Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 4.

Characteristics of newly developed 17 InDel markers using the whole genome re-sequencing data from 6 Korean malting barley varieties.

Primer InDel
Position
Forward primer (5'-3') Reverse primer (5'-3') InDel
size
Expected product size (bp) PIC
50BH1H-2 1H (10,961,973) CACCCTGCATGAAAGAAAGTATG TCCTACATGTTCATAGAGCCATG -62 308 0.373
BH7H-2 7H (7,591,851) CTTGAAATCGGTATGAACAACCC TTAGAGCAAGTTAACTAGGGCTT -55 435 0.160
HH1H-9 1H (529,911,805) TTCATGGCTGCTATCCTTACAAT ATATCCTTGTAGCCAGTCCTTTC -76 358 0.289
HH4H-3 4H (4,226,207) GACTCTTGATCAACGATCGATCT GAAACTTAGGCGGTAGTTGGATA +59 438 0.353
HP1H-5 1H (267,927,828) TTTGCAAGACGTTACATTCATCG CTGTCCCATATACTCATGAGCAA -61 411 0.234
50HP5H-1 5H (7,476,116) TATAGGAAACGCTGAGATGTGAC AAACCAGTTCCTTGTATCACTCC -87 300 0.263
50HP5H-2 5H (15,653,913) TCCGTCCTCTATGCCTATGAATA GCGTCATGATATATGAGCATCTATG -58 353 0.327
50JY7H-2 7H (3,690,102) TCACACTCCCTTACCTCATAGAT GCTTGGCAGACTTAATTTACCAG -50 338 0.362
GM1H-10 1H (342,831,132) CAAGGATCTAAGCAAACATGCAA GATTAATCCAACGGTCATTGTGG -60 396 0.263
GM1H-17 1H (455,796,748) CTAGGGATATTCTGATCGGTTGG TTAGCATGCCTCAATCATACCAT +54 425 0.362
50GM4H-3 4H (38,957,934) ATCCTTATAAGTCATGCTCTGCC TGCATCCAACACTTCATGTCATC +73 356 0.160
GM6H-30 6H (383,582,843) GGAGAAGTCATCTTGTAAAGCCA CTCATGAGCATAAGTGATCCAGT -50 376 0.060
50GM6H-4 6H (48,302,999) AAATTCCTCCTACTGAACTGAGC GTGGAAATGAACTTGTTGGTGGT +54 320 0.342
NM3H-28 3H (400,954,841) TGACCAATGTTGTGATTGACAAA TCCTAAGGCTCCCTAGTTCAATA -81 419 0.200
NM3H-36 3H (517,324,260) GGGAGCACAAGATAACACCATTA TAAGCTGAAACCTCCTTGAAAGT -63 375 0.234
NM5H-3 5H (516,751,365) AACAATGACCACAACACTATTGC AAATGGAAGGAAAGCTGCTATAA -87 348 0.327
NM5H-6 5H (523,703,745) GATAGTATTAGGAGTTGCTCGCA CCGAAGAGACATGTACATTTGTT -53 365 0.160
Korean J. Breed. Sci. 2021;53:266-76 https://doi.org/10.9787/KJBS.2021.53.3.266
© 2021 Korean J. Breed. Sci.