Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 2.

List of used SSR marker primers in this study. Each primers were designed as described in Balfourier et al. (2007).

Primer Forward (5'→3') Reverse (5'→3')
Xgwm2-3A CTGCAAGCCTGTGATCAACT CATTCTCAAATGATGGAACA
Xgwm5-3A GCCAGCTACCTCGATACAACTC AGAAAGGGCCAGGCTAGTAGT
Xgwm11-1B GGATAGTCAGACAATTCTTGTG GTGAATTGTGTCTTGTATGCTTCC
Xgwm44-7D GTTGAGCTTTTCAGTTCGGC AGTGGCATCCACTGAGCTG
Xgwm46-7B GCACGTGAATGGATTGGAC TGACCCAATAGTGGTGGTCA
Xgwm99-1A AAGATGGACGTATGCATCACA GCCATATTTGATGACGCATA
Xgwm120-2B GATCCACCTTCCTCTCTCTC GATTATACTGGTGCCGAAAC
Xgwm135-1A TGTCAACATCGTTTTGAAAAGG ACACTGTCAACCTGGCAATG
Xgwm149-4B CATTGTTTTCTGCCTCTAGCC CTAGCATCGAACCTGAACAAG
Xgwm196-6A ACCACTGCAGAGAACACATACG GTGCTCTGCTCTAAGTGTGGG
Xgwm186-5A GCAGAGCCTGGTTCAAAAAG CGCCTCTAGCGAGAGCTATG
Xgwm190-5D GTGCTTGCTGAGCTATGAGTC GTGCCACGTGGTACCTTTG
Xgwm219-6B GATGAGCGACACCTAGCCTC GGGGTCCGAGTCCACAAC
Xgwm233-7A TCAAAACATAAATGTTCATTGGA TCAACCGTGTGTAATTTTGTCC
Xgwm234-5B GAGTCCTGATGTGAAGCTGTTG CTCATTGGGGTGTGTACGTG
Xgwm251-4B CAACTGGTTGCTACACAAGCA GGGATGTCTGTTCCATCTTAG
Xgwm257-2B AGAGTGCATGGTGGGACG CCAAGACGATGCTGAAGTCA
Xgwm260-7A GCCCCCTTGCACAATC CGCAGCTACAGGAGGCC
Xgwm261-2D CTCCCTGTACGCCTAACGC CTCGCGCTACTAGCATTG
Xgwm272-5D TGCTCTTTGGCGAATATATGG GTTCAAAACAAATTAAAAGGCCC
Xgwm285-3B ATGACCCTTCTGCCAAACAC ATCGACCGCGATCTAGCC
Xgwm312-2A ATCGCATGATGCACGTAGAG ACATGCATGCCTACCTAATGG
Xgwm337-1D CCTCTTCCTCCCTCACTTAGC TGCTAACTGGCCTTTGCC
Xgwm372-2A AATAGAGCCCTGGGACTGGG GAAGGACGACATTCCACCTG
Xgwm400-7A GTGCTGCCACCACTTGC TGTAGGCACTGCTTGGGAG
Xgwm413-1B TGCTTGTCTAGATTGCTTGGG GATCGTCTCGTCCTTGGCA
Xgwm415-5A GATCTCCCATGTCCGCC CGACAGTCGTCACTTGCCTA
Xgwm427-6A AAACTTAGAACTGTAATTTCAGA AGTGTGTTCATTTGACAGTT
Xgwm437-7D GATCAAGACTTTTGTATCTCTC GATGTCCAACAGTTAGCTTA
Xgwm469-6D CAACTCAGTGCACACACAACG CGATAACCACTCATCCACACC
Xgwm480-3A TGCTGCTACTTGTACAGAGGAC CCGAATTGTCCGCCATAG
Xgwm539-2D CTGCTCTAAGATTCATGCAACC GAGGCTTGTGCCCTCTGTAG
Xgwm566-3B TCTGTCTACCCATGGGATTTG CTGGCTTCGAGGTAAGCAAC
Xgwm610-4A CTGCCTTCTCCATGGTTTGT AATGGCCAAAGGTTATGAAGG
Xgwm626-6B GATCTAAAATGTTATTTTCTCTC TGACTATCAGCTAAACGTGT
Xgwm642-1D ACGGCGAGAAGGTGCTC CATGAAAGGCAAGTTCGTCA
Xgwm664-3D CAGTCAGTGCCGTTTAGCAA AGCTTTGCTCTATTGGCGAG
Korean J. Breed. Sci. 2021;53:277-88 https://doi.org/10.9787/KJBS.2021.53.3.277
© 2021 Korean J. Breed. Sci.