search for




 

Development of Single Nucleotide Polymorphism Markers Linked to Quantitative Trait Loci Controlling Anthocyanin Content in Red Bulb Onion (Allium cepa L.)
적색 양파에서 안토시아닌 함량 조절 양적형질유전자좌와 연관된 SNP 분자표지 개발
Korean J. Breed. Sci. 2021;53(2):116-126
Published online June 1, 2021
© 2021 Korean Society of Breeding Science.

Hyunwook Ryu1, Sunggil Kim2, Hye-Eun Lee3, JiWon Han3, and Jundae Lee1*
류현욱1⋅김성길2⋅이혜은3⋅한지원3⋅이준대1*

1Department of Horticulture, Institute of Agricultural Science & Technology, Jeonbuk National University, Jeonju 54896, Republic of Korea
2Department of Horticulture, Biotechnology Research Institute, Chonnam National University, Gwangju 61186, Republic of Korea
3Vegetable Research Division, National Institute of Horticultural & Herbal Science, Wanju 55365, Republic of Korea
1전북대학교 농업생명과학대학 농업과학기술연구소 원예학과, 2전남대학교 농업생명과학대학 원예생명공학과, 3농촌진흥청 국립원예특작과학원 채소과
Correspondence to: (E-mail: ajfall@jbnu.ac.kr, Tel: +82-63-270-2560, Fax: +82-63-270-2581)
Received April 5, 2021; Revised April 12, 2021; Accepted May 16, 2021.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
The bulb onion (Allium cepa L.), one of the most important vegetables worldwide, contains various functional compounds such as quercetin, allicin, and flavonoids. Red onions are rich in anthocyanins, a flavonoid that is a functional phytochemical with antioxidative and anticancer activities. In the previous study, two quantitative trait loci (QTLs) (qAC4.1 and qAC4.2) controlling the anthocyanin content were identified on chromosome 4 in an F2 population derived from a cross between A. cepa ‘SP3B’ and ‘H6’. In this study, we developed single nucleotide polymorphism-based high-resolution melting (HRM) markers linked to QTLs qAC4.1 and qAC4.2. In addition, we constructed a new genetic linkage map of chromosome 4 using HRM markers and performed a QTL analysis. The QTL qAC4.1 was false, while qAC4.2 was a major QTL. The QTL peak position, logarithm of the odds value, and phenotypic variance explained of qAC4.2 was 53.6 cM, 7.45, and 22.51%, respectively. Four HRM markers (AC4.2_65336.1_1123-HRM, AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM, and AC4.2_14596.1_345-HRM) within the QTL region of qAC4.2 were developed in this study. The average anthocyanin content of B (homozygous paternal) genotypes was higher than that of A (homozygous maternal) and H (heterozygous) genotypes for all markers. Consequently, these markers will be useful for marker-assisted selection to develop onion cultivars with high anthocyanin content.
Keywords : anthocyanin, bulb onion, HRM, marker, QTL, SNP
서 언

양파(Allium cepa L.)는 2018년 기준 세계 연간 생산량이 96,773,819톤에 달할 정도로 많이 생산되는 경제작물이다(FAO 2020). 국내에서는 대부분 황색 품종이 재배되고 있지만 최근 소비자들의 기능성 식품에 대한 관심과 샐러드 소비의 증가에 따라 적색 양파의 수요가 증가하고 있는 추세이다(Sidhu et al. 2019, Li et al. 2020).

양파에는 기능성이 높은 플라보노이드(flavonoids)가 풍부하다(Rodrigues et al. 2017). 플라보노이드는 식물의 2차 대사산물로 식물에 있어서는 자외선에 대한 방어 기능을 하며 인간에게는 혈액순환 개선, 알레르기 예방, 항산화 작용 등의 기능을 한다(Panche et al. 2016, Górniak et al. 2019, Agati et al. 2020). 이러한 플라보노이드 계열 화합물 중에서 양파에 다량 존재하는 대표적인 기능성 물질은 시아니딘(cyanidin)과 쿼세틴(quercetin)이다(Zhang et al. 2016).

안토시아닌은 식물의 꽃, 과실, 줄기, 뿌리 등에 함유되어 붉은색에서 푸른색 계통의 색을 나타내고 강한 항산화 활성이 있어 인간에 항암, 항염증, 항당뇨 작용 및 심혈관계 개선에 효과가 있다고 알려져 있다(Holton & Cornish 1995, Khoo et al. 2017, Gu et al. 2019). 양파에서 플라보노이드 물질은 구피색(bulb color)을 결정하며, 구피색은 크게 백색(white), 연녹색(chartreuse), 황색(yellow), 금색(gold), 분홍색(pink), 적색(red) 등이 있다(El-Shafie & Davis 1967, Cramer & Havey 1999, Khandagale & Gawande 2019). 특히 안토시아닌은 분홍색과 적색 양파를 만드는데 관여하고 있다(Kim et al. 2004b, 2005a, 2006).

양파 구피색은 6개 유전자좌(I, C, G, L, L2, and R loci)의 상호작용에 의해 결정된다고 보고되었으며(El-Shafie & Davis 1967, Khar et al. 2008, Khosa et al. 2016), 이들의 유전자좌는 플라보노이드 생합성 과정에 관여하는 다양한 유전자라는 것이 보고되었다(Dooner et al. 1991, Koes et al. 1994, Khosa et al. 2016, Khandagale & Gawande 2019). 적색 양파는 상보적인 두 유전자 DFR (dihydroflavonol 4-reductase)과 ANS (anthocyanidin synthase)의 상호작용에 의해 나타나며, 두 유전자 중 어느 하나라도 기능을 상실하면 황색 양파가 된다(Kim et al. 2004a, 2005a). 분홍색 양파는 ANS 유전자좌의 p 대립유전자에 의해 나타난다(Kim et al. 2004b). 금색 양파는 CHI (chalcone isomerase) 유전자좌의 premature stop codon에 의한 돌연변이 대립유전자에 의해 나타난다(Kim et al. 2004c). 백색 양파는 bHLH (basic helix-loop-helix) 전사인자 유전자 내 트랜스포존(transposon) 삽입에 의한 기능 상실에 의해 나타난다(Jo & Kim 2020). 이처럼 양파의 서로 다른 구피색에 대한 연구는 잘 되어 있지만 적색 양파의 안토시아닌 함량에 대한 연구는 아직 미흡한 실정이다. Duangjit et al. (2014)은 양파에서 반수체(haploids) 후대 집단에서 안토시아닌 함량에 대한 QTL (quantitative trait loci) 분석을 수행하였는데 각각 1, 4, 8번 염색체에 위치한 세 개의 QTLs를 탐색하였다. 최근 Choi et al. (2020)은 양파에서 GBS (genotyping-by-sequencing) 분석을 통하여 안토시아닌 함량에 대한 QTL을 분석하였는데 4번 염색체 위에서 두 개의 QTLs [qAC4.1 (LOD=3.26, PVE=19.43%)과 qAC4.2 (LOD=3.03, PVE=26.28%)]를 탐색하였다.

본 연구에서는 선행연구(Choi et al. 2020)에서 탐색된 양파의 안토시아닌 함량에 대한 QTLs (qAC4.1qAC4.2)과 연관된 SNP (single nucleotide polymorphism)를 HRM (high-resolution melting) 분자표지로 개발하고자 한다.

재료 및 방법

식물재료

F2 분리집단을 육성하기 위해 사용된 모친은 황색(yellow) 양파 계통인 ‘SP3B’를, 부친은 배가 반수체(doubled haploid) 적색(red) 양파 계통인 ‘H6’를 사용하였다(Choi et al. 2020). 이 F2 분리집단을 두 번 재배하였는데, 첫번째는 전남대학교 농장 포장에서 2017년 10월에 파종하여 2018년 6월에 양파구를 수확하였고(Choi et al. 2020), 두번째는 국립원예특작과학원 채소과 파속채소연구실 무안 농장에서 2018년 10월에 파종하여 2019년 6월에 양파구를 수확하였다. 수확된 양파구 중에서 황색 양파는 제외하고 적색 양파만 안토시아닌 함량 분석 실험재료로 사용하였는데, 1차 수확에서는 51개체(Choi et al. 2020)를, 2차 수확에서는 89개체를 사용하였다(Fig. 1).

Fig. 1. Total anthocyanin content of 51 and 89 F2 individuals derived from Allium cepa ‘SP3B’בH6’ and harvested in 2018 (A) and 2019 (B), respectively. A is originated from the results by Choi et al. (2020).

총 안토시아닌 함량 분석

총 안토시아닌 함량 분석은 수확한 적색 양파에 대해 Shin et al. (2007)의 방법에 따라 분석하였다. 양파의 구를 각 개체별로 액체질소를 사용하여 동결 분쇄 후 2.0 mL microcentrifuge tube에 100 mg씩 소분하였고 600 µL의 추출용액(1% HCl이 포함된 메탄올)을 넣고 4℃, 암조건에서 6시간 동안 추출하였다. 추출액은 원심분리기 1730R (Labogene, Seoul, Korea)을 이용하여 4℃, 12,000 rpm에서 5분 동안 원심분리를 실시한 후 상층액 200 µL를 새로운 1.5 mL microcentrifuge tube에 옮긴 후 TDW 200 µL와 chloroform: isoamyl alcohol (24:1)을 첨가 후 4℃, 12,000 rpm에서 5분 동안 원심분리를 실시하였다. 원심분리가 완료된 혼합액의 상층액 750 µL을 새로운 1.5 mL microcentrifuge tube에 옮긴 후 300 µL를 96-well microplate에 옮겨 spectrophotometer (BioTek Instruments, Inc., Winooski, Vermont, USA)를 사용하여 530 nm와 657 nm에서 측정하였다. 측정된 값은 다음공식[총 안토시아닌 함량(μg⋅100 mg-1)=A530nm - 0.25×A657nm]에 의해 계산되어 총 안토시아닌 함량을 측정하였다(Mancinelli & Schwartz 1984). 최종적으로 도출된 총 안토시아닌 함량은 각 개체당 5반복의 평균값을 사용하였다.

DNA 추출

수확한 양파구로부터 개체별로 각각 genomic DNA를 추출하였다. 액체질소를 사용하여 양파구를 동결 분쇄하여 DNA 추출에 사용하였다. 동결 분쇄된 각 시료들을 2.0 mL microcentrifuge tube에 담고 5 mm stainless steel beads 3개와 DNA extraction buffer (20 mM Tris-HCl, pH7.5; 250 mM NaCl; 25 mM EDTA; 0.5% SDS) 700 µL, PVP (polyvinylpyrrolidone) 1 g과 beta-mercaptoethanol 13 µL을 넣은 후 Tissue Lyser Ⅱ (Qiagen, Hilden, Germany)를 이용하여 60 Hz로 3분간 마쇄하였다. 그 후 Lab Armor beads bath (Thermo Fisher Scientific Inc., Waltham, MA, USA)를 사용하여 70℃에서 10분간 incubation을 진행한 후 원심분리기 1730R (Labogene, Seoul, Korea)를 이용하여 4℃, 13,000 rpm에서 10분간 원심분리를 진행하였다. 원심분리가 끝난 혼합액의 상층액 600 µL를 chloroform: isoamyl alcohol (24:1) 600 µL가 담긴 새로운 1.5 mL micro-centrifuge tube에 옮긴 후 4℃, 13,000 rpm에서 10분간 원심분리를 진행하였다. 원심분리가 완료된 혼합액의 상층액 500 µL을 isopropanol 500 µL가 담긴 1.5 mL microcentrifuge tube에 옮긴 후 잘 섞어 준 후 -20℃에서 10분 동안 incubation한 뒤 4℃, 13,000 rpm에서 10분간 원심분리를 진행하여 DNA pellet을 확인하였다. 확인된 DNA pellet을 제외한 나머지 용액을 제거하고 70% 에탄올 600 µL를 첨가하여 4℃, 13,000 rpm에서 1분간 원심분리를 진행하는 세척과정을 2회 반복하였다. 세척이 끝난 뒤 RNase 0.1 µL와 TDW (triple distilled water) 100 µL를 첨가하였고 최종적으로 BioDrop Lite (BioDrop UK Ltd., Cambridge, England)를 이용하여 DNA 농도를 20 ng⋅µL-1로 희석하여 사용하였다.

프라이머 디자인

선행연구에서 탐색된 두 개의 총 안토시아닌 함량 양적형질유전자좌(qAC4.1qAC4.2) 주변에 위치하는 SNP를 기반으로 HRM 분석용 프라이머를 디자인하였다(Choi et al. 2020). 프라이머 디자인은 primer3 ver. 0.4.0 (https://bioinfo.ut.ee/primer3-0.4.0/)을 이용하였다. 디자인된 프라이머의 amplicon을 transcriptome sequence에 BLAST하여 특이적 염기서열인지 아닌지를 확인하였다(Kim et al. 2015). 또한 탐색된 QTLs과 ANS 유전자의 위치를 비교하기 위하여 ANS 유전자로부터 기 개발된 HRM 프라이머를 사용하였다(Cho et al. 2021). 최종적으로 본 연구에서는 28개 세트의 프라이머를 새로 디자인하였고, 기 보고된 1개 세트의 프라이머를 사용하였다(Table 1).

Table 1

Information of HRM primer sets used in this study.

No. Primer namez Forward primer (5'→3') Reverse primer (5'→3') Luna probe (5'→3'-phosphate)
1 AC4.1_18641.1_434-HRM CTCTTTTGGCCACGTAGCTG GCAACTCAATTGCAACTCCA AGTAGGTGTGGTTTCCCACGCCTAT
2 AC4.1_3237.2_216-HRM TCAAAAGCAGAGTGGTGGAA ATGATGCCATCGTCCCATA -
3 AC4.1_53589.2_634-HRM GCCAATCGACTTGAATGATG TGCTGATTACCGGACTACTGC TCCAAACATTTTTAAAATTGAATTCTCTG
4 AC4.1_82084.4_2455-HRM TGCAGCGACATTTAACACTTTT TTCGTCCGGAAAAATCATTG -
5 AC4.1_35733.1_627-HRM TTTTAGTACCCGGCATCGAC TATTTTGGGCTCGAGGAATG -
6 AC4.1_91314.1_297-HRM ACGCGGCTACATCTGTTTCT GAAATGAGGCCCAAAGACC GAGTTCACTTCATGCTGCAGGTTG
7 AC4.1_35733.1_806-HRM CAAACAAACCAAAATTTGCATC GGTGTGTAATCTTGCCTGAGAA CAAAATGAACCTTCAAAAGCTCCACTA
8 AC4.1_54991.1_76-HRM GGGTTGTTGGAGTTCATCGT ACCACATCAGCCTCGACTTC -
9 AC4.1_82084.4_2438-HRM TTTCGAAAGCAATACACATTGA CAAAAAGGTTGCTGAAAATCTC -
10 AC4.1_57513.1_394-HRM AACCACCACCGTCAAACTTC GTAGTGGCAATGGGATGGAG -
11 AC4.1_57513.1_314-HRM TCAACTAACCACCACCGTCA AAGGCACTGATATGTTTGTGG -
12 AC4.1_82084.4_2438-HRM TTTCGAAAGCAATACACATTGA CAAAAAGGTTGCTGAAAATCTC -
13 AC4.1_53764.1_356-HRM CAAAACAGTTTGCGCCCTAT CCAATTTCATCAACACAGTGC -
14 AC4.1_22910.1_761-HRM CCATCCGATACCTCAAACCA TGCCCTATGTAAATCATTGGAA -
15 AC4.1_82084.4_2119-HRM GTGTCAGAGGGGCCTGGTAG CATGGACGGTAATGCTAGGG -
16 AC4.1_27269.1_95-HRM CAACAAAATAAGACGGGTTGG GAGACAACCATCATTTGGAAAA -
17 AC4.2_2203.1_2751-HRM AGCTTCGGGATGTGGTAGC AGCTGCAAGGTAGAGACAAGC TTGCTTATCATCATCATCATCCAT
18 AC4.2_11181.3_221-HRM CAGCTTGAACTGCAGCCATA GCCTTGTTGGTGACCGTACT -
19 AC4.2_26110.2_685-HRM AGCACATCTGCATTGATTGG CAGGACTTGGAAGCCAGAAT -
20 AC4.2_68134.1_674-HRM TAGAATTTGCCCACCCACTG ACCGCATTACTTCAGCCATC -
21 AC4.2_65336.1_1123-HRM TCTTCGTCGCCATTAGAAGG GACTCAGGTTCGGGTTTGAA -
22 AC4.2_84695.1_220-HRM CCACCAATCAGTCTGCTTCA GGGCGCAACTCCTGTTACTA CCAACGCATCACTAGTCAGTCTGCTA
23 AC4.2_84695.1_288-HRM CCAGCACATCAGGATCACTC CCCATGAAAGAAGCATCGAC ACTTTTACTAAAATGCCCCCAAGCAAT
24 AC4.2_26019.3_513-HRM CAAGTGGATTAAAGGAAAAAGTTG TTTCCAGTAATGAAATGAACAACA -
25 AC4.2_53230.3_454-HRM ACCCTTCATGGAAAGGAACG CCATCAGGATGGAAGTACCG -
26 AC4.2_11999.1_756-HRM CTCCCCCATCGTTGTTACTC CGATCTATTTCGCACGATTG -
27 AC4.2_25396.9_1284-HRM TTCAGGTATTTCCATGTCACAA AAGGCAGAGAGGAATTTTTGAA AAATATTGCCGCATTTTAACTACAAAA
28 AC4.2_14596.1_345-HRM GAAGCCCTCTTGCATCAGTT TGCCTTTTAACTCGTCAGCA -
29 ANS-HRM GCATTGACCGCAAAATACTTA TGCCACTTCTGAGGATGGAT

zANS-HRM, HRM marker developed in ANS (anthocyanidin synthase) gene (Cho et al. 2021).



HRM 분석

HRM 분석은 LightCycler® Real-Time PCR (Roche, Basel, Swizerland)을 사용하여 분석하였다(Liew et al. 2004). HRM 반응액은 genomic DNA 20 ng⋅µL-1 2.0 µL, 10×EasyTaq buffer 2.0 µL (Transgen Biotech, China), 2.5 mM dNTP mixture 1.0 µL, SYTO®9 green fluorescent nucleic acid stain (Life Technologies™, Carlsbad, CA, USA) 0.5 µL, 0.1 unit Taq DNA polymerase (Transgen Biotech, China), 각각의 10 pmole⋅µL-1 프라이머 1.0 µL, TDW 12.4 µL를 혼합하여 총 20 µL로 만들어 사용하였다. 만약 SNP 조합이 A/T, T/A, C/G 및 G/C인 경우에는 TDW 1.0 µL를 줄이고 Luna probe 1.0 µL를 추가하여 총 20 µL로 만들어 사용하였다(deSilva & Blackett 2007). PCR 반응은 95℃에서 5분간 pre-denaturation을 진행하였고 95℃에서 20초간 denaturation, 60℃에서 20초간 annealing 및 extension 과정을 40회 반복하였으며 72℃에서 20초간 final extension 반응을 진행하였다. 최종적으로 생산된 PCR products는 LightCycler® Real-Time PCR (Roche, Basel, Swizerland)를 사용하여 65℃에서 97℃까지 0.2℃씩 온도를 증가시키며 SYTO®9 형광값을 측정하여 melting curve graph를 작성하였다. 작성된 melting curve는 LightCycler® ver. 1.1.0.1320 프로그램(Roche, Basel, Swizerland)을 사용하여 유전자형 분석을 수행하였다. 유전자형은 3개의 그룹으로 동형접합형(homozygous)인 A (‘SP3B’ type)와 B (‘H6’ type), 이형접합형(heterozygous)인 H로 구분하여 분류하였다.

유전자지도 작성

유전자지도는 JoinMap 4.1 프로그램을 이용하여 작성하였다(Van Ooijen 2006). 연관 그룹은 LOD≥3.0과 최대 거리 30 cM 기준으로 나누었고, 연관 거리는 Kosambi mapping function을 사용하여 계산하였다(Kosambi 1944). 집단 옵션은 F2를 사용하였다(Van Ooijen 2006). 최종 연관 지도는 MAPCHART v.2.1 프로그램을 사용하여 그렸다(Voorrips 2002).

QTL 분석

QTL 분석은 Windows QTL Cartographer ver. 2.5 프로그램을 이용하여 수행하였다(Silva et al. 2012). 분자표지 유전형과 안토시아닌 함량 표현형의 연관을 분석하기 위해 1.0 cM walking speed를 사용하여 composite interval mapping (CIM) 분석 방법을 사용하였다. LOD threshold는 1000번의 permutation tests를 수행한 후 50번째 높은 LOD값(유의성 5% 기준)을 사용하였다.

통계 분석

유전자형 분석 결과, 분자표지의 유전형이 나타내는 평균 안토시아닌 함량간 유의미한 차이를 확인하기 위하여 R studio ver. 4.0.2를 이용하여 5% (α=0.05)의 유의수준에서 ANOVA 분석 및 Duncan’s new multiple range test를 수행하였다(Venables et al. 2020).

결과 및 고찰

F2 분리집단에서 분석된 총 안토시아닌 함량 분포

‘SP3B’בH6’ 조합의 F2 분리집단에서 적색 양파와 황색 양파는 3:1로 분리되었는데, 이전 연구에서 이 양파색 분리는 DRF 유전자의 분리에 의해 나타나는 것이라고 보고하였다(Choi et al. 2020). 따라서 본 연구에서는 2018년에 수확된 적색 양파 51개체(Choi et al. 2020)와 2019년에 수확된 적색 양파 89개체만을 이용하여 총 안토시아닌 함량을 측정하였다(Fig. 1). 그 결과, 2018년에 수확된 집단에서 최대값은 0.506 μg⋅100 mg-1이고 최소값은 0.010 μg⋅100 mg-1이며 평균값은 0.099 μg⋅100 mg-1이었고 표준편차는 0.013 μg⋅100 mg-1이었다(Fig. 1A, Choi et al. 2020). 그리고 2019년에 수확된 집단에서 최대값은 0.432 μg⋅100 mg-1이고 최소값은 0.006 μg⋅100 mg-1이며 평균값은 0.116 μg⋅100 mg-1이었고 표준편차는 0.077 μg⋅100 mg-1이었다(Fig. 1B). 분석에 사용된 두 집단 모두 연속적인 변이를 보이는 것은 양파에서 안토시아닌 함량이 양적형질임을 의미한다(Fig. 1). 본 연구에서 개발된 HRM 분자표지의 유전적 효과를 분석하는데 이 두 집단을 사용하였다.

안토시아닌 함량 QTL에 연관된 SNP 기반 HRM 분자표지 개발

선행연구에서 탐색된 양파 안토시아닌 함량에 대한 두 개의 양적형질유전자좌 qAC4.1qAC4.2는 각각 4번 염색체 7.0 cM과 62.0 cM 위치에서 확인되었다(Choi et al. 2020). QTL qAC4.1 범위는 5.7~10.7 cM이었는데 0.0 cM에서 20.4 cM 범위에 위치하는 16개의 SNP를 선발하였고, QTL qAC4.2 범위는 51.8~62.0 cM이었는데, 41.5 cM에서 63.5 cM 범위에 위치하는 12개의 SNP를 선발하였다(Table 1, Choi et al. 2020). 본 연구에서는 선발된 SNP를 기반으로 HRM용 프라이머를 디자인하였다(Table 1). 새롭게 디자인된 프라이머를 이용하여 2018년 수확한 양파 F2 분리집단에 분석하여 최종적으로 11개의 HRM 분자표지를 개발하였다(Fig. 2). qAC4.1과 연관된 SNP에서 개발된 HRM 분자표지는 AC4.1_91314.1_297-HRM, AC4.1_57513.1_394-HRM, AC4.1_53764.1_356-HRM, AC4.1_82084.4_2119-HRM 및 AC4.1_27269.1_95-HRM 등 5개였고, qAC4.2와 연관된 SNP에서 개발된 HRM 분자표지는 AC4.2_68134.1_674-HRM, AC4.2_65336.1_1123-HRM, AC4.2_26019.3_513-HRM, AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM 및 AC4.2_14596.1_345-HRM 등 6개였다(Fig. 2). 또한 4번 염색체에서 탐색된 두 개의 QTLs과 ANS 유전자의 위치를 비교하기 위해 ANS-HRM 분자표지를 분석하였는데 다형성을 보였다(Fig. 2).

Fig. 2. Melting curves of polymorphic HRM markers linked to two QTLs, qAC4.1 and qAC4.2, controlling total anthocyanin content and ANS-HRM marker for ANS (anthocyanidin synthase) gene in red onion. A, homozygous maternal genotype (‘SP3B’); B, homozygous paternal genotype (‘H6’); H, heterozygous genotype.

개발된 HRM 분자표지를 이용한 양파 유전자지도 작성 및 QTL 분석

기 작성된 양파 4번 염색체 유전자지도(Choi et al. 2020)에 본 연구에서 개발된 HRM 분자표지를 추가하여 새로운 연관 지도를 작성하였다(Fig. 3). 13개의 HRM 분자표지와 22개의 GBS-based SNP 분자표지로 이루어진 4번 염색체 유전자지도는 총 88.1 cM의 연관 거리를 보였다(Fig. 3).

Fig. 3. Genetic linkage map of chromosome 4 and LOD graph by composite interval mapping analysis in an F2 population of Allium cepa ‘SP3B’בH6’. Red line, LOD threshold, the 50th LOD value (4.17) from 1,000 permutation tests; Blue line, QTL peak position (53.6 cM); Red bar, qAC4.1 QTL region detected in previous study (Choi et al. 2020), Blue bar, qAC4.2 region.

새롭게 작성된 유전자지도를 이용하여 안토시아닌 함량에 대한 QTL 분석을 다시 수행하였다. 그 결과, qAC4.1은 QTL로 나타나지 않았고, qAC4.2는 주동 QTL로 나타났다(Fig. 3). 이전 연구에서 탐색되었던 qAC4.1은 false QTL인 것으로 판단되었는데, 이는 새롭게 개발된 HRM 분자표지가 유전자지도에 위치함으로써 그 유전자형이 더 정확하게 scoring되었기 때문인 것으로 생각된다(Supplementary Table 1). GBS 분석을 통해 생성된 유전자형은 in silico 분석을 통해 생성되는 데이터이기 때문에 항상 에러를 포함할 수 있는 여지가 있다(Torkamaneh et al. 2016, Bresadola et al. 2020). 본 연구에서도 T57513.1_394-GBS와 T57513.1_394-HRM 데이터를 비교한 결과, 3개의 genotypes에서 차이가 났고 GBS 분석에서 분석이 안 된 2개의 missing data가 HRM 분자표지 분석에서 genotyping이 되었다(Supplementary Table 1). 반면 T53764.1_356-GBS와 T53764.1_356-HRM 데이터를 비교한 결과에서는 잘못 scoring된 genotypes은 없었으나 GBS에서 분석이 안 된 3개의 missing data가 HRM 분자표지 분석에서는 genotyping이 되었다(Supplementary Table 1).

반면에 qAC4.2는 이전 연구 결과와 마찬가지로 주동 QTL로 나타났다(Fig. 3). QTL peak position은 53.6 cM이었는데, 이 위치의 LOD값은 7.45였고, phenotypic variance explained (PVE)를 설명하는 결정계수(R2)값은 22.51%였다(Table 2). LOD threshold값(4.17)을 넘는 QTL 범위는 T65336.1_1123과 T79877.1_198 사이인데(Table 2), 4개의 HRM 분자표지(AC4.2_65336.1_1123-HRM, AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM 및 AC4.2_14596.1_345-HRM)가 위치하고 있었다(Fig. 3). 따라서 이 4개의 HRM 분자표지를 이용하여 안토시아닌 함량에 대한 유전적 효과를 추가적으로 분석하였다.

Table 2

Detailed information of the QTL qAC4.2 detected in an F2 population of Allium cepa ‘SP3B’בH6’.

QTL Chr. Marker interval Peak position (cM) Additive effect Dominance
effect
R2 (%) LOD
value
LOD
threshold
qAC4.2 4 T65336.1_1123
- T79877.1_198
53.6 -0.052 -0.040 22.51 7.45 4.17


이전 연구에 따르면 ANS 유전자는 양파의 4번 염색체 위에 위치한다는 결과가 있었고(Masuzaki et al. 2006), ANS 유전자의 변이 형태에 따라 적색 양파의 적색 강도가 달라진다는 결과도 있었다(Kim et al. 2006). 따라서 본 연구에서는 ANS 유전자가 안토시아닌 함량에 관여하는 여러 유전자 중 하나일 것으로 생각되어 ANS 유전자로부터 개발된 ANS-HRM 분자표지와 기 탐색된 QTLs의 위치를 비교하였다. 그 결과, ANS 유전자는 QTL qAC4.2와 연관되어 있었으나 QTL 범위에는 포함되지 않았다(Fig. 3). 이는 본 연구에서 사용한 분리집단에서는 ANS 유전자가 안토시아닌 함량에 영향을 미치지 않았다는 것을 의미한다.

선발된 HRM 분자표지의 안토시아닌 함량에 대한 유전적 효과 분석

안토시아닌 함량 조절 QTL qAC4.2와 연관된 4개의 HRM 분자표지(AC4.2_65336.1_1123-HRM, AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM 및 AC4.2_14596.1_345-HRM)를 2018년과 2019년에 수확된 적색 양파를 이용하여 안토시아닌 함량에 대한 유전적 효과를 분석하였다. 그 결과, 2018년 수확된 ‘SP3B’בH6’ 조합의 F2 분리집단 분석에서 4개의 분자표지 모두 B 유전형(homozygous paternal genotype)을 가지고 있을 때 평균 안토시아닌 함량이 A 유전형(homozygous maternal genotype) 또는 H 유전형(heterozygous genotype)을 가진 것보다 높았다(Fig. 4). 각 분자표지별로 유의성을 확인하기 위하여 5%(α=0.05)의 유의수준에서 ANOVA 분석과 Duncan’s test를 수행한 결과 모두 유의성을 보였다(Fig. 4). 또한 H 유전형의 평균 안토시아닌 함량이 A 유전형의 값과 비슷한 것으로 보아 B 유전형이 A 유전형에 대해 열성으로(recessive) 작용하는 것으로 판단된다(Fig. 4).

Fig. 4. Genotypic effect of four HRM markers linked to the QTL qAC4.2 on average anthocyanin content in red onions cultivated in 2018 (1, 3, 5, and 7) and 2019 (2, 4, 6, and 8). A, homozygous maternal genotype (‘SP3B’); B, homozygous paternal genotype (‘H6’); H, heterozygous genotype; a and b indicate significant difference by Duncan’s test with p<0.05.

2019년 수확된 F2 분리집단 분석에서는 AC4.2_65336.1-1123-HRM 분자표지만 유전자형에 따른 유의성이 있었고, 나머지 3개의 분자표지(AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM 및 AC4.2_14596.1_345-HRM)는 유전자형에 따른 유의성이 없었다(Fig. 4). 하지만 B 유전자형의 평균 안토시아닌 함량이 A 또는 H 유전자형의 함량보다 높은 경향성은 있었다(Fig. 4). 이는 본 연구에서 개발된 분자표지를 사용하여 B 유전자형을 선발한다면 평균적으로 높은 안토시아닌 함량을 가진 개체를 선발할 수 있음을 의미한다.

2018년 수확된 양파에서는 분자표지의 유전자형별로 안토시아닌 함량 차이가 큰 반면 2019년 수확된 양파에서는 그 차이가 적었다. 이는 연차별 재배 환경이 영향을 미쳤기 때문인 것으로 생각된다. 일반적으로 2차 대사산물의 함량은 환경에 영향을 받는다고 알려져 있다(Yang et al. 2018).

본 연구에서 개발한 4개의 HRM 분자표지는 양파 4번 염색체 위 11.9 cM (48.4~60.3 cM) 사이에 위치하고 있는데, 개체수가 더 큰 분리집단을 사용하여 QTL 범위를 더 좁히는 추가 실험을 한다면 어느 분자표지가 안토시아닌 고함량 개체 선발에 더 효과적인지 확인할 수 있을 것이다. 또한 다양한 양파 유전자원에 본 연구에서 개발된 분자표지를 분석하여 적용성 검정을 수행한다면 MAS의 활용 가능성을 확인할 수 있을 것이다.

결론적으로 본 연구과제에서 개발한 안토시아닌 함량 조절 QTL qAC4.2와 연관된 4개의 HRM 분자표지는 적색 양파에서 안토시아닌 함량 조절유전자를 클로닝하는데 기여할 뿐만 아니라 안토시아닌 고함량 양파 품종 육성시 큰 도움이 될 것으로 생각된다.

적 요

양파는 세계적으로 많이 소비되는 채소 중 하나이고, 쿼세틴, 알리신, 플라보노이드 등 기능성 물질을 풍부하게 함유하고 있다. 그 중 양파에 함유되어 적색을 나타내는 수용성 색소인 안토시아닌은 항산화 및 항암 등에 효과가 있다고 보고되었다. 선행 연구에서 ‘SP3B’בH6’ 조합의 F2 분리집단을 이용하여 QTL 분석을 수행한 결과, 안토시아닌 함량에 관련된 2개의 QTL (qAC4.1qAC4.2)을 4번 염색체 위에서 탐색하였다. 본 연구에서는 안토시아닌 함량과 관련된 2개의 QTL에 대해 SNP 기반 HRM (high-resolution melting) 분자표지를 개발하였다. 또한 개발된 HRM 분자표지를 추가하여 양파 4번 염색체의 유전자지도를 다시 작성하였고, QTL 분석 또한 다시 수행하였다. 그 결과, qAC4.1은 false QTL로 확인되었고, qAC4.2는 주동 QTL로 확인되었다. QTL qAC4.2의 peak position은 53.6 cM이었는데, 이 위치의 LOD값은 7.45였고, 결정계수(R2)값은 22.51%였다. QTL 범위 안에는 4개의 HRM 분자표지(AC4.2_65336.1_1123-HRM, AC4.2_53230.3_454-HRM, AC4.2_11999.1_756-HRM 및 AC4.2_14596.1_345-HRM)가 위치하고 있었다. 적색 양파에서 4개의 분자표지 모두 B 유전형(homozygous paternal genotype)을 가지고 있을 때 평균 안토시아닌 함량이 A 유전형(homozygous maternal genotype) 또는 H 유전형(heterozygous genotype)을 가진 것보다 높았다. 결론적으로 본 연구과제에서 개발한 4개의 HRM 분자표지는 안토시아닌 고함량 양파 품종 육성시 MAS에 활용할 수 있을 것으로 생각된다.

보충자료

본문의 Supplementary Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

사 사

본 논문은 농림축산식품부, 해수부, 농진청, 산림청의 재원으로 농림식품기술기획평가원 Golden Seed 프로젝트 사업의 지원을 받아 연구되었음(과제번호: 213007-05-5-WTB11).

Supplementary information
Supplementary File
References
  1. Agati G, Brunetti C, Fini A, Gori A, Guidi L, Landi M, Sebastiani F, Tattini M. 2020. Are flavonoids effective antioxidants in plants? Twenty years of our investigation. Antioxidants 9: 1098.
    Pubmed KoreaMed CrossRef
  2. Bresadola L, Link W, Buerkle CA, Lexer C, Wegmann D. 2020. Estimating and accounting for genotyping errors in RAD-seq experiments. Mol Ecol Resour 20: 856-870.
    Pubmed CrossRef
  3. Cho Y, Kim B, Lee J, Kim S. 2021. Construction of a high-resolution linkage map and chromosomal localization of the loci determining major qualitative traits in onion (Allium cepa L.). Euphytica 217: 17.
    CrossRef
  4. Choi Y, Kim S, Lee J. 2020. Construction of an onion (Allium cepa L.) genetic linkage map using genotyping-by- sequencing analysis with a reference gene set and identification of QTLs controlling anthocyanin synthesis and content. Plants 9: 616.
    Pubmed KoreaMed CrossRef
  5. Cramer CS, Havey MJ. 1999. Morphological, biochemical, and molecular markers in onion. HortScience 34: 589-593.
    CrossRef
  6. deSilva D, Blackett J. 2007. Developing a simple and inex-pensive genotyping assay with luna probes. Assay: high- resolution melting & unlabeled probes. Genetic Engineering & Biotechnology News. Available online: http://www.genengnews.com/gen-articles/assay-high-resolution-melting-unlabeled-probes/1986.
  7. Dooner HK, Robbins TP, Jorgensen RA. 1991. Genetic and developmental control of anthocyanin biosynthesis. Annu Rev Genet 25: 173-199.
    Pubmed CrossRef
  8. Duangjit J, Welsh K, Wise ML, Bohanec B, Havey MJ. 2014. Genetic analyses of anthocyanin concentrations and intensity of red bulb color among segregating haploid progenies of onion. Mol Breed 34: 75-85.
    CrossRef
  9. El-Shafie MW, Davis GN. 1967. Inheritance of bulb color in the onion (Allium cepa L.). Hilgardia 38: 607-622.
    CrossRef
  10. FAO. 2020. Food and agriculture data. http://www.fao.org/faostat/en.
  11. Górniak I, Bartoszewski R, Króliczewski J. 2019. Comprehensive review of antimicrobial activities of plant flavonoids. Phytochem Rev 18: 241-272.
    CrossRef
  12. Gu KD, Wang CK, Hu DG, Hao YJ. 2019. How do anthocyanins paint our horticultural products?. Sci Hort 249: 257-262.
    CrossRef
  13. Holton TA, Cornish EC. 1995. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7: 1071-1083.
    Pubmed KoreaMed CrossRef
  14. Jo C, Kim S. 2020. Transposition of a non-autonomous DNA transposon in the gene coding for a bHLH transcription factor results in a white bulb color of onions (Allium cepa L.). Theor Appl Genet 133: 317-328.
    Pubmed CrossRef
  15. Khandagale K, Gawande S. 2019. Genetics of bulb colour variation and flavonoids in onion. J Hort Sci Biotechnol 94: 522-532.
    CrossRef
  16. Khar A, Jakse J, Havey MJ. 2008. Segregations for onion bulb colors reveals that red is controlled by at least three loci. J Am Soc Hort Sci 133: 42-47.
    CrossRef
  17. Khoo HE, Azlan A, Tang ST, Lim SM. 2017. Anthocyanidins and anthocyanins: colored pigments as food, pharmaceutical ingredients, and the potential health benefits. Food Nut Res 61: 1361779.
    Pubmed KoreaMed CrossRef
  18. Khosa JS, McCallum J, Dhatt AS, Macknight RC. 2016. Enhancing onion breeding using molecular tools. Plant Breed 135: 9-20.
    CrossRef
  19. Kim S, Bang H, Yoo KS, Pike LM. 2006. Identification of the fourth allele of the ANS (anthocyanidin synthase) gene and its effect on red color intensity in onions (Allium cepa). Euphytica 149: 45-51.
    CrossRef
  20. Kim S, Binzel ML, Park S, Yoo KS, Pike LM. 2004a. Inactivation of DFR (dihydroflavonol 4-reductase) gene transcription results in blockage of anthocyanin production in yellow onions (Allium cepa). Mol Breed 14: 253-263.
    CrossRef
  21. Kim S, Binzel ML, Yoo KS, Park S, Pike LM. 2004b. Pink (P), a new locus responsible for a pink trait in onions (Allium cepa) resulting from natural mutations of anthocyanidin synthase. Mol Gen Genomics 272: 18-27.
    Pubmed CrossRef
  22. Kim S, Jones R, Yoo KS, Pike LM. 2004c. Gold color in onions (Allium cepa): a natural mutation of the chalcone isomerase gene resulting in a premature stop codon. Mol Genet Genomics 272: 411-419.
    Pubmed CrossRef
  23. Kim S, Jones R, Yoo KS, Pike LM. 2005a. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase. Theor Appl Genet 111: 120-127.
    Pubmed CrossRef
  24. Kim S, Kim MS, Kim YM, Yeom SI, Cheong K, Kim KT, Jeon J, Kim S, Kim DS, Sohn SH, Lee YH, Choi D. 2015. Integrative structural annotation of de novo RNA-Seq provides an accurate reference gene set of the enormous genome of the onion (Allium cepa L.). DNA Res 22: 19-27.
    Pubmed KoreaMed CrossRef
  25. Koes RE, Quattrocchio F, Mol JNM. 1994. The flavonoid biosynthetic pathway in plants: Function and evolution. BioEssays 16: 123-132.
    CrossRef
  26. Kosambi DD. 1944. The estimation of map distance from recombination value. Ann Eug 12: 172-175.
    CrossRef
  27. Li Q, Wang Y, Mai Y, Li H, Wang Z, Xu J, He X. 2020. Health benefits of the flavonoids from onion: Constituents and their pronounced antioxidant and anti-neuroinflammatory capacities. J Agric Food Chem 68: 799-807.
    Pubmed CrossRef
  28. Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, Wittwer C. 2004. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin Chem 50: 1156-1164.
    Pubmed CrossRef
  29. Mancinelli AL, Schwartz OM. 1984. The photoregulation of anthocyanin synthesis IX. The photosensitivity of the response in dark and light grown tomato seedlings. Plant Cell Physiol 25: 93-105.
  30. Masuzaki S, Shigyo M, Yamauchi N. 2006. Complete assignment of structural genes involved in flavonoid biosynthesis influencing bulb color to individual chromosomes of the shallot (Allium cepa L.). Genes Genet Syst 81: 255-263.
    Pubmed CrossRef
  31. Panche AN, Diwan AD, Chandra SR. 2016. Flavonoids: An overview. J Nut Sci 5: e47.
    Pubmed KoreaMed CrossRef
  32. Rodrigues AS, Almeida DPF, Simal-Gándara J, Pérez-Gregorio MR. 2017. Onions: a source of flavonoids. pp. 439-471. In: Justino GC (Ed) Flavonoids: From Biosynthesis to Human Health. IntechOpen.
    CrossRef
  33. Shin J, Park E, Choi G. 2007. PIF3 regulates anthocyanin biosynthesis in an HY5-dependent manner with both factors directly binding anthocyanin biosynthetic gene promoters in Arabidopsis. Plant J 49: 981-994.
    Pubmed CrossRef
  34. Sidhu JS, Ali M, Al-Rashdan A, Ahmed N. 2019. Onion (Allium cepa L.) is potentially a good source of important antioxidants. J Food Sci Technol 56: 1811-1819.
    Pubmed KoreaMed CrossRef
  35. Silva LDCE, Wang S, Zeng ZB. 2012. Composite interval mapping and multiple interval mapping: Procedures and guidelines for using Windows QTL Cartographer. In: Rifkin S (Ed) Quantitative Trait Loci (QTL). Humana Press, Totowa, NJ, USA.
    Pubmed CrossRef
  36. Torkamaneh D, Laroche J, Beizile F. 2016. Genome-wide SNP calling from genotyping by sequencing (GBS) data: A comparison of seven pipeline and two sequencing technologies. PLoS ONE 11: e0161333.
    Pubmed KoreaMed CrossRef
  37. Van Ooijen JW. 2006. JoinMap® 4, Software for the calculation of genetic linkage maps in experimental populations. Wageningen, the Netherlands: Kyazma B.V..
  38. Venables WN, Smith DM; The R Core Team. 2020. An introduction to R: Notes on R, a programming environment for data analysis and graphics. Available online: http://www.r-project.org/.
  39. Voorrips RE. 2002. MAPCHART: Software for the graphical presentation of linkage maps and QTLs. J Hered 93: 77-78.
    Pubmed CrossRef
  40. Yang L, Wen KS, Ruan X, Zhao YX, Wei F, Wang Q. 2018. Response of plant secondary metabolites to environmental factors. Molecules 23: 762.
    Pubmed KoreaMed CrossRef
  41. Zhang S, Deng P, Xu Y, Lu S, Wang J. 2016. Quantification and analysis of anthocyanin and flavonoids compositions, and antioxidant activities in onions with three different colors. J Int Agric 15: 2175-2181.
    CrossRef


June 2021, 53 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information
  • Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry
      10.13039/501100014189
      213007-05-5-WTB11