search for




 

Development of HRM Markers Based on SNPs Identified from Next Generation Resequencing of Susceptible and Resistant Parents to Gummy Stem Blight in Watermelon
수박에서 덩굴마름병 감수성 및 저항성 양친에 대한 차세대 염기서열 재분석으로 탐색된 SNP 기반 HRM 분자표지 개발
Korean J Breed Sci 2018;50(4):424-433
Published online December 1, 2018
© 2018 Korean Society of Breeding Science.

Eun Su Lee1, Jinhee Kim1, Jong Pil Hong1, Do-Sun Kim1, Minkyong Kim1, Yun-Chan Huh2, Chang-Gi Back3, Jundae Lee4, and Hye-Eun Lee1,*
이은수1, 김진희1, 홍종필1, 김도선1, 김민경1, 허윤찬2, 백창기3, 이준대4, 이혜은1,*

1Vegetable Research Division, NIHHS, RDA, Wanju, 55365, Republic of Korea,
2Planning and Coordination Division, NIHHS, RDA, Wanju, 55365, Republic of Korea,
3Horticultural and Herbal Crop Environment Division, NIHHS, RDA, Wanju, 55365, Republic of Korea,
4Department of Horticulture, Chonbuk National University, Jeonju, 54896, Republic of Korea
1농촌진흥청 국립원예특작과학원 채소과,
2농촌진흥청 국립원예특작과학원 기획조정과,
3농촌진흥청 국립원예특작과학원 원예특작환경과,
4전북대학교 농업생명과학대학 원예학과
Correspondence to: (E-mail: helee72@korea.kr, Tel: +82-63-238-6674, Fax: +82-63-238-6605)
Received October 5, 2018; Revised October 9, 2018; Accepted October 30, 2018.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Watermelon (Citrullus lanatus) is an economically important vegetable crop all over the world, which has functional compounds such as lycopene and citrulline. Gummy stem blight caused by Didymella bryoniae is one of the most devastative diseases in watermelon. Single nucleotide polymorphisms (SNPs), which are genetic variations occurring between individuals with respect to a single base, were often used to construct genetic linkage maps and develop molecular markers linked to a variety of horticultural traits and resistance to several diseases. In this study, we developed high-resolution melting (HRM) markers based on SNPs generated from NGS resequencing of two parents in watermelon. Plant materials were C. lanatus ‘920533’ (female and susceptible parent), C. amarus ‘PI 189225’ (male and resistant parent), and their F1 and F2 progenies. A total of 13.6 Gbp (‘920533’) and 13.1 Gbp (‘PI 189225’) of genomic sequences were obtained using NGS analysis. A total of 6.09 million SNPs between ‘920533’ and ‘PI 189225’ were detected, and 354,860 SNPs were identified as potential HRM primer sets. From these, a total of 330 primer sets for HRM analysis were designed. As a result, a total of 61 HRM markers that have polymorphic melting curves were developed. These HRM markers can be used for the construction of SNP-based linkage maps and for the analysis of quantitative trait loci (QTLs) related to gummy stem blight resistance.

Keywords : Gummy stem blight, Resistance, Genetic linkage map, Melting curve, Polymorphism
서 언

수박은 채소작물 중 전세계 재배면적 약 3,518천ha로 4위에 해당하는 중요한 작물이다(FAOSTAT 2016). 수박은 약 91%가 수분으로 이루어져 있어 여름철 갈증 해소를 위하여 소비가 많이 되며 또한 라이코펜, 시트룰린 등 기능성 물질을 함유하고 있어 건강 식품으로 활용되고 있다(Kim et al. 2013).

덩굴마름병은 수박을 비롯한 여러 박과 채소에 큰 피해를 주는 병으로, 일교차가 크고 고온 다습한 조건에서 주로 발생한다(Lee et al. 2016). 발병 시 잎에서는 황갈색의 작은 반점이 생기며 점차 큰 원형 또는 부정형으로 병반이 확대되고, 줄기에서는 회갈색의 불규칙한 병반이 형성되어 심하면 식물체 전체가 고사한다(Skarshaug 1981). 특히 수박에서는 잎, 줄기, 과경 등에서 물관이 마르고 잎이 일찍 떨어지는 증상이 보이며(Maynard & Hopkins 1999), 착과 이후에 병이 급속히 진전되어 과실이 수확되기 이전에 잎과 덩굴이 고사하는 경우가 많다(Kwon et al. 1997).

수박에서 덩굴마름병을 방제하기 위해서는 병 발생 이전에 약제를 미리 살포하여 예방해야 하며, 심하게 발생되는 포장의 경우에는 윤작을 수행해야 한다(dos Santos et al. 2016). 하지만 화학적 방제의 경우 반복적으로 사용되면 생태계 오염을 야기할 수 있고 농산물의 안전성 문제를 유발시킬 수 있으며 재배적 방제 또한 노동력과 비용이 소모되는 측면에서 문제점을 갖고 있다(Wolukau et al. 2007). 병저항성 품종의 개발은 덩굴마름병 방제를 위한 근본적인 해결책이 될 수 있으며, 복합 병해 저항성 유전자를 집적할 수 있기 때문에 효율적인 방법이다(Lou et al. 2013, Norton et al. 1995).

수박에서 덩굴마름병 저항성을 지니는 소재는 미국 USDA- ARS (United States Department of Agriculture-Agricultural Research Service)의 수박 Germplasm Collection에서 보유 중인 ‘PI 189225’와 ‘PI 271778’ 등이 있는 것으로 보고되었으며(Sowell 1975, Sowell & Pointer 1962), 최근에는 덩굴마름병 저항성의 새로운 자원으로 ‘PI 279461’, ‘PI 526233’ 및 ‘PI 482283’ 등이 보고되었다(Gusmini et al. 2005). 그리고 ‘PI 189225’는 감수성인 ‘Chareston Gray’와 교배하여 나온 분리집단 분석을 통해 그 저항성이 단인자 열성 유전자인 db에 의해 조절된다고 보고되었지만(Norton 1979), 최근에는 그 저항성이 환경적인 요인에 의해 영향을 받는 다수의 유전자가 관여하고 있는 양적 형질로 보고하였기 때문에 명확한 유전양식 규명을 위한 후속 연구가 필요한 상황이다(Gusmini et al. 2017).

수박에서 병저항성을 가진 개체를 효율적으로 선발하고 육종에 필요한 시간을 줄이기 위해서 분자표지 개발과 응용에 관한 연구가 진행되고 있다. 수박 흰가루병 저항성 자원인 ‘Arka Manik’와 ‘PI 254744’를 이용하여 cleaved amplified polymorphic sequence (CAPS) 마커와 high-resolution melting (HRM) 마커가 개발되었다(Han et al. 2016, Kim et al. 2015). 또한 수박 덩굴쪼김병 race2에 대한 QTL mapping이 진행되었고, 수박에서 호박 노란 모자이크 바이러스(Zucchini Yellow Mosaic Virus, ZYMV) 저항성 관련 CAPS 분자표지가 개발되었다(Branham et al. 2017, Ling et al. 2009). 이와 같이 분자표지를 활용한다면 환경 요인을 배제한 유전자형을 분석할 수 있어 표현형 예측 시 정확도가 향상되며, 또한 일정한 기준이 적용되기 때문에 실험자에 따라 조사결과가 변동되지 않는 장점이 있다(Dudley et al. 1992, Lande & Thompson 1990).

최근 염기서열 해독 기술이 발달하고 비용이 저렴해지면서 염기서열 정보를 바탕으로 하는 단일염기다형성(single nucleotide polymorphism, SNP) 정보를 활용한 분자표지가 많이 개발되고 있다(Lee et al. 2013). 그리고 이 SNP 정보를 이용한다면 단일마커 분석에서 더 나아가 다수의 샘플에 대한 다수의 분자표지 분석이 이루어지는 고속대량 유전자형 분석시스템(high-throughput genotyping system)에 적용할 수 있다(Thomson 2014, Trebbi et al. 2011).

따라서 본 연구에서는 수박 덩굴마름병 감수성 및 저항성인 양친에 대해 차세대 염기서열 재분석(next generation resequencing)을 진행하여 유의미한 SNP를 선발하고, 이 정보를 바탕으로 HRM 분자표지를 개발하였다. HRM 분석 방법은 전기영동이 필요한 CAPS, SCAR, SSR 등의 분자표지 분석 방법보다 상대적으로 간편하고 결과를 신속히 확인할 수 있으며 분석 비용이 저렴하다(Wittwer et al. 2003). 이러한 HRM 분자표지를 활용하여 추후 수박 유전자 연관지도 작성 및 덩굴마름병 저항성 양적 형질 유전자좌(quantitative trait loci, QTLs) 분석 등을 위한 기초자료로 사용하고자 하였다.

재료 및 방법

식물재료

식물재료는 농촌진흥청 국립원예특작과학원 채소과 과채류연구실에서 2013년 수박 덩굴마름병 저항성 자원인 Citrullus amarus Schrad. ‘PI 189225’와 감수성 자원인 Citrullus lanatus (Thunb.) Matsum & Nakai ‘920533’을 분양 받았다(Fig. 1). 2014년에 ‘920533’을 모계로 사용하고 ‘PI 189225’를 부계로 사용하여 F1을 확보하였다. 2017년 5월에 F1을 자가수정하여 F2 종자를 채종하였으며, 11월에 F2 종자를 파종하여 F2 식물체 13개체의 잎을 채취하여 DNA 추출에 사용하였다.

Fig. 1.

Watermelon fruits of a susceptible line ‘920533’ (A) and a resistant line ‘PI 189225’ (B) to gummy stem blight.



덩굴마름병 저항성 검정

수박 덩굴마름병균 접종을 위해 감자한천배지(potato dextrose agar, PDA)를 제작하였다. 수박 덩굴마름병균 균주는 농촌진흥청 국립농업과학원 농업유전자원센터(Korean Agricultural Culture Collection, KACC)에서 분양 받은 수박 덩굴마름병균 KACC40937 (Didymella bryoniae)을 사용하였다. 본 균주의 균사 조직을 떼어 PDA 고체배지의 중앙에 접종하여 25°C 배양기에서 5일간 배양하였다. 수박 덩굴마름병균의 인공접종을 위한 분생포자 형성을 위해 12시간 광조건과 12시간 암조건으로 5일간 배양하였다. 인공접종을 위한 현탁액은 분생포자가 형성된 PDA 고체배지에 멸균수를 부어 포자를 회수하고, 이를 거즈로 걸러 제작하였다. 포자현탁액의 접종농도를 측정하기 위해 Hemocytometer (Marienfeld GmbH & Co. KG, Lauda-Konighofen, Germany)를 사용하여 4×105 cfu⋅mL-1 접종농도로 맞춰 저항성 검정에 사용하였다. 인공접종은 본엽이 2~3매가 전개된 식물체 1개체당 포자현탁액을 10 mL씩 분무하였고, 48시간 동안에 25~27°C 암상태에서 습실처리를 실시하였다. 이후 25°C 생장상에서 12시간 광조건으로 처리하였고, 접종 후 5일차부터 덩굴마름병의 발생 유무를 조사하였다(Lee et al. 2016). 감수성 자원인 ‘920533’ 20개체와 저항성 자원인 ‘PI 189225’ 20개체에 대해 각각 조사하였으며 저항성 정도는 본엽의 병반면적률을 계산하여 측정하였다.

식물 DNA 추출

수박 덩굴마름병 저항성 및 감수성 자원인 양친과 F1, 그리고 F2 13개체 식물체 각각으로부터 CTAB (cetyltrimethyl ammonium bromide) 방법을 이용하여 genomic DNA의 pellet을 확보하였다(Doyle & Doyle 1990). 그 후 70% Ethanol을 700 L 분주하고 12,000 rpm에 1분간 원심분리를 하면서 2번의 세척을 한 후, 50 L triply-distilled water (TDW)를 넣고 pellet을 녹인 다음 NanovueTM plus spetrophotometer (GE Healthcare, USA)를 이용하여 정량하였고, 추출된 genomic DNA는 20 ng⋅µL-1 농도로 맞추어 사용하였다.

차세대 염기서열 분석 및 SNP 탐색

수박 양친인 ‘920533’과 ‘PI 189225’의 어린잎에서 추출된 genomic DNA는 총 10 µg을 이용하여 차세대 염기서열 분석(next generation sequencing, NGS)을 수행하였다. 생물정보분석 업체인 마크로젠(Seoul, Korea)에 의뢰하여 전장유전체 염기서열 재분석(whole genome resequencing)을 실시하였다. 수박 표준유전체 정보는 박과 유전체 데이터베이스 홈페이지(http://www.cucurbitgenomics.org)에 공개된 C. lanatus subsp. vulgaris cv. 97103을 이용하였다(Guo et al. 2013). 수박 표준유전체의 추정된 크기는 425 Mbp이고, assembly된 정보는 약 355.2 Mbp로 전체 게놈의 약 83.6%를 차지하였으며 유전체 정보는 DNA 단편조각인 1,793개(353.5 Mbp)의 scaffold와 43,342개(321.4 Mbp)의 contig로 구성되어 있었다(Table 1).

Statistics of reference genome C. lanatus subsp.vulgaris cv. 97103.

Estimated genome size (Mbp) Genome assembly size (bp) Genome covered by assembly (%) Genome assembly size except ‘N’ base (bp) Number of scaffolds (Total length of scaffolds, Mbp) Number of contigs (Total length of contigs, Mbp)
425 355,247,419 83.6 321,373,230 1,793 (353.5) 43,342 (321.4)


Resequencing된 염기서열 데이터는 read 생성, 표준유전체에 정렬(alignment), SNP 탐색(variant calling), 기준에 의한 SNP 선발(filtering), HRM 프라이머 디자인의 단계를 거쳐 분석되었다. TruSeq DNA Nano Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA)를 활용하여 시퀀싱 라이브러리를 제작하였으며, Illumina Hiseq 4000(Illumina, Inc., San Diego, CA, USA)으로 염기서열을 분석하였다. 시퀀싱 결과 얻어진 raw reads의 quality 분석을 통한 전처리 과정을 진행하고 BWA (v.0.7.17) 프로그램을 이용하여 reference genome에 mapping한 후 정렬된 reads를 이용하여 SAMtools (v.1.6) 프로그램을 통한 SNP 탐색을 진행하였다(Li 2011, Li & Durbin 2009).

다음으로 ‘920533’과 ‘PI 189225’ 간의 탐색된 SNP 주위의 400 bp에 해당하는 flanking sequence (amplicon sequence) 정보를 확보하였다. 이 중에서 동형접합형(homozygous)인 것과 SNP 종류 중 A/T와 G/C를 제외한 A/G, A/C, T/G, T/C인 것, 그리고 수박 표준유전체에 BLASTN (v.2.7.1+)을 진행하여 copy number가 1개인 것, 그리고 genic region에 위치한 것만을 선발하였고(Zhang et al. 2000), 목표로 하는 SNP 부위를 증폭하는 high- resolution melting (HRM) 프라이머를 디자인하였다(Untergasser et al. 2012).

HRM 프라이머 제작 및 분석

HRM 반응액은 genomic DNA 2.0 L, 10x PCR buffer 2.0 L, 2.5 mM dNTP mixture 1.0 L, Taq DNA polymerase (Takara, Japan) 0.1 L, SYTO® 9 green fluorescent nucleic acid stain (Life TechnologiesTM, USA) 1.0 L, 선발된 HRM 프라이머 10 pmole⋅mL-1 농도로 forward와 reverse 각각 0.5 L, 멸균된 3차 증류수(TDW)로 총 20.0 L의 부피를 맞추었다. PCR 반응은 PCR machine (Eppendorf, Germany)을 이용하였으며, 98°C에서 2분간 denaturation을 수행한 후, 98°C에서 5초간 denaturation, 60°C에서 10초간 annealing 및 extension 과정을 40회 반복하였다. PCR 산물은 CFX96 TouchTM Real-Time PCR Detection System (Bio-rad, CA, USA)을 이용하여 70°C에서 94.6°C까지 0.3°C씩 온도를 올리면서 각 온도에서 SYTO 9의 형광을 측정하여 melting curve를 그렸고, Precision Melt Analysis 프로그램(Bio-Rad, CA, USA)를 사용하여 유전자형을 분석하였다. 온도 증가에 따른 형광 감소 그래프의 양상을 분석함으로써 다형성이 보이는 프라이머를 최종 선발하였다.

결과 및 고찰

덩굴마름병 저항성 검정

감수성 계통인 ‘920533’과 저항성 계통인 ‘PI 189225’에 대해 유묘 상태에서 각 20개체씩 덩굴마름병 저항성 검정을 실시한 결과, ‘PI 189225’의 병반면적률 평균은 약 14.04%였으며, ‘920533’의 평균은 약 73.73%이었다. F-검정에서 두 집단의 분산이 등분산이 아니었기 때문에, 이분산을 가정한 t-검정을 실시하였으며 그 결과 p<0.001으로 감수성 계통과 이병성 계통에서 유의성이 있는 것으로 나타났다(Fig. 2). 저항성 계통인 ‘PI 189225’의 경우 감수성 계통인 ‘920533’보다 확연히 뚜렷한 병징이 나타나지 않았는데, 이는 Sowell (1975)이 수박 상업 품종과 PI 자원에 대해 덩굴마름병을 접종하여 ‘PI 189225’가 저항성임을 보고한 결과와 일치하는 것이었다.

Fig. 2.

Comparison of resistance to Didymella bryoniae between resistant (‘PI 189225’) and susceptible (‘920533’) watermelon lines. % lesion area means the ratio of gummy stem blight lesion area to total leaf area. Bars on graphs indicate standard error. Three asterisks indicates that the susceptible cultivar represents significantly different values to the resistant cultivar. (Student’s t-test; p<0.001).



양친의 NGS 대량 염기서열 분석

수박 유전체 전체를 커버하는 분자표지를 개발하기 위해 양친인 ‘920533’과 ‘PI 189225’를 NGS resequencing한 결과, ‘920533’은 총 17.8 Gbp의 염기서열을, ‘PI 189225’는 총 16.8 Gbp의 염기서열을 해독하였다(Table 2). 이 염기서열에서 필요 없는 부분을 잘라낸(trimming) 결과, ‘920533’은 총 13.6 Gbp, ‘PI 189225’는 총 13.1 Gbp의 염기서열이 남았다(Table 2). 이는 assembly된 수박 표준유전체 길이인 약 355.2 Mbp의 각각 약 38.28배(‘920533’) 및 약 36.80배(‘PI 189225’)에 해당한다(Table 2). 또한 실제 NGS resequencing에 사용한 염기는 ‘N’ 염기를 제외한 약 321.4 Mbp를 사용하였다(Table 1). Trimmed data를 이용하여 수박 표준유전체 염기서열에 mapping한 결과, ‘920533’은 표준유전체의 약 90.13%인 320 Mbp를, ‘PI 189225’는 약 85.92%인 305 Mbp를 커버하였다(Table 2).

Statistics of raw reads, trimmed reads, and mapped reads obtained from next generation resequencing data.

Plant material Use Raw reads Total reads Mapped reads



Total length (bp) Total length (bp) Trimmed/Raw Genome coverage The number of mapped reads (The ratio of mapped reads, %) Mapped region of reference genome (bp) Reference genome coverage (%)
‘920533 Female parent 17,762,375,526 13,598,385,369 ≒0.77 ≒38.279 80,972,784 (80.0) 320,192,188 90.13
‘PI 189225’ Male parent 116,791,415,024 13,071,171,856 ≒0.78 ≒36.795 87,354,113 (89.84) 305,232,561 85.92


대량 SNP 탐색 및 HRM 프라이머 제작

해독된 염기서열을 바탕으로 ‘920533’과 ‘PI 189225’ 간의 SNP를 탐색한 결과, 총 SNP 수는 6,086,851개였다(Table 3). 이는 C. lanatus 종 내의 SNP 개수보다 많은 것인데, 그 이유는 ‘PI 189225’가 분류학상으로 유연관계가 먼 C. amarus이기 때문에 종 간의 유전적 차이에 의한 것으로 생각된다.

Summary of single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM) primer sets between watermelon lines ‘920533’ and ‘PI 189225’.

Raw SNP The number of homozygous SNP The number of HRM candidate The number of HRM recommended (single copy)

Total Intergenic region Genic region (HRM primer sets designed)
6,086,851 5,113,361 4,332,440 2,026,130 1,671,270 354,860


앞서 발굴한 6,086,851개의 SNP는 그 수가 매우 많아 모두 분자표지로 활용하는 것은 어렵기 때문에, 본 연구에서는 덩굴마름병 저항성 연관 수박 유전자지도 작성 방법을 제시하기 위해 분자표지를 일부 선발하여 분석에 이용하였다. 양친 계통에서 모두 동형접합형(homozygous)인 SNP는 5,113,361개였으며, 그 중에서 HRM 프라이머 제작 시 melting curve 간에 서로 구분이 잘되는 염기서열 조합인 A/G, A/C, T/G 및 T/C 조합만 선발하였는데 4,332,440개였다(Table 3). 다음으로 SNP 주위의 flanking sequence가 전체 genome에서 1개의 copy만이 존재하는 SNP는 2,026,130개였고, genic region에 존재하는 것은 354,860개였다(Table 3). 이 중에서 수박의 각 염색체 별로 고르게 선발하여 최종 330개의 HRM 프라이머 쌍을 제작하였다(Supplementary Fig. 1).

HRM 분석 및 다형성 있는 프라이머 선발

330개의 HRM용 프라이머 쌍을 이용하여 HRM 분석을 진행하였는데, 프라이머 쌍 1개당 감수성 계통인 ‘920533’과 저항성 계통인 ‘PI 189225’와 F1 개체, 그리고 F2 13개체 총 16개의 genomic DNA 시료를 사용하여 분석하였다. 프라이머 쌍 중 61개는 Fig. 3에서와 같은 melting curve 패턴을 나타내어 다형성(polymorphic)을 보이는 분자표지로 이용할 수 있었고, 나머지 269개는 다형성이 나타나지 않는 단형성(monomorphic)을 보였거나 두 개 이상의 위치에서 증폭되어 melting curve가 복잡해져 분자표지로 활용할 수 없었다(Table 4). 본 연구에서 수박 표준유전체 정보가 불완전한 부분이 있어 게놈상 다른 부위에서 동일한 flanking sequence 지점이 존재해 다수의 증폭을 완전히 없애지 못하였기 때문인 것으로 생각된다. 또한 melting curve가 다형성(polymorphic)을 나타내었지만 melting temperature 차이가 거의 없어서 유전자형 분석이 매우 어려울 것으로 예상되는 SNP를 제외하였기에 최종 선발된 SNP 수가 적었다. 제작한 330개의 HRM 분자표지의 염색체 상의 위치는 MapChart (v.2.3)를 이용하여 Supplementary Fig. 1와 같이 물리적 지도에 위치하여 표시할 수 있었다.

Fig. 3.

Melting curves of two HRM markers, WGRS095 (A, C) and WGRS240 (B, D), developed in this study. A and B present the form of normalized melt curve, while C and D show us the image of difference curve. a, Plants of ‘920533’ genotype; b, Plants of ‘PI 189225’ genotype; h, Heterozygous plants.


List of 61 SNP markers that were developed into HRM marker type. These markers were polymorphic between ‘920533’ and ‘PI 189225’ using HRM analysis.

Marker namez Chromosome SNP position (bp)y Forward primer (5’→3’) Reverse primer (5’→3’)
WGRS002 1 1,043,418 GGTGGTACCCAATTTGTCCCT AACAGGAAGCCGGCTAGAAA
WGRS006 1 3,819,913 GCGATCAAGAGACAAACGGG TGCGAAGGATGCTTGGTTCT
WGRS011 1 9,325,855 AGGTGCTTAGGAGGTGGAGA CCGCCATGAGAGGAGGTTAG
WGRS017 1 20,202,103 ACGGCAAGCAGTGAAGGTAT GGGGAGAGATGATCGAGCAC
WGRS018 1 22,049,812 TGGGAACTGAGAAGACTGCC GACTTCCACTTCCAACCCCT
WGRS028 1 30,705,477 TGGATATTCCCTCGCTCCAA TTGCTGCTCTTCAAATGGGC
WGRS030 1 33,601,876 GGACAAACCTGGCCCACTAA TCGAAAAGCAGCAGAGGCA

WGRS039 2 13,988,030 AACGGAGCTAATCGACGACC ACAAGGCCCAAGAGATTTAGGA
WGRS046 2 26,782,186 GCCCTGTCAGTGAACCATCA ACAGACCTGAGAATCACTAGCT
WGRS048 2 29,195,322 AGCGTGTGGTTTTGACTTGAG AGATGTAATGCGATGCAGTTGC

WGRS054 3 3,074,543 CGTCTCCAACTCCATCTCCG CTGAGGGGGTTGATGACGAG
WGRS061 3 11,069,946 GTGGGAGGGGAAAACGGATT CATTTTCTTCGGAGCTGGCG
WGRS066 3 20,298,449 TGCAGCCCATGAAAGTGCTA GTGTTTATTGTTCCGCCAGCT
WGRS072 3 25,926,099 GCTCTTCCATTGCTCCTGGA GCAGGGTTCTATGGTCGAGT
WGRS074 3 26,809,484 CGCTATCAGCCGACAAAAGC TCGAGGAAGCTTGCACCAAT

WGRS091 4 5,970,325 TGTGCTGATTGTGGACCTCC AGCTTGCTCATTCCTCTCGT
WGRS095 4 8,233,892 GGTGGCCTCACTATTACCGG GGTTTAGAGGTGGAAGGGGTG
WGRS098 4 10,824,802 TAAGACCCAACCGAACTGCC GCAGGCTGCTCTAACAAAGC
WGRS100 4 13,147,227 TGGTAGAAAATGGCAACGCG GATCAAGGACGGGAATGGGA
WGRS101 4 15,102,363 GGCAAAAGCAGACCCTGTTG CCAGTTCCACCAAGCAAACC
WGRS107 4 17,910,257 TGCCAAGAGAATGCAACACG ATGGAGGACATTGCTTGCCA

WGRS121 5 1,577,748 GGGGTTCCATTCCCTAAGGG GGCGAGATGGTCAAACTCCT
WGRS122 5 2,108,735 AGAACCCCCAACCAAAGCTT TCCCCTGCCTTTGCTTGATT
WGRS124 5 4,255,857 CCAGGCATCCAATCGAGGAA CGTCCATAAAGTTGTGGCCC
WGRS126 5 6,580,137 AGTCCGTTGTCCAGTTTCGA AACAGTAGCCCAAGAGCTGG

WGRS148 6 36,471 GTGCTGCTCCTGGTCTCTAA ACTCAATGGGTGCTTGTGGT
WGRS151 6 1,670,897 GCCATTTGATTCCTCACCGC GAGCTGCCCGTAATGCAATG
WGRS152 6 2,870,018 GCTGCGATCGTGTTCACATC CAGAGGCCAAGACCCAGAAT
WGRS170 6 18,074,367 GCTGTGCTTCTTGTGGCAAA AGAGAACATCAACACGGCGT
WGRS171 6 19,159,722 AGAGCTTTTCGTCATGGCCA TCCAGGTTTGGTTTCCGACA
WGRS172 6 20,013,243 TAGGTCAGCCCTCCCTCAAA CGTTCGAGTAATCCTCCGGG
WGRS174 6 21,093,377 TGGAGTGTTTGACTGTGGGG TCTCCATCTCCAGCCATCCT
WGRS177 6 22,055,693 AAGTGGCAATACCTGACCCC ACTACTCTGCAGCTCATGGC
WGRS186 6 26,890,432 CCTGCTTGTGGACCTGGAAT GCAACCATGCGCACATAACT

WGRS190 7 3,830,477 ATCCGCAGATTCACAGGGAG GGCGCTTAAATCTGGTTCCC
WGRS194 7 6,714,580 CGTTGTTTGCAAGCTCCCAA GCCTCCGCTTCCGATTCTTA
WGRS200 7 16,377,893 AGAATCTTGCCACCTTAGGG TCGGTGGTGACTGAGAAACA
WGRS203 7 21,480,403 AATTGGAGGGTCAAGGGGTG TGCTCGTTTCATCAAAAGCCA
WGRS208 7 26,134,906 TGGGCTACATTGTTCTGCCT GCTTCAAGTTTCCTTGCCTGT
WGRS209 7 27,405,979 TGGTGGTGGAGGCAATCAAA GGGGGTTATGCCTGAAACAA
WGRS212 7 30,620,572 TGCTTGGGTTGTATCACTGACA TGGTGTGGCAGGTAATTGGA
WGRS213 7 31,054,142 AATTCTTTGCGCACTCGTGG ATCCACTCTGAGCAATTGGC

WGRS220 8 7,024,617 AACAGTCAACACCCAGCCTT TTGAGGTGGTCTTTCCGAGC
WGRS221 8 7,889,760 GTGACAACCAAGCAGCACTG TCCTGCCCAACTTGTTCCTC
WGRS225 8 10,733,107 CTTCTGCCATTAAACGCCCA GGGTTCAATCATTGTGGTCACC
WGRS226 8 11,279,464 TGCTGGCCCCACTCAATAAA AGGACCGGGTCTCAATCTCA
WGRS227 8 11,656,539 AGTTCTAACGACACGAGGGC TTGTACCAGACTGCGAGCAA
WGRS229 8 15,003,269 CCTTGTGCAACCAAAGCTGT GACAGCGGTTGCATCAGTTC
WGRS233 8 17,637,101 GTAGACACTCTTAGCCGGGC TCCTGCATTGTGTGGTTCCA
WGRS235 8 18,473,596 ACTGTGTGCACTCACCTGTT CGGACATCTGCTGAGGAGTT
WGRS240 8 20,663,001 ACGGCTGGTCTCATGTTCAA TAGGGTTTGGTGCTGGTGAC

WGRS254 9 4,555,267 TGGCTAACCATGGGTTGCAT AGTTTGTTCCAGCGCCATTG
WGRS263 9 16,573,290 GAGTGCTGATGGAAGCTGGA TGCTCCATATGGAAGCAAGTCA
WGRS271 9 29,654,845 TGCACATTGTGTCACTCTACGA CATTGCCTAGAATTTGCCGGG
WGRS272 9 30,799,073 CTAGATTCCTGCGGATGCCT ACCCATACCTTCTCGCGAAA

WGRS281 10 6,101,884 GCCGGTAGTTTCTGACCCAA AGGTTCAAGAAGTGGCGGAG
WGRS287 10 14,082,501 ACAATGCCTCCACCTTTCCA GTAGCAGCAACAGTGGCAAA
WGRS297 10 27,692,702 TGGCAGTGTTGTACTTGGGT AGGGCTTGGAGACTTTTGCA

WGRS307 11 6,959,074 GAGGGTGAGTTTCTGGTGGG CACGCACACTTCACGCTTAA
WGRS316 11 14,891,680 GTGCCTCTGCTTCTCAGGTT TGGCAGTTTTAGGCTTTTCAGT
WGRS326 11 24,272,773 CAGGTTCCTGAAGCAGCTGA GCTGAATCTACCAGGCAACA

SNP (HRM) markers developed in this study and WGRS is the abbreviation for watermelon gummy stem blight resistance SNP.

Position of SNP on reference genome.



이전에 수박 덩굴마름병 저항성 관련하여 동일한 양친 재료를 바탕으로 HRM 분자표지를 선발한 연구가 있었다(Lee et al. 2015). 하지만 이 연구에서는 GS FLX 454 Titanium (Roche, Basel, Switzerland) NGS 분석으로 읽어낸 염기서열이 길이가 최대 73 Mbp이었기 때문에 데이터 크기가 매우 작았으며, 이로 인하여 충분한 수의 SNP를 발굴하지 못하였다. Rotor-Gene Q Real-Time PCR machine system (Qiagen, Venlo, Netherlands)을 이용한 HRM 분석을 통해 다형성을 보이는 14개의 SNP를 확인하였지만, 오직 양친 genomic DNA에 대해서 적용을 하였고 F1과 F2 개체에 적용을 하지 않아 집단 개체에 대해 유전자형 분석이 가능한 HRM 프라이머 쌍은 더욱 줄어들 수 있었다. 따라서 충분한 수의 SNP 정보를 확보하고 보다 대량의 HRM 프라이머 쌍을 제작하여 다형성 있는 분자표지를 개발하는 것이 차후에 유전자지도를 작성하는 것에 도움이 될 것이라 판단하였다.

본 연구를 통해 수박 덩굴마름병에 감수성 자원과 저항성 자원을 NGS resequencing 함으로써 HRM 분자표지로 활용할 수 있는 61개의 프라이머 쌍을 최종 선발할 수 있었다. 해당 HRM 분자표지를 활용하여 F2 178개체 전체에 대하여 유전자형 분석을 진행하고, 분자표지 간의 거리를 계산하여 유전자지도를 작성할 수 있을 것이다. 또한 기존에 HRM 형태 이외에 다른 형태로 개발된 분자표지를 추가하여 유전자지도를 통합할 수도 있을 것이다. 더 나아가 F2 분리집단 개체에 대해 덩굴마름병 병저항성 검정을 실시하여 정확한 표현형을 측정한다면 덩굴마름병 저항성과 관련된 QTL 분석을 수행하는 데 유용하게 활용될 수 있을 것이다.

적 요

수박(Citrullus lanatus)은 전세계에서 경제적으로 중요한 채소작물이며, 라이코펜과 시트룰린과 같은 기능성 물질을 함유하고 있다. Didymella bryoniae 병원균에 의해 발생하는 덩굴마름병은 수박 재배에서 가장 피해를 많이 주는 병해 중에 하나이다. 단일염기다형성(SNP)은 한 개 염기에 관해 개체 간에 발생하는 유전적 변이로서 유전자 연관 지도를 작성하는 것과 원예적 형질 및 병저항성에 연관된 분자표지를 개발하는 데 자주 사용된다. 본 연구에서는 수박에서 모친과 부친의 차세대 염기서열 재분석(next generation resequencing)을 통해 SNP 분자표지를 선발하였다. 식물재료는 C. lanatus ‘920533’(모친, 감수성)과 C. amarus ‘PI 189225’(부친, 저항성) 및 이들의 F1, F2 개체를 이용하였다. NGS 분석 결과, ‘920533’과 ‘PI 189225’에서 각각 13.6 Gbp와 13.1 Gbp의 염기서열을 얻었다. ‘920533’과 ‘PI 189225’ 간의 SNP 수는 609만 개였고, 그 중 HRM 프라이머로 디자인이 가능한 SNP의 수는 354,860개였다. 그 중에 HRM 분석을 위한 330개 프라이머 쌍이 디자인되었다. 결과적으로 HRM 분석을 통해 총 61개의 HRM 분자표지를 개발하였다. 이번 연구의 결과는 SNP 기반의 유전자지도 작성에 이용될 수 있으며 덩굴마름병 저항성과 연관된 양적 형질 유전자좌(QTL) 분석에 활용될 수 있을 것이다.

보충자료

본문의 Supplementary Fig. 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

사 사

본 논문은 농촌진흥청 연구사업(과제번호: PJ00926101)의 지원에 의해 이루어졌습니다.

Supplementary
References
  1. Branham SE, Levi A, Farnham MW, and Wechter WP. A GBS-SNP-based linkage map and quantitative trait loci (QTL) associated with resistance to Fusarium oxysporumf. sp niveum race 2 identified in Citrullus lanatusvar citroides. Theor Appl Genet 2017;130:319-330.
    Pubmed CrossRef
  2. dos Santos GR, Sousa SCR, Juliatti FC, Rodrigues AC, Dalcin MS, and Bonifacio A. Control of gummy stem blight in watermelon through different management systems. Biosci J 2016;32:371-377.
    CrossRef
  3. Doyle JJ, and Doyle JL. Isolation of plant DNA from fresh tissue. Focus 1990;12:13-15.
  4. Dudley JW, Maroof S, and Rufener GK. Molecular marker information and selection of parents in corn breeding. Crop Sci 1992;32:310-304.
    CrossRef
  5. Food and Agriculture Organization of the United Nations. Food and agriculture data 2016. http://www.fao.org/faostat/en/#data
  6. Guo S, Zhang J, Sun H, Salse J, Lucas WJ, Zhang H, Zheng Y, Mao L, Ren Y, Wang Z, Min J, Guo X, Murat F, Ham BK, Zhang Z, Gao S, Huang M, Xu Y, Zhong S, Bombarely A, Mueller LA, Zhao H, He H, Zhang Y, Zhang Z, Huang S, Tan T, Pang E, Lin K, Hu Q, Kuang H, Ni P, Wang B, Liu J, Kou Q, Hou W, Zou X, Jiang J, Gong G, Klee K, Schoof H, Huang Y, Hu X, Dong S, Liang D, Wang J, Wu K, Xia Y, Zhao X, Zheng Z, Xing M, Liang X, Huang B, Lv T, Wang J, Yin Y, Yi H, Li R, Wu M, Levi A, Zhang X, Giovannoni JJ, Wang J, Li Y, Fei Z, and Xu Y. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nature Genetics 2013;45:51-60.
    Pubmed CrossRef
  7. Gusmini G, Rivera-Burgos LA, and Wehner TC. Inheritance of resistance to gummy stem blight in watermelon. HortScience 2017;52:1477-1482.
    CrossRef
  8. Gusmini G, Song R, and Wehner TC. New sources of resistance to gummy stem blight in watermelon. Crop Sci 2005;45:582-588.
    CrossRef
  9. Han BK, Rhee SJ, Jang YJ, Sim TY, Kim YJ, Park TS, and Lee GP. Identification of a causal pathogen of watermelon powdery mildew in Korea and development of a genetic linkage marker for resistance in watermelon (Citrullus lanatus). Korean J Hortic Sci Technol 2016;34:912-923.
  10. Kim JY, Lee SH, Hwang SJ, Kim GH, and Eun JB. Physicochemical characteristics and functional components of Mudeungsan watermelon and the other cultivars from Korea. Korean J Food Sci Technol 2013;45:345-349.
    CrossRef
  11. Kim KH, Hwang JH, Han DY, Park M, Kim S, Choi D, Kim Y, Lee GP, Kim ST, and Park YH. Major quantitative trait loci and putative candidate genes for powdery mildew resistance and fruit-related traits revealed by an intraspecific genetic map for watermelon (Citrullus lanatusvar lanatus). PLOS ONE 2015;10:e1-e18.
    Pubmed KoreaMed CrossRef
  12. Kwon MK, Hong HJ, Sung KY, Cho BH, and Kim KL. Standardization of a mass-production technique for pycnidiospores of Didymella bryoniae gummy stem blight fungus of Cucurbits. Korea J Plant Pathol 1997;13:105-112.
  13. Lande R, and Thompson R. Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics 1990;124:743-756.
    Pubmed KoreaMed
  14. Lee HY, Hong JP, Suh HY, Huh YC, Ahn YK, Kim JH, and Kim DS. Survey of SNP markers based on genome related to gummy stem blight resistance in watermelon. J Agr Sci Chungbuk Nat'l Univ 2015;31:107-113.
  15. Lee J, Park SJ, Do JW, Han JH, Choi D, and Yoon JB. Development of a genetic map of chili pepper using single nucleotide polymorphism markers generated from next generation resequencing of parents. Korean J Hortic Sci Technol 2013;31:473-482.
    CrossRef
  16. Lee JH, Jang KS, Choi YH, Kim JC, and Choi GJ. Development of an efficient screening system for resistance of watermelon plants to Didymella bryoniae. Res Plant Dis 2016;22:72-80.
    CrossRef
  17. Li H, and Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 2009;25:1754-1760.
    Pubmed KoreaMed CrossRef
  18. Li H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 2011;27:2987-2993.
    Pubmed KoreaMed CrossRef
  19. Ling KS, Harris KR, Meyer JDF, Levi A, Guner N, Wehner TC, Bendahmane A, and Havey MJ. Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to Zucchini yellow mosaic virus. Theor Appl Genet 2009;120:191-200.
    Pubmed CrossRef
  20. Lou L, Wang H, Qian C, Liu J, Bai Y, and Chen J. Genetic mapping of gummy stem blight (Didymella bryoniae) resistance genes in Cucumis sativus-hystrix introgression lines. Euphytica 2013;192:359-369.
    CrossRef
  21. Maynard DN, and Hopkins DL. Watermelon fruit disorders. HortTechnology 1999;9:155-161.
    CrossRef
  22. Norton JD, Boyhan G, Smith DA, and Abrahams BR. 'AU-Sweet Scarlet'watermelon. HortScience 1995;30:393-394.
  23. Norton JD. Inheritance of resistance to gummy stem blight caused by Didymella bryoniae in watermelon. HortScience 1979;14:630-632.
  24. Skarshaug AJ. Centrum development in Didymella bryoniae. Am J Bot 1981;68:1096-1103.
    CrossRef
  25. Sowell G, and Pointer GR. Gummy stem blight resistance introduced watermelons. Plant Dis Rep 1962;46:883-885.
  26. Sowell G. An additional source of resistance to gummy stem blight in watermelon. Plant Dis Rep 1975;59:413-415.
  27. Thomson MJ. High-throughput SNP genotyping to accelerate crop improvement. Plant Breed Biotech 2014;2:195-212.
    CrossRef
  28. Trebbi D, Maccaferri M, de Heer P, Sorensen A, Gluliani S, Salvi S, Sanguineti MC, Massi A, van der Vossen EAG, and Tuberosa R. High-throughput SNP discovery and genotyping in durum wheat (Triticum durumDesf.). Theor Appl Genet 2011;123:555-569.
    Pubmed CrossRef
  29. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, and Rozen SG. Primer3-new capabilities and interfaces. Nucleic Acids Res 2012;40:e115-e115.
    Pubmed KoreaMed CrossRef
  30. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, and Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clinic Chem 2003;49:853-860.
    Pubmed CrossRef
  31. Wolukau JN, Zhou XH, Li Y, Zhang YB, and Chen JF. Resistance to gummy stem blight in melon (Cucumis meloL.) germplasm and inheritance of resistance from plant introductions 157076, 420145, and 323498. HortScience 2007;42:215-221.
  32. Zhang Z, Schwartz S, Wagner L, and Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol 2000;7:203-214.
    Pubmed CrossRef


June 2019, 51 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information