Korean Journal of Breeding Science :eISSN 2287-5174 / pISSN 0250-3360

Table. 3.

The characteristics of eight SSR related with FDP of Prunus persica.

Chr No of Scaffolds SSR_marker SSR marker location Forward primer sequences Reverse primer sequences Product size (bp)
Chr6 Scaffold_22 #150 4,664,217 4,664,252 CGAAAGCCGACGAGAATAG GGAGAGCTTTAGAAGCACACAG 150
#151 4,774,584 4,774,621 GACCCCTTGCGCATATAA GCTCTCTATTTTCTGCTCCTCC 152
Chr7 Scaffold_24 #228 14,764,107 14,764,136 GTGGTTGTTTGAGTGTTGGG CACTTCGCTCATCTTCCTCTAC 183
#230 18,099,174 18,099,239 CCATTACAGCCTGGTGAAGA GAGTGTCTGGAATCGCAATG 162
Chr8 Scaffold_25 #246 7,183,480 7,183,513 GCGGTGGTTGTAGAGAATAGAG TCTTGGCCGACCTAATTG 196
#247 7,674,465 7,674,498 GGACCAAGTGGAACAGAGAA ACCTTAACCTAACCAGGGTCAC 176
#249 7,831,800 7,831,809 CTCAACCTCATGTCCTTTGC CTCATGGAGGGGAAGAAAGT 161
#252 9,980,615 9,980,654 AAGCTAACCTACTTGTCGTCCC GAGTTGGCCTTCAACTCTTC 194
Korean J. Breed. Sci. 2022;54:149-57 https://doi.org/10.9787/KJBS.2022.54.3.149
© 2022 Korean J. Breed. Sci.