 아조변이 품종, Chubu, Iwakami 등 3.6%(27점)이었다. 이 자원들을 교배양친으로 사용하면 저장성이 강한 품종 개발에 더 효율적일 것으로 생각 된다.

Md-ACS1, Md-ACO1, and Md-PG1 genotype of 750 apple germplasm preserved in Apple Research Institute (Gunwi), NIHHS, RDA.

Genotypez Cultivar or collection namey

ACS1 ACO1 PG1
1/1 1/1 1/1 Almey, Annurca, Dorothea, Gorgeous, Roberts Crab, SI-22-40
1/1 1/1 1/3 67PRI 1279-9 (27-55)
1/1 1/1 2/2 Adam’s Crab, Ashiro 3, Indian Summer Crab, Malus koreara, Malus sikkimensis Koehn, Red Jade, Robinson Crab
1/1 1/1 3/3 Akita Tare, Oswego, Snowdrift, Suislepper
1/1 1/2 1/1 Aegisagwa, Akita Maruba Tachi, Crimson King, Eley Purple Crab, FO73.11D.3, Hopa Crab A, Hopa Crab B, Malus prunifolia Fastigiata, Malus prunifolia var. macrocar, Malus robusta Baily, Malus robusta var. eleta 88075, Malus sylvestris Plena, Megumi x Jonathan, Morioka 55, Noret, Pink Beauty, Profusion, Purple Wave, Robusta 5, Tartan, Tohoku #4, Wakapingguo, Winter Gold Crab
1/1 1/2 1/3 Blaxstayman, Butter Ball, Collet, Columbia, Cowichan, De Jaune, Derman Winesap (4X), DIR68T492, Eosocheonwon, Hoehwa, Isawevis, Jonagram, M. gloriosa, Noiphing, Parker’s Pippin, Salute, Schoner aus Itzstedt, Tawria, Terry, Trusevitch Ⅰ-48-41, Verginia Crab K6, Wellington, White Pippin, Youyi
1/1 1/2 2/2 Adams’s Pearmain, Crimson Glory, Malus sargentii Rosea, Midget crab, Nagasaki Zumi, Pink Perfection, Prinicia, Sentinel Crab, St. Edmund’s Russet
1/1 1/2 2/3 Chulanka, Collins June, Court Pendu, Court Pendude France, CourtPenduPlat, Crawley Beauty, Dab325, Humboldt, Landsberger Reinette, M.platycarpa IRA 38-1, Malabols, Malus prunifolia DE 229, Max Trio, Reinette Clochard, Reinette du Canada, Shandongpingguo, Trial Ornamental, Urawa Tare, Whitney, Yeikan
1/1 1/2 3/3 Baxter, Chehalis, Early Joe, Early Strawberry, Malus columnaris, Malus Darth Mounta, Noiprim, Nova Easygro, Red June, Reid’s Seedling, Summer Champion, Whitney Crab
1/1 2/2 1/1 Anhaeng Tare, Arnold Crab, Atlas (UZ-84), Belle Fleur Large Mouche, Bessemyanka Michurina, Charlamoff, Demir, Doch Diany, Foxwhelp, Harcourt, Hatsubenishibori, Kemp, Keuleman, Malus laurifolia, Malus prunifolia Sikora, Malus pumila Royalty, Malus turesii, Merton Beauty, Nishtani Jonathan, Novosibirski Sweet, Paides Ziemas Abols, Roter Eiserapfel, Royale d’Angleterre, Samar Candskoe rannee, Scheidecker Crab, Stark Earliest, Succary, Virginiagold, Yeondaejohongha
1/1 2/2 1/2 Drap D’or Guemene, Primus
1/1 2/2 1/3 Alton, Ananas Rouge, Antonovka Karmen, Aromatic Russet, Arthur Turner, Battleford, Beatrix, Bellefleur Record, Beninomai, Blenheim Orange, Blenheim Pippin, BrabantBellefleur, Caravel (=Portia), Crow Egg, De Flanders, Democrat, Dubbele Zoete Aagt, Egremont, Frostproof, Greeveston Fanny, Gros Bois, Gros Frequin, Guldborg, Hibernal, Hwado, Lady (Lady Apple, Api), Lixiang, Macfree, Nubeena, Olga Crab, Orleans Reinette, P.18, Pederstrup, Pingguo, Pink Wood, Poeltsamaa Winter Apple, Pomme Royale, Prince Nicolas, Prinzen Apfel, Purpurroter Cousinot, Quastresse, R12740, Severny Sinap K-21, 39, Spasovka Kvasna, Spy 227, Summer Rose, Sylvia, Trent, Uralian Butter, Van Eseltine, York Imperial, Young America, Youyiaben, Zaohwang, Zhongqiu
1/1 2/2 2/2 Antonovka, Antonovka Shafran, Belle Fille, Budagovsky 57-491, Hillieri, Michelin, Spur Lodi, Stark Primo, Xinshuai
1/1 2/2 2/3 Altaiski Sweet, Bongli, Carmine Crab 81108 HT, Cestra Belferkitaika, Crimson Superb, Earl, Flontish, Gross Bohn, Gwendolyn, Huidobro, HunterOttawa244 4×, Ikorrocavka Alaja, James Grieve (Red Rosamund Strain), Kuoteshaho, Lalla Red Delicious (T1-27-77), Lemoine Purple Crab, Local 6 (907579), M. robusta Joan, M. soulardii, Major, Malus jacki, Malus zumi, Menkoi Hime, Mislimka, Muscadet de Dieppe, NO pip, Norfolk Royal, Norhey, Northwood, Ogden, PK-14, PRI 77-1, Reinerre d’espagne, Repinvaldo de Liebana, Roda Mantet, Rozovoye Priewoskhodnoye, Sensacion, Steacy, Yukari
1/1 2/2 3/3 A 2, Alpha 68, Alpha 68A, Anisim, Anoka, Appa No. 3, Arkansas Black, Aromat de vara, Athabasca, Beautiful Arcade, BernerRosen, Beverly Hills, Bolero, Britemac, Carroll, CG 10, Chouyou, Chunhyang, Cortland, Court Royal, Crollon, Dayton, Derman McIntosh (4X), Desertnoe Petrove, Doux Normandie, Doux-AMR, E559-13, Earliblaze, Early Golden, Field Spy, Flaym, FlowerofKent, Frequin, Geneva Early, Gingergold, Gloria Mundi, Grenadier, Hall Keeper, Improved McIntosh, Ingol, Jabchenab, Jadernicka, Jajang, Jamba, Kestrel, King of Tompkins 2, Kitanosachi, Klarapfel, Laxton’s Superb, Liestnaya Antonoffku #1836-A, Local 2 (907575), Local 4 (907577), Local 5 (907578), Loyda, M.1, M.3, M.5, M.7 EMLA, Malus pumila Apetala, Manitoba Spy, Marin Onfroy, Marshall McIntosh, Maypole, McIntosh Spur, McIntosh Summerland Red, Merton 793, Merton Ace, Merton Worcester, Milton, MM.102, MM.103, MM.104, MM.115, Nico, Northern Spy, Obilnoye, Ottawa 1, Ottawa 3, Ottawa 8, P.13, P.14, Pajam 1, Papirovkapolska, Parkland, Patricia, PRI 333-9, Primate, Prime Golden, Puritan, Red Apple, Red Canel, Red Dijmanszoet, Redfree, Reinette de Champagne, Reinette De Cuzy, Reinette van Ekenstein, Rosemary Russet, Rossoshanskoje Polosatoje, Schoharie Spy, Shaphran Letnij, Shenandoah, Shuihongsepingguo, Sops of wine, Spencer Seedlss, Spur Red Delicious, Spur Starking, Stayma Keel, Stearns, Sterappel, Striped Tawny, Suislepas Rozabols, Susvorenskoye #4, Szapanska, Thurgauer Weinapfel, Tohoku #2, Tuscan, Vandevere B-26-4, Wabskaw, Wayne, Wellington Bloomless, Williams Favourite, Yellow Bellflower, Yellow Siberian
1/2 1/1 1/1 Fukutami, Jeongseonmaeju, Schlect Spur Red Delicious, Zhigulevskoe
1/2 1/1 1/2 Early Stripe Spur
1/2 1/1 1/3 Ben Spur, Bisbee Spur, Brigham Delicious, Chellan Red, Red Delicious, Delicious, Derman Delicious (4X), Double Red Delicious, Fruitland Delicious, Imperial Red Delicious, Jonadee, Kinrei, Miller Sturdy Spur, Shiro, Short Well, Sky Spur, Stahls Prinz, Starkspur Delicious, Strip Bisbee, Wayne Spur Delicious
1/2 1/1 3/3 Mu-Jon, Nero Rome, Ryan, White Winter, White Winter Pearmain, Wickson
1/2 1/2 1/1 Akane, Bel Golden, Boller McIntosh, Chestnut Crab, Eikou, Ellison Orange, Kiou, Michinoku, Nero-26, Prairie Spy, Royal Jonathan, Staymared, Stembridge Cluster, Sundale Sturdee Spur, Tsugaru-Sayaka, Wealthy Double Red Delicious
1/2 1/2 1/2 Stark Florence
1/2 1/2 1/3 Alps Otome, Antonovka Zheltaia, Arlet, Bhrens, Bramley’s Seedling, Captain Kidd, Conrad, Cut, Delistein, Eurika, Great Ralls, Hillwell Red Braeburn, Hunter Sandow 2-4-4, Idared-1, Idared-2, Ivette, Moira, Newfane, Oilase, Priscilla, Red Cinnamon, Subtropical Apple, Sun Gold, Sweet Delicious, Tilsith, Trusevitch V-5-38, Turley Winesap, Yantaishaguo
1/2 1/2 2/2 Early Banta, Hwangtaepyeong, Inducoa No.1, Longguan, Minisker von Hammerstein, Yellow Newtown, Yesansamyeob
1/2 1/2 2/3 Berlepsch Red, Chinatsu, Giant Janet, Improved Lambrook Pippin, Kile, Korei, Lord Wolsley, Loyalist, Northern Lights, Rozovoe, Sheisyun, Shizuka, Swiss Gourmet
1/2 1/2 3/3 Amelia, Empire, Franklin, Jersey Spur, King Edward Ⅶ, Malus coronaria Wynema, Mantuanskoye, NFT 1, Orin, Pitsmaston Pineapple x 692, Red Fortune, Sudeten Reinette, Sunlight, Tropical Beauty, Webster, York-A-Red
1/2 2/2 1/1 Aroma, Baumann’s Reinette, Beauty Tsugaru, Bedford Pippin, Bercon, Blue Pearmain, Carola, De Roche st lawrence, De Roche st. Lawrence, Early Red Rich, Emneth Earlry, Florina, Frian Dise, Kem Tsugaru, Natsuka Tsugaru, Pink Lady, Spur Earliblaze, St. Cecilia, Sturmer Pippin, Tsugaru, Tsugaru-Hime, William s Pride, Yamamo Tsugaru
1/2 2/2 1/3 Alfa, Amere, Amere de Berthecourt (True), Aori No.1, Bedfordshir Foundling, Berthecourt, Beverly Crab, Bulmer Norman, Burgundy, Cherry cox, Chuxiao, Coast Apple, Cox’s Orange Pippin, Cox’s Orange pippin Self-fortile clone4, Delago, Devonshire Quarreden, DL-11-12, Dutch Mignonne, Eickhoff, Eikan, Empress, Fallwater, Fantazja, Fuhong, Geneva Black, Gladstone, Golden Grecoce, Gravenstein, Greenball, Hausmar, Jonagored, Jonica, Karmijn, Local 10 (907583), Local 11 (907584), Lombart’s Calville, Longfield, Malus rockii, McIntosh, Nepal, Nugget Spur, NY 674, Potomac, Potter, Red Melba, Shinkou, Tsugaru-Hayate, Zuccalmaglio
1/2 2/2 2/2 Hongso, Lady Williams, Martini VH/430, Merton Pearmain, Spuree Rome, Stembridge Jersey, Vandevere
1/2 2/2 2/3 Blairmont, Blushing Gold, Chautauqua, Doud Golden Delicious (4X), Doyle, Early Harvest, Gold Spur, Golden Delicious, Malus mandshurica 2330, Mutsu, Odin, Peck’s Pleasant, Pepin Shafrannyi, Pigeonnet, Regent, Reinette Grise, Rugenthaons, Smoothee Golden, Smordodina, Spigold, Spur Golden Delicious, Summer Dream, Sunrise, Tale Sweet, Telamon, Wolf River, Yellow Delicious
1/2 2/2 3/3 Aizaohui, Alkmene, Anna, Aurora, Baldwin, Bancroft, Beforest, Brusnichoe, Calville Blanc, Charlotte, Chesapeak Apple, Chicheng, Clarke, Crandall, Diana, Esopus Spitzenburg, Fillbarrel, Gallia Beauty, Glockenapfel, Goro, Granny Smith, Greensleeves, Heyer #12, Hongsim, Indo, Ingram, Jonagold,Rubinstar, Lord Lambourne, M255-0010, Mahe-7, Manshu, Michaelmas Red, Mollie’s Delicious, Monmouth Beauty, Morden 359, Mother, Muscadet de Lense, OBIR2T47, Ontario, Oregon Spur, Oriole, Ortley, Ottawa, Oyusanjeong, Piervomaiskoie, Pink Pearl, Pixie, Pomme Cloche, PRI 2050-2, Priam, Radoux, Ranger, Red Astrachan, Red coy’s Pomona, Redstreak, Rhode Island Greening, SA54-43, Sampion, Scarlet Sentinel M.11 apple, Shin Indo, Sir Prize, Smokehouse, Spencer, Stafford, Stoke Red, Summerred, Sunburn, Sweet Alford, Sweet Coppin, Sweet McIntosh, Tallmans Sweet, Tumanga, VIP, Winesap, Winter Banana, Yuggyehaedang, Zaohui, Zigeunerinapfel, Zuboff
2/2 1/1 1/1 Chubu, E36-7, Fuji, Fuji-Benishogun, Fuji-Champion, Fuji-Hangawi, Fuji-Jubilee, Fuji-KIKU 8, Fuji-Myra Red, Fuji-Nagafu 12, Fuji-Nagafu 2, Fuji-Nagafu 6, Narita Fuji, Fuji-Rakuraku, Yamadani 2gei Fuji, Fuji-Akifu-1, Fuji-Royal, Fuji-Royal 21, Iwakami, Mimaki Spur, Spur Fuji, Standel, Sun Fuji, Wangsil, Yataka
2/2 1/1 2/2 Marie-Joseph d’Othee, Nyeongpung
2/2 1/2 1/1 Aori No.15, Dulcet (Bailey), Geumwangja, Holly, Honggeum, Hwangok, Idajon, Kagayaki, Nyeongsu, Pilot, Splendor
2/2 1/2 1/3 Annie Elizabeth, Dunkerton Late, Hwamugold, Kinsei, Picnic, Sandel
2/2 1/2 2/2 Hongan, Malus fusca F2, Miki Life, Mitsuyoshi, Shenshu
2/2 1/2 2/3 Gala-Regal, Gala-Scarlet, Sahmiga (G), Sosogwa, Topaz
2/2 1/2 3/3 4814018, C. R. Fireside, Gala, Galaxy Gala, Gloster 69, Lakeland, Orei, Seohong, Shengli, Vystavochnoye, Yume Oirase, Yunqing, Gamhong
2/2 2/2 1/1 Akagi, Alome Mills, Liaofu, Opalescent, Shinano Gold, Undine
2/2 2/2 1/3 Bonnoe, Charles Ross, Discovery, Ingrid Marie, Reverend. W. Wilks, Spartan, State Fair, Vanda
2/2 2/2 2/3 Kandil Sinap, Lustre Elstar, Northwest Greening, Rumut
2/2 2/2 3/3 Belle de Jardins, Delbarestivale, Jewel, Meran, Resista, Willow Twig

zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.

yBold text indicate that cultivar or collection was used for firmness analysis.



과실 경도와 Md-ACS1, Md-ACO1, Md-PG1 유전자형

Md-ACS1, Md-ACO1, Md-PG1 유전자형 분석을 수행한 사과 유전자원 중 108점에 대하여 수확일과 상온 저장(20~25℃) 20일 후 과실의 경도, 저장 중 경도 변화에 대하여 조사하였다(Table 3). Sunrise 등 4점을 8월 1일에 첫 수확하였으며 Pink Lady를 11월 9일에 마지막으로 수확하였다. 수확일의 경도는 Sundale Sturdee Spur가 116.2 N으로 가장 높았고 유전자형은 ACS1-1/2, ACO1-1/2, PG1-1/1이었다. Anna는 32.1 N으로 가장 낮았으며 ACS1-1/2, ACO1-2/2, PG1-3/3이었다. 저장 중 경도 변화가 73.8 N으로 가장 컸던 Zuboff는 ACS1-1/2, ACO1-2/2, PG1-3/3 이었으며 1.2 N으로 가장 적었던 것은 Fuji 아조변이 품종인 Fuji-Nagafu 6이었다. Fuji의 경도 변화도 1.6 N으로 매우 적은 것으로 확인되었다. Fuji와 Fuji의 아조변이 품종은 ACS1-2/2, ACO1-1/1, PG1-1/1 유전자형을 가지고 있다. 본 연구 결과는 ACS1-2/2는 경도와 저장성이 강하고(Marić & Lukić 2014), PG1-3/3은 약한 것으로 보고되었던 결과와 유사하였다(Longhi et al. 2013). 에틸렌 발생이 적고 저장성이 뛰어난 것으로 알려진 Fuji는 ACS1-2/2 promoter region의 SINE retroposon insertion에 의해 다른 품종 보다 에틸렌 발생량이 적은 것으로 알려져 있다(Kondo et al. 1991, Zhu & Barritt 2008). Md-ACS1은 대립유전자형에 따라 저장 후 과실의 경도와 저장 중 경도변화에 차이가 있었다. ACS1-2/2ACS1-1/2ACS1-2/2에 비해 저장 후 경도가 가장 높았고 경도 변화는 가장 적었으며 통계적으로도 유의했다(Table 4). ACS1-2/2ACS1-1/2ACO1-1/1의 유전자형을 가지는 품종들 보다 내생 에틸렌 발생량이 낮았으며, mRNA의 발현량이 다른 대립유전자형에 비해 적었음이 보고 된 바 있다(Harada et al. 2000). 반면 Md-ACO1은 대립유전자형에 따른 수확일과 저장 후 과실의 경도, 경도 변화에 차이가 없는 것으로 확인되었다. Md-PG1은 대립유전자형에 따라 수확일과 저장 후 과실경도에서는 차이가 없었지만 경도 변화는 통계적 유의 차를 보였다. PG1-2/2는 경도 변화가 가장 적었고, PG1-1/1은 다음으로 경도 변화가 적었다. PG1-3/3PG1-1/3은 가장 경도 변화가 큰 것으로 조사되었다. 과실의 저장 중 경도 변화는 Md-ACS1, Md-PG1의 대립유전자형과 관련이 있었으나 Md-ACO1은 관련이 없었다(Nybom et al. 2013). 따라서 분자표지 Md-ACS1, Md-PG1은 사과의 저장성 예측에 활용 가능할 것으로 생각 된다.

Fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage and difference between firmness at harvest and firmness after storage in 108 samples.

Cultivar or collection Harvest date Firmness (N) Cultivar or collection Harvest date Firmness (N)


Fresh fruit Storage fruit Difference Fresh fruit Storage fruit Difference
4814018 10-Sep 72.4 51.4 21.0 Iwakami 21-Aug 67.7 46.3 21.4
Akane 10-Aug 45.4 41.0 4.4 Jadernicka 20-Aug 77.2 0.0 77.2
Amere 22-Aug 77.4 0.0 77.4 Kinrei 3-Sep 72.4 44.3 28.1
Anna 14-Aug 32.1 0.0 32.1 Kio 14-Aug 66.7 47.8 18.9
Annurca 6-Nov 98.6 72.4 26.1 Korei 1-Oct 60.0 39.5 20.5
Antonovka shafran 9-Aug 50.2 27.1 23.2 McIntosh 30-Aug 76.7 35.5 41.3
Arkansas black 29-Oct 106.6 81.3 25.3 Michelin 30-Aug 71.7 35.0 36.7
Arlet 11-Aug 65.3 41.1 24.2 Mollie`s Delicious 14-Aug 58.9 0.0 58.9
Arthur Turner 11-Aug 59.7 33.4 26.3 Mutsu 3-Sep 78.3 49.0 29.3
Beforest 3-Sep 58.5 29.3 29.3 Nero Rome 30-Aug 61.6 24.9 36.7
Beninomai 11-Aug 79.4 0.0 79.4 Nishtani Jonathan 8-Aug 35.0 0.0 35.0
Beverly hills 1-Aug 44.9 30.7 14.2 Northern Spy 3-Sep 98.8 50.7 48.0
Blairmont 1-Aug 57.7 25.8 32.0 Northwest Greening 1-Oct 96.7 78.5 18.3
Blushing Gold 3-Sep 94.0 55.2 38.9 Nubeena 1-Nov 106.3 94.4 11.9
Bonnoe 10-Sep 69.9 45.8 24.1 Nugget Spur 1-Oct 67.2 61.4 5.8
Charles Ross 13-Aug 86.5 0.0 86.5 Obilnoye 30-Aug 95.4 0.0 95.4
Chicheng 14-Sep 55.3 52.7 2.6 Oregon Spur 6-Nov 65.3 44.8 20.5
Collet 13-Aug 56.0 0.0 56.0 Orin 3-Sep 78.4 59.9 18.5
Crimson King 14-Aug 74.6 0.0 74.6 Oswego 1-Oct 90.5 52.4 38.1
Dayton 14-Aug 61.8 44.9 16.9 Pederstrup 11-Sep 67.7 0.0 67.7
Delicious 30-Aug 58.9 27.9 31.0 Picnic 25-Sep 69.7 36.2 33.5
Demir 17-Oct 102.1 79.8 22.3 Pink Lady 9-Nov 77.0 66.0 11.0
Diana 11-Oct 69.3 38.8 30.4 Pink Wood 1-Aug 59.9 21.8 38.0
Double Red Delicious 30-Aug 66.3 38.5 27.8 Pixie 31-Aug 111.0 74.9 36.2
Early Golden 2-Aug 70.8 0.0 70.8 Prairie Spy 11-Sep 81.5 52.9 28.6
Eikou 9-Aug 53.4 48.1 5.3 Red delicious 3-Sep 60.8 24.4 36.4
Empress 8-Aug 53.4 0.0 53.4 Royal Jonathan 31-Aug 75.8 44.9 30.9
Eurika 2-Aug 51.9 0.0 51.9 Sampion 1-Oct 59.7 24.2 35.5
Fallwater 1-Nov 72.9 46.0 26.9 Seohong 9-Aug 47.4 32.6 14.8
Field Spy 11-Sep 64.2 49.8 14.4 Shenshu 3-Sep 63.8 60.8 3.0
FO73.11D.3 5-Nov 86.9 63.6 23.3 Shinano Gold 17-Sep 72.5 65.1 7.4
Frequin 14-Aug 64.8 0.0 64.8 Shiro 3-Sep 66.0 31.6 34.5
Fuji 31-Oct 50.5 48.9 1.6 Smokehouse 20-Aug 53.0 0.0 53.0
Fuji-Nagafu 6 15-Oct 57.9 56.7 1.2 Smoothee Golden 26-Sep 62.9 33.0 29.9
Fuji-Rakuraku 15-Oct 59.5 56.6 2.9 Spartan 31-Aug 83.4 40.4 43.0
Gala 14-Aug 80.2 55.1 25.1 Spur Golden Delicious 14-Sep 59.6 41.5 18.1
Galaxy Gala 21-Aug 77.5 57.1 20.4 Spur Starking 24-Aug 62.9 37.1 25.9
Gamhong 2-Oct 64.1 58.3 5.8 Stearns 13-Aug 60.9 35.2 25.8
Geneva Black 14-Aug 49.7 36.3 13.4 Sun Gold 20-Aug 56.6 31.6 25.1
Giant Janet 6-Nov 76.8 38.2 38.5 Sundale Sturdee Spur 14-Sep 116.2 97.5 18.7
Gingergold 8-Aug 44.4 0.0 44.4 Sunlight 14-Aug 54.2 34.8 19.4
Gold spur 3-Sep 76.8 42.8 34.0 Sunrise 1-Aug 46.0 0.0 46.0
Golden Delicious 3-Sep 63.5 42.9 20.5 Sweet Delicious 31-Aug 65.3 37.8 27.5
Gravenstein 14-Aug 46.9 0.0 46.9 Tallmans Sweet 31-Aug 80.0 61.0 19.0
Great Ralls 6-Nov 78.6 43.6 34.9 Telamon 27-Sep 64.1 31.3 32.8
Gros Bois 20-Aug 65.0 37.9 27.2 Trent 27-Sep 89.3 74.7 14.5
Hillwell Red Braeburn 17-Oct 66.6 33.7 32.9 Tsugaru-Sayaka 11-Aug 61.8 39.2 22.6
Holly 6-3 15-Oct 56.5 43.2 13.3 Turley Winesap 17-Sep 51.7 19.3 32.4
Hongan 27-Sep 56.3 53.8 2.5 Virginiagold 1-Oct 60.0 53.7 6.3
Hongso 14-Sep 72.7 64.1 8.6 White Winter Pearmain 8-Nov 60.7 26.4 34.3
Hwangok 14-Sep 57.2 54.3 2.9 Wickson 8-Nov 60.2 25.9 34.3
Idajon 17-Sep 61.9 32.4 29.5 Yellow Bellflower 27-Sep 75.3 37.0 38.4
Idared-1 25-Sep 62.8 45.2 17.6 Yellow Delicious 19-Sep 62.8 42.7 20.1
Ikorrocavka Alaja 14-Aug 38.0 0.0 38.0 zuboff 6-Sep 94.5 20.8 73.8


According to genotype of Md-ACS1, Md-ACO1, and Md-PG1, fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage, difference between firmness at harvest and firmness after storage in 108 samples.

Genotypez Firmness (N)

Fresh fruit Storage fruit Difference in fresh and storage fruit
ACS1-1/1 71.6ay 32.7b 38.9a
ACS1-1/2 66.3a 36.3b 29.9a
ACS1-2/2 67.6a 48.7a 18.9b

ACO1-1/1 66.5a 41.2a 25.3a
ACO1-1/2 66.5a 41.8a 24.8a
ACO1-2/2 69.1a 34.6a 34.5a

PG1-1/1 69.0a 50.5a 18.6bc
PG1-2/2 62.9a 48.2a 14.8c
PG1-1/3 67.2a 31.9a 35.4a
PG1-2/3 67.8a 36.3a 31.5ab
PG1-3/3 68.9a 34.1a 34.9a

zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.

yMeans followed by the same letters within the column per parameter are not significantly different (p<0.05).



숙기에 따른 과실의 저장 중 경도 변화

수확시기에 따라 7~8월은 조생종, 9~10월 상순까지는 중생종, 10월 중순~11월까지 만생종으로 분류하여 숙기와 유전자형에 따른 저장 중 경도 변화를 분석하였다(Fig. 1). Md-ACS1은 대립유전자형이 같더라도 숙기가 빠를수록 경도 변화가 커지는 경향을 보였다. 만생종이면서 ACS1-2/2 유전자형을 가지는 경우에는 경도 변화가 가장 적었고 조생종 ACS1-1/1은 경도변화가 가장 컸다(Oraguzie et al. 2004). Md-ACO1 대립유전자형과 숙기에 따른 저장 중 경도 변화는 통계적으로 유의미한 경향이 없었고, 앞서 Md-ACO1 대립유전자형에 따른 수확일과 저장 후 과실의 경도, 저장 중 경도변화에서도 통계적 차이가 없는 것으로 확인되어 Md-ACO1은 사과의 저장성 예측에 적합하지 않은 것으로 생각된다. Md-PG1은 만생종이면서 PG1-2/2인 실험 샘플이 없었고 PG1-1/3PG1-2/3는 각각의 실험 샘플 수가 적어 같은 그룹으로 분류하여 분석하였다. Md-PG1Md-ACS1의 결과와 유사하게 숙기가 빠를수록 저장 중 경도 변화가 커지는 경향을 보였으며 중생종인 PG1-2/2의 경도 변화가 가장 적었다. Gingergold 등 20점은 수확 후 상온 저장 20일에 도달하기 전 과육이 완전히 분질화 되어 저장성이 약한 것으로 확인되었으며 9월에 수확한 Pederstrup을 제외하고 모두 8월에 수확하는 조생종이었다. Charles Ross, Crimson King을 제외하고 대부분 저장성이 약한 ACS1-1, ACS1-2, PG1-3 대립유전자를 가지고 있었다. Md-ACS1, Md-PG1은 같은 대립유전자형에서도 숙기가 늦을수록 저장성이 더 우수할 것으로 예측이 가능하였다.

Fig. 1. Difference in fresh and storage fruit firmness according to harvest season and Md-ACS1 (A), Md-ACO1 (B), Md-PG1 (C) genotype in 108 samples. Same small letters are not significantly different at the 5% level by Duncan’s multiple range test.

본 연구의 결과, 분자표지 Md-ACS1, Md-PG1은 사과의 저장성 예측, 저장성이 강한 모부본 선정 및 교배 계통의 조기 선발에 유용하게 사용될 수 있을 것으로 생각 된다. 또한 저장성과 관련 된 사과 유전자원 750점의 유전자형 분석 결과는 유전자원의 육종 소재 활용을 위한 기초자료가 될 수 있을 것이다.

적 요

사과 품종 육성에 있어서 저장성과 연관된 분자표지의 Marker Assisted Selection (MAS) 이용 가능성을 검토하고 사과 유전자원의 Md-ACS1, Md-ACO1, Md-PG1 유전자형 정보를 육종 소재 활용을 위한 기초자료로 제공하고자 하였다. 사과 유전자원 750점에 대하여 에틸렌 생합성 과정에 관여하는 유전자 Md-ACS1, Md-ACO1와 세포벽분해효소 관련 유전자 Md-PG1의 대립유전자형을 분석하였다. 유전자형 분석에 사용된 유전자원 중 108점에 대하여 수확일과 상온 저장(20~25℃) 20일 후의 과실 경도 및 저장기간 중 과실 경도 변화(수확일과 저장 후 과실 경도의 차이)를 조사하였다. Md-ACS1, Md-PG1은 저장 중 과실 경도 변화와 관련이 있었고, ACS1-2/2, PG1-1/1, PG1-2/2는 가장 낮은 경도 변화를 보였다. 또한 같은 유전자형을 가지더라도 숙기가 늦은 만생종이 저장 중 경도 변화가 적었다. Md-ACO1은 수확일과 저장 후 과실 경도 및 경도 변화와 관련이 없었다. 사과 유전자원 750점 중 ACS1-2/2, PG1-1/1 또는 PG1-2/2의 유전자형을 가진 자원은 3.6%로 Fuji, Fuji의 아조변이 품종, Chubu, Iwakami 등이었다. 따라서 Md-ACS1Md-PG1 분자표지를 활용하여 사과의 저장성 예측하고 사과의 육종 효율 향상을 위한 MAS 적용이 가능할 것으로 생각된다.

사 사

본 연구는 2019년도 농촌진흥청 국립원예특작과학원 시험연구사업의 지원에 의해 수행되었습니다(과제번호: PJ01122001).

References
  1. Costa F, Cappellin L, Farneti B, Tadiello A, Romano A, Soukoulis C, Sansavini S, Velasco R, Biasioli F. 2014. Advances in QTL mapping for ethylene production in apple (Malus×domestica Borkh.). Postharvest Biol Technol 87: 126-132.
    CrossRef
  2. Costa F, Sara S, Van de Weg WE, Guerra W, Cecchinel M, Dallivina J, Koller B, Sansivini S. 2005. Role of the genes Md-ACO1 and Md-ACS1 in ethylene production and shelf life of apple (Malus domestica Borkh). Euphytica 141: 181-190.
    CrossRef
  3. Harada T, Sunako T, Wakasa Y, Soejima J, Satoh T, Niizeki M. 2000. An allele of the 1-aminocyclopropane-1-carboxylate synthase gene (Md-ACS1) accounts for the low level of ethylene production in climacteric fruits of some apple cultivars. Theor Appl Genet 101: 742-746.
    CrossRef
  4. Hummer KE, Janick J. 2009. Rosaceae: taxonomy. In: Folta KM, Gardiner SE (Eds). Genetics and genomics of Rosaceae. Springer, New York. pp. 1-17.
    CrossRef
  5. Hur YY, Jung CJ, Noh JH, Jung SM, Nam JC, Ma KH, Park KS. 2014. Analysis of genetic relationship of seedless germplasm and validation assay of the P3_VvAGL11 marker linked to seedlessness in grapevines. Korean J Breed Sci 46: 28-36.
    CrossRef
  6. Janick J, Cummins JN, Brown SK, Hemmat M. 1996. Apples. In: Janick J, Moore JM (Eds). Fruit breeding, tree and tropical fruits. John Wiley & Sons, Inc., New York. pp. 1-78.
  7. Johnston JW, Hewett EW, Hertog MLATM. 2002. Postharvest softening of apple (Malus domestica) fruit: A Review. N Z J Crop Hortic Sci 30: 145-160.
    CrossRef
  8. Kellerhals M, Schütz S, Patocchi A. 2017. Breeding for host resistance to fire blight. J Plant Pathol 99: 37-43.
  9. Khan MA, Duffy B, Gessler C, Patocchi A. 2006. QTL mapping of fire blight resistance in apple. Mol Breeding 17: 299-306.
    CrossRef
  10. Kim JH, Oh YJ, Lee GA, Kwon YS, Kim SA, Kwon SI, Do YS, Choi C. 2019. Genetic diversity, structure, and core collection of Korean apple germplasm using simple sequence repeat markers. Horticult J 88: 329-337.
    CrossRef
  11. Kondo S, Uthaibutra J, Gemma H. 1991. Comparison of 1-Aminocyclopropane-1-carboxylic acid, abscisic acid and anthocyanin content of some apple cultivars during fruit growth and maturation. J Jpn Soc Hortic Sci 60: 505-511.
    CrossRef
  12. KREI. 2020. Trend and prospect of supply and demand in fruit. Agricultural perspective. Korea Rural Economic Institute, Seoul, Korea. pp. 502-504.
  13. Kwon YS, Kwon SI, Kim SA, Kweon HJ, Yoo J, Ryu S, Kang IK, Kim JH. 2017. Estimation of storability for Korean apples (Malus domestica) using Md-ACS1 and Md-ACO1 DNA marker. Korean J Food Preserv 24: 903-909.
    CrossRef
  14. Longhi S, Hamblin MT, Trainotti L, Peace CP, Velasco R, Costa F. 2013. A candidate gene based approach validates Md-PG1 as the main responsible for a QTL impacting fruit texture in apple (Malus x domestica Borkh). BMC Plant Biol 13: 37.
    Pubmed KoreaMed CrossRef
  15. Mann HS, Alton JJ, Kim S, Tong CBS. 2008. Differential expression of cell-wall-modifying genes and novel cDNAs in apple fruit during storage. J Amer Soc Hort Sci 133: 152-157.
    CrossRef
  16. Marić S, Lukić M. 2014. Allelic polymorphism and inheritance of Md-ACS1 and Md-ACO1 genes in apple (Malus×domestica Borkh.). Plant Breeding 133: 108-114.
  17. McClure KA, Gardner KM, Douglas GM, Song J, Forney CF, DeLong J, Fan L, Du L, Toivonen PMA, Somers DJ, Rajcan I, Myles S. 2018. A genome-wide association study of apple quality and scab resistance. Plant Genome 11: 1-14.
    Pubmed CrossRef
  18. Nybom H, Ahmadi-Afzadi M, Sehic J, Hertog M. 2013. DNA marker-assisted evaluation of fruit firmness at harvest and post-harvest fruit softening in a diverse apple germplasm. Tree Genet Genomes 9: 279-290.
    CrossRef
  19. Oraguzie NC, Iwanami H, Soejima J, Harada T, Hall A. 2004. Inheritance of the Md-ACS1 gene and its relationship to fruit softening in apple (Malus domestica Borkh.). Theor Appl Genet 108: 1526-1533.
    Pubmed CrossRef
  20. Potts SM, Han Y, Khan MA, Kushad MM, Rayburn AL, Korban SS. 2012. Genetic diversity and characterization of a core collection of Malus germplasm using simple sequence repeats (SSRs). Plant Mol Biol Rep 30: 827-837.
    CrossRef
  21. Soejima J, Bessho H, Tsuchiya S, Komori S, Abe K, Kotoda N. 1998. Breeding of Fuji Apples and Performance on JM Rootstocks. Compact Fruit Tree 31: 22-24.
  22. Sunako T, Sakuraba W, Senda M, Akada S, Ishikawa R, Niizeki M, Harada T. 1999. An allele of the ripening-specific 1-aminocyclopropane-1-carboxylic acid synthase gene (ACS1) in apple fruit with a long storage life. Plant Physiol 119: 1297-1303.
    Pubmed KoreaMed CrossRef
  23. Wakasa Y, Kudo H, Ishikawa R, Akada S, Senda M, Niizeki M, Harada T. 2006. Low expression of an endopolygalacturonase gene in apple fruit with long-term storage potential. Postharvest Biol Technol 39: 193-198.
    CrossRef
  24. Yang X, Song J, Campbell-Palmer L, Fillmore S, Zhang Z. 2013. Effect of ethylene and 1-MCP on expression of genes involved in ethylene biosynthesis and perception during ripening of apple fruit. Postharvest Biol Technol 78: 55-66.
    CrossRef
  25. Zhu Y, Barritt BH. 2008. Md-ACS1 and Md-ACO1 genotyping of apple (Malus x domestica Borkh.) breeding parents and suitability for marker-assisted selection. Tree Genet Genomes 4: 555-562.
    CrossRef
  26. Zhu Y, Mattheis J, Barritt B, Peace C. 2009. Funtional genomics and marker development for apple sensory qualities. ARS: Final Report of USDA.


December 2020, 52 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information