Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 3.

Descriptions of candidate DEGs and primer design for gene expression analysis

Genes
(Assembled transcripts)
Gene description Forward (5' → 3') Reverse (5' → 3') Tm
K1 vs KM1 Up-regulation DEGs
Keumgang1SL003317t014 PROLM24 - Prolamin precursor AGCAGCAAGGGCAAAGTTTC TGTCATGGGGATGCTGTAGATG 60℃
Keumgang1SL001254t019 beta-amylase GCCCTTCTCGAATTTGTTGTCG ACGCAAGCCAGTGTTTGTAG 60℃
Keumgang1SL095837t001 ANAC087, Arabidopsis NAC domain containing protein 87 TCGTCAACCCACATTGCATG TATTGGAAGCGGCATTTGCG 60℃
Keumgang1SL002056t010 MFT, PEBP family protein AACAGCACCAGCACGTAGC TGGCTGGTGGTTAACATACCTG 60℃
Keumgang1SL008016t001 Serine protease inhibitor, potato inhibitor I-type family protein AGCAAGCTTGATGTGCATGG GGAAAGTACATCCATGGCATGC 60℃
Keumgang1SL001264t011 ATCRA1,CRA1,CRU1, RmlC-like cupins superfamily protein AGTGGTGTAGATGCTTGTAGCC TGGCACAACTGTTTGGCATG 60℃
Keumgang1SL034539t010 Tubby-like F-box protein AAAGATGTCGTCGCTTGTGC CGACACCGGAAAAGTGAGTTTC 60℃
Keumgang1SL011205t005 ATSUC3,ATSUT2,SUC3,SUT2, sucrose transporter 2 ACCTTGCACAGTGTTGTTGG TCTGCATTGCTGTTGTGGTC 60℃
K1 vs K7 Up-regulation DEGs
Keumgang1SL003578t009 Starch branching enzyme 2.2 GCTCTGATGTTTGGTGGACATG TTCCGCTTTTTCCTCAACGC 60℃
Keumgang1SL001971t019 BETA-VPE,BETAVPE, vacuolar-processing enzyme precursor TCGCCAAAAACGACCTCAAC AGTAACCGCGGTTTTGTTCC 60℃
Keumgang1SL003424t003 fatty acid hydroxylase TTTCCAGTTCTCCCTCCATTCG ATTTGACGGTTCCCACATGC 60℃
Keumgang1SL014234t009 4-alpha-glucanotransferase TGCTGGTTTTTGGGCAGTTC ACAGCTTTGAACAGCGCATC 60℃
Keumgang1SL007804t008 ACT domain containing protein TATTGCGGAGATTGAGGGCTAC TTGCATTTGAGGCTCGCAAG 60℃
Keumgang1SL000284t005 AtCOR47,COR47,RD17, cold-regulated 47 CAAACACAACACACGCCAAC TGCCTGGTTACCACAAGACAG 60℃
Keumgang1SL004791t001 thiaminC, thiamine biosynthesis protein TGTGTGGTCCCAAGTTTTGC AGCTTCACCATGTTGTTCGC 60℃
Keumgang1SL038902t003 CAMK includes calcium/ calmodulin depedent protein kinases AGAACCTCATGTCCATGTACCG TTCCAAGAGAGGGTTCGGAATG 60℃
Keumgang1SL007502t020 zinc finger, C3HC4 type domain containing protein ACAATGGGCATGCCAAATGG ACATTGCTTTGACGCTGAGG 60℃
Keumgang1SL000284t005 aldehyde dehydrogenase AACCACTTTGACTGCAGTGC ATGCTTGCATTGTGCTGGAC 60℃
Housekeeping gene
TaActin Housekeeping gene GCTGTTCCAGCCATCTCATGT CGATCAGCAATTCCAGGAAAC 60℃
Korean J. Breed. Sci. 2022;54:104-18 https://doi.org/10.9787/KJBS.2022.54.2.104
© 2022 Korean J. Breed. Sci.