search for




 

Classification of Korean Rice Cultivars through Amylose Content Using Molecular Markers Targeting the Waxy Locus
Waxy 유전자 좌위 분자마커를 이용한 아밀로스 함량별 벼 품종 분류
Korean J. Breed. Sci. 2021;53(4):361-372
Published online December 1, 2021
© 2021 Korean Society of Breeding Science.

So-Myeong Lee, Young-Ho Kwon, Ju-Won Kang, Ji-Yoon Lee, Sumin Jo, Dongjin Shin, Jin-Kyung Cha, Dong-Soo Park, Jun-Hyeon Cho, and Jong-Hee Lee*
이소명⋅권영호⋅강주원⋅이지윤⋅조수민⋅신동진⋅차진경⋅박동수⋅조준현⋅이종희*

Paddy Crop Research Division, Department of Southern Area Crop Science, National Institute of Crop Science, RDA, Miryang, 50424, Republic of Korea
농촌진흥청 국립식량과학원 남부작물부 논이용작물과
Correspondence to: (E-mail: ccriljh@korea.kr, Tel: +82-55-350-1168, Fax: +82-55-352-3059)
Received August 1, 2021; Revised November 1, 2021; Accepted November 1, 2021.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
A total of 285 Korean rice cultivars were used for amylose content and genetic analyses using KASP markers related to the amylose content. We used three polymorphic KASP markers targeting the Waxy (Wx) gene and compared the genotyping efficiency with previously reported molecular markers. The rice cultivars were raised in Miryang, Korea, for one period. Genetic analysis of the rice cultivars revealed that the three KASP markers on the Wx gene were functional for genomic selection of SNPs related to amylose content variation. Therefore, the three KASP markers targeting different Wx alleles can be used for genomic selection. In addition, KASP markers were more efficient than previously reported molecular markers that target the same alleles. These findings can be beneficial for the breeding and genomic selection of high-quality rice in Korea.
Keywords : rice, functional marker, amylose content, breeding, genetic analysis
서 언

쌀의 주요 구성성분은 단백질, 지질, 수분, 그리고 전분이다. 전분은 백미의 경우 중량 대비 76.7~78.4%를 차지하고 있다. 쌀의 식미 및 조리특성은 단백질 함량, 아밀로펙틴 분지사슬 길이 분포, 아밀로스 함량, 호화특성 등에 따라 달라지며, 이 중 가장 큰 영향을 미치는 것이 아밀로스 함량이다(Bao et al. 2006, Cagampang et al. 1973, Chen et al. 2006, Fuller et al. 2009, Hansen et al. 2002, Huang et al. 1998, Juliano 1985, Lee et al. 2016, Lestari et al. 2009, Little 1958, Ramesh et al. 2000).

쌀의 아밀로스 함량은 벼 6번 염색체상의 Waxy (Wx) 유전자의 유전자형에 의해서 찰벼, 저아밀로스, 메벼 및 고아밀로스로 분류되며, 아밀로스 합성은 Granule Bound Starch Synthase 1 (GBSS1)에 의해 조절된다(Sano 1984, Wang et al. 1992, Wang et al. 1990). Wx 유전자는 벼 재배종에 따라 여러 하플로타입이 존재하는데, 일반 메벼의 하플로타입인 Wxa, Wxb, Wxin은 야생벼형 대립유전자 Wxiv에서 파생되었다(Zhang et al. 2019). 고아밀로스 품종은 Wxa 대립유전자를 가지고 있으며, Wx 유전자의 발현이 Wxb 대립유전자를 가진 품종보다 10배 정도 높고, 아밀로스 함량이 25% 이상을 차지한다. 아밀로스 함량이 16-23% 전후인 일반 메벼 품종 중 자포니카 품종은 Wxb 대립유전자를, 인디카 품종은 Wxin 대립유전자를 가지고 있다(Kumar et al. 1987). 찰벼는 Wx 유전자 2번 엑손의 23 bp의 중복 염기서열에 의해 전사과정이 일찍 종결되는 wx 대립유전자를 갖고 있어 아밀로스 함량이 낮다(Isshiki et al. 2001, Teng et al. 2012, Wanchana et al. 2003). 한편, 찰벼와 멥쌀의 중간 정도 아밀로스 함량의 저아밀로스 품종 밀키퀸은 고시히카리에 MNU (N-methyl-N-nitrosourea)를 처리해 만들어졌다(Ise et al. 2001). 밀키퀸은 Wx 유전자의 4, 5번 엑손에 SNP 돌연변이가 생겨 아밀로스 함량이 낮아졌으며 이 대립유전자는 Wx-mq로 명명되었다(Ise et al. 2001, Sato et al. 2002, Suto 1996).

한편, 분자마커를 이용하여 벼의 아밀로스 함량을 구분하기 위해 많은 연구들이 진행되었다. Bligh et al. (1995)은 Simple sequence repeat (SSR) 마커인 RM190를 이용하여 (CT)n 반복수에 따라 아밀로스 함량의 구분이 가능하다고 하였다. Yamanaka et al. (2004)Wxa 대립유전자를 동정할 수 있는 Derived cleaved amplified polymorphic sequences (dCAPS) 마커를 보고했다. 이 마커는 활용 시 EcoT14I 제한효소를 이용하며 제한자리 유무에 따라 Wx 유전자의 첫번째 인트론 5’-이어맞추기부위(splice junction)에 위치한 G/T Single nucleotide polymorphism (SNP)을 검출하여 WxaWxb 대립유전자를 구별할 수 있다. 또한 Yamanaka et al. (2004)은 찰벼 대립유전자인 wx의 23 bp 중복염기서열을 대상으로 InDel 마커를 개발하였으며, Sato et al. (2002)은 밀키퀸의 Wx-mq 대립유전자가 가진 SNP 선발을 위한 tetra-primer를 보고하였다. Shao et al. (2020)은 여러 Wx 대립유전자를 구분 가능한 6개의 Kompetitive allele-specific PCR (KASP) 마커를 보고했다.

본 연구에서는 분자육종 기반 고품질 및 가공용 벼 품종의 다양화를 위해 Wx 유전자 상의 KASP 마커를 이용하여 국내 벼 품종 285개에 대한 유전자형을 파악하였다. 또한 해당 마커를 이용하여 Wx 대립유전자형별 찰벼, 저아밀로스벼, 고아밀로스벼 품종 구분이 가능한지 검토하였다.

재료 및 방법

시험재료 및 아밀로스 함량분석

시험재료는 국내 육성 벼 품종인 오대벼 등 자포니카 품종은 253개, 태백벼 등 통일형 품종은 32개를 사용하였다. 2020년 국립식량과학원 남부작물부(경상남도 밀양)에서 보통기 보비재배법에 준하여 재배하였으며, 5월 6일 파종하여 29일간 육묘한 뒤 이앙은 6월 4일에 재식거리는 30×15 cm 간격으로 주당 1본씩 한 품종당 4열씩 심었다. 아밀로스 함량 분석을 위한 시료는 출수생태형에 따라 조생종, 중생종, 및 중만생종을 각각 출수 후 45일, 50일 및 55일에 수확하였다. 아밀로스 함량은 Juliano의 비색검정법(Juliano 1971)에 따라 분석시료를 전처리 한 후 UV-VIS spectrophotometer (UV-2700, Shimadzu Co, Japan)를 이용하여 측정하였다. 쌀가루 0.1 g을 1 mL 에탄올과 9 mL 1 N NaOH를 가한 후 10분간 항온조건에서 호화시킨 샘플에 증류수를 더해 용량을 100 mL로 맞췄다. 그 중 5 mL을 취하여 1 mL의 acetic acid, 2 mL의 2% I-KI (iodine solution)을 가한 샘플에 증류수를 더해 용량을 100 mL로 맞춘 다음 20분 후 620 nm 파장에 대한 흡광도를 측정했다. 이 값을 표준검량식에 대입해 아밀로스 함량을 구했다.

Genomic DNA 추출

Genomic DNA는 벼의 어린 잎을 채취하여, CTAB 방법(Murray & Thompson 1980)을 응용하여 다음과 같이 추출했다. 벼 어린 잎 3~4 cm와 3 mm 마쇄용 구슬(Masuda, Cat, 12-410-032) 1개를 2 mL Eppendorf tube (Axygen, MCT-200)에 넣고 액체질소에 5~10분간 침적시킨 후 1분간 vortex했다. 마쇄된 잎 샘플에 700 µL의 DNA Extraction buffer (Biosesang)를 넣고, 65℃로 30분 처리했다. 마쇄된 잎 샘플과 DNA Extraction buffer 혼합물에 700 µL CI 용액(chloroform:isoamylalcohol=24:1)을 첨가하여 10분간 교반한 후 13,000 rpm으로 15분간 원심분리하여 500 µL 상등액을 1.5 mL Eppendorf tube에 옮겼다. 상등액에 1000 µL의 90% ethanol을 첨가하여 2~3회 혼합한 후 -20℃로 2시간 처리한 뒤 13,000 rpm에서 10분간 원심분리하여 상등액을 버리고 침전물을 70% ethanol로 세정 후 건조했다. 추출된 DNA는 TE buffer (10 mM Tris-HCL, pH 8.0; 2.5 mM EDTA)에 녹여 PCR에 이용했다.

유전자형 분석

유전자형 분석을 위해 KASP마커 및 InDel, CAPS 마커를 사용했다. KASP 마커는 모부본 다형성을 분석하여 다형성을 보인 아밀로스 함량 관련 마커 3개를 이용했다(Shao et al. 2020). PCR 플레이트 한 well당 KASP-TF V4.0 2×Master Mix (LGC Genomics, London, UK) 4.86 µL, KASP by Design Primer Mix 0.14 µL에 1 µL당 DNA 총량이 5 ng이 되도록 희석한 DNA 샘플을 5 µL 분주한 뒤 Cheon et al. (2018)이 보고한 바에 따라 Touchdown PCR 방식으로 PCR했다. PCR 단계는 다음과 같았다. 우선 15분간 94℃로 유지한 뒤, 94℃ 20초, 61℃ 1분간 유지하는 2단계로 이루어진 과정을 10번 반복했다. 이후 94℃ 20초, 55℃ 1분간 유지하는 과정을 26번 반복하고, 37℃에서 1분간 유지한 뒤 형광 측정 전까지 샘플 온도를 4℃로 유지했다. PCR 산물은 Real Time PCR (QuantStudio 3, appliedbiosystems)로 형광을 측정 했다. InDel 및 CAPS 마커는 기존에 보고된 Wx 유전자 관련 마커를 이용했다(Sato et al. 2002, Wanchana et al. 2003, Yamanaka et al. 2004). 각 마커별 PCR 단계는 다음과 같았다. Glu-23 마커는 프라이머를 10 pmole/µL 농도로 0.5 µL씩 첨가하고, DNA 5 µL (50 ng/µL), dNTP 0.8 µL (0.2 mM), 10×buffer 1.5 µL, Taq 0.1 µL (1.25 unit), dH2O 6.6 µL를 첨가한 뒤 PCR 반응시켰다. Wx-mq 마커는 네 가지의 프라이머를 모두 20 pmole/µL 농도로 1 µL씩 첨가하고, DNA 2 µL (50 ng/µL), dNTP 1 µL (0.2 mM), Taq 0.2 µL (2.5 unit), dH2O 12.8 µL를 첨가한 뒤 PCR 반응시켰다. PCR 단계는 94℃에서 5분 처리 후 94℃ 1분, 69℃ 1분, 72℃ 2분 유지하는 3단계로 이루어진 과정을 28번 반복했다. 이후 72℃에서 5분 처리 후 4℃ 냉장보관했다. Wx_a,b 마커는 프라이머를 10 pmole/µL 농도로 0.5 µL씩 첨가하고, DNA는 50 ng/µL 농도로 5 µL, 0.2 mM dNTP 0.8 µL, 10×buffer 1.5 µL, Taq 0.1 µL, dH2O 6.6 µL를 첨가한 뒤 PCR 반응시켰다. 먼저 94℃에서 2분 처리 후 94℃ 30초, 55℃ 30초, 72℃ 1분 유지하는 3단계로 이루어진 과정을 35번 반복했다. 이후 72℃에서 5분 처리 후 반응을 마친 PCR 산물을 제한효소 처리 전까지 4℃ 냉장보관했다. PCR 산물 20 µL당 5 µL의 비율로 EcoT14I를 첨가하고 37℃에서 하룻밤 처리했다. PCR 및 제한효소 처리를 마친 샘플은 아가로스 겔에서 전기영동 한 뒤 자외선 조명을 비추어 촬영한 사진을 바탕으로 유전자형을 분석했다.

결과 및 고찰

국내 육성 벼 285품종 아밀로스 함량 분포

벼 285품종 보통기 재배 시 백미 아밀로스 함량 평균은 17.9%이며 표준편차는 3.81이었다(Fig. 1, Table 1). 자포니카 251품종 중 찰벼는 19품종, 저아밀로스벼는 5품종, 메벼는 223품종, 고아밀로스벼는 4품종이었고, 통일형 34품종 중 찰벼는 3품종, 저아밀로스벼는 0품종, 메벼는 22품종, 고아밀로스벼는 9품종이었다(Table 2). Bao et al. (1990)은 벼 전분의 신속점도계(RVA) 측정 결과는 벼의 외관상 아밀로스 함량(AAC)와 강한 상관관계가 있으며, 마커 유전자형 데이터와 함께 분석한 결과 Wx 유전자가 신속점도계로 측정되는 벼 전분의 이화학적 성질을 좌우하는 주요 유전자라고 보고하였다. 따라서 벼 전분 관련 형질 육종 시 Wx 유전자의 대립유전자형을 분자마커를 활용하여 미리 파악 가능하다면 아밀로스 함량을 수확기 전에 예측할 수 있기 때문에 보다 효율적인 육종이 가능할 것이다.

Table 1

Amylose Content and Heading Date of 285 Korean rice cultivars

Cultivars Ecotype Heading Date* Amylose Content (%)
Odae Japonica 8/3 17.6
Unbong Japonica 8/2 16.5
Geumo Japonica 8/4 17.5
Jinmi Japonica 8/6 16.6
Obong Japonica 8/2 17.7
Namwon Japonica 7/31 18.9
Jinbu Japonica 8/3 12.8
Jinbuol Japonica 7/25 16.4
Sinunbong Japonica 8/4 17.6
Sangju Japonica 8/4 17.3
Dunnae Japonica 8/3 17.8
Joryeong Japonica 8/4 18.6
Unjang Japonica 8/2 16.9
Samcheon Japonica 8/4 17.2
Junghwa Japonica 8/4 16.6
Keumobyeo2 Japonica 8/15 16.6
Guru Japonica 8/5 17.4
Sangjuchal Japonica 8/7 8.3
Undoo Japonica 7/30 16.6
Manan Japonica 8/5 18.5
Jeogjinju Japonica 8/4 17.0
Taebong Japonica 8/2 16.4
Jungsan Japonica 8/7 18.1
Saesangju Japonica 8/5 17.0
Manchoo Japonica 8/4 17.5
Manho Japonica 8/3 18.0
Namil Japonica 8/7 18.1
Joan Japonica 8/2 16.6
Heugkwang Japonica 8/13 18.3
Goun Japonica 8/1 16.6
Unkwang Japonica 8/4 17.6
Josaengheugchal Japonica 8/6 8.4
Odae1ho Japonica 8/3 17.1
Sinunbong1 Japonica 8/3 18.0
Manna Japonica 8/2 18.1
Keumo3 Japonica 8/2 18.8
Hwangkeumbora Japonica 8/4 19.0
Sandeuljinmi Japonica 8/5 18.2
Junamjosaeng Japonica 8/5 18.6
Pyeongwon Japonica 8/4 16.6
Unmi Japonica 8/4 16.9
Handeul Japonica 8/9 17.4
Jogwang Japonica 8/5 18.1
BoSeog Japonica 8/1 19.4
Joami Japonica 8/5 17.6
Hanseol Japonica 7/31 18.2
Joun Japonica 7/31 18.5
Geumyoung Japonica 8/4 17.7
Manjong Japonica 8/13 19.2
Wolbaek Japonica 8/4 13.6
Jopyeong Japonica 8/1 18.3
Jeogjinjuchal Japonica 8/7 7.9
Cheongbaekchal Japonica 8/2 8.0
Seolemi Japonica 8/5 17.5
Joeunheukmi Japonica 8/4 16.9
Saeodae Japonica 8/3 19.8
Jinseolchal Japonica 7/27 8.3
Jungmo1024 Japonica 8/4 18.0
Sanhomi Japonica 8/4 18.0
Hwawang Japonica 8/6 17.6
Nunkeunheugchal Japonica 8/6 8.3
Asemi Japonica 8/5 19.2
Ondami Japonica 8/5 18.0
jungmo1032 Japonica 7/30 18.9
Jinok Japonica 8/1 17.8
BaegIlmi Japonica 7/26 17.2
Asemi1ho Japonica 8/8 18.7
Haedamssal Japonica 8/6 19.7
Unilchal Japonica 8/7 8.9
Jungmo1043 Japonica 8/5 19.1
Jinhan Japonica 8/3 17.9
Jopum Japonica 7/30 18.0
Joil Japonica 8/6 17.6
Danpyeong Japonica 8/5 19.0
Unbaekchal Japonica 8/4 8.4
Jinkwang Japonica 8/6 17.1
Seongsan Japonica 8/7 18.6
Jonong Japonica 8/9 19.2
Shinpyeong Japonica 8/4 17.4
CW92MR Japonica 8/7 17.2
Haedeul Japonica 8/10 17.4
IS592BB Japonica 8/5 16.7
Sinseonchalbyeo Japonica 8/11 7.8
Giho Japonica 8/15 17.7
Hwaseong Japonica 8/16 17.9
Yeongdeog Japonica 8/14 18.5
Palgong Japonica 8/12 18.0
Hwajin Japonica 8/15 19.3
Janngan Japonica 8/12 18.3
Seoan Japonica 8/13 17.2
Hwayeong Japonica 8/14 17.2
Hwaseonchal Japonica 8/12 8.1
Gancheok Japonica 8/13 19.0
Hwajung Japonica 8/12 19.8
Daeripbyeo 1 Japonica 8/15 20.1
Nongan Japonica 8/16 16.6
Juan Japonica 8/13 17.3
Keumobyeo 1 Japonica 8/11 17.9
Naepung Japonica 8/10 17.4
Daejin Japonica 8/17 18.6
Sura Japonica 8/15 17.6
Hwabong Japonica 8/16 18.1
Jinpum Japonica 8/13 19.2
Sobi Japonica 8/15 17.8
Seolhyangchal Japonica 8/11 8.3
Sampyeong Japonica 8/15 18.6
Hwaan Japonica 8/14 19.4
Manpung Japonica 8/16 19.4
Haepyeong Japonica 8/12 17.2
Saegyehwa Japonica 8/18 18.9
Manwol Japonica 8/16 18.9
Yeongan Japonica 8/17 19.1
Geuman Japonica 8/18 18.5
Daepyeong Japonica 8/18 18.2
Samdeog Japonica 8/15 18.3
Pungmi Japonica 8/12 16.9
Boseogchal Japonica 8/14 8.0
Haepyeongchal Japonica 8/14 7.9
Seoan1 Japonica 8/17 19.4
Geunnun Japonica 8/17 16.5
Cheonga Japonica 8/12 18.4
Gangbaek Japonica 8/16 18.7
Haechanmulgyeol Japonica 8/14 19.2
Donghaejinmi Japonica 8/17 19.4
Cheongdam Japonica 8/15 19.3
Hongjinju Japonica 8/16 17.9
Cheongan Japonica 8/15 19.2
Borami Japonica 8/18 20.4
Heugseol Japonica 8/16 17.4
Haeoreumi Japonica 8/16 17.8
Boseogheugchal Japonica 8/16 9.0
Migwang Japonica 8/19 19.1
Cheongnam Japonica 8/15 20.1
Suryeojinmi Japonica 8/15 18.8
Gangchan Japonica 8/19 17.5
Suan Japonica 8/17 20.0
Shinbaeg Japonica 8/20 18.6
Dongbo Japonica 8/18 18.3
Jungsaenggold Japonica 8/15 16.2
Seonhyangheukmi Japonica 8/14 17.5
Daebo Japonica 8/15 17.1
Geonyang2 Japonica 8/18 11.3
Dabo Japonica 8/17 18.0
Dodamssal Japonica 8/17 39.1
Bodrami Japonica 8/17 19.6
Sinbo Japonica 8/19 18.8
Jungmo1034 Japonica 8/15 19.8
Haepum Japonica 8/18 19.2
Seonpum Japonica 8/16 17.7
Youngbo Japonica 8/15 17.6
Samkwang1 Japonica 8/16 17.2
Cheongpum Japonica 8/15 17.7
Sangbo Japonica 8/14 19.1
Heugjinmi Japonica 8/17 17.9
Boramchal Japonica 8/15 7.5
Jeogjinju2 Japonica 8/18 18.8
Dongjin Japonica 8/19 19.4
Daecheong Japonica 8/17 19.0
Tamjin Japonica 8/21 18.2
Kyehwa Japonica 8/20 17.5
Ilpum Japonica 8/18 18.2
Manguem Japonica 8/17 18.7
Hwanam Japonica 8/16 18.2
Daean Japonica 8/17 18.7
Yangjo Japonica 8/15 19.3
Hwasin Japonica 8/20 20.7
Hyangnam Japonica 8/18 18.4
Ilmi Japonica 8/18 18.7
Dongan Japonica 8/17 20.1
Hwasam Japonica 8/20 18.3
Daesan Japonica 8/21 19.4
Nampyeong Japonica 8/19 20.5
Heugnam Japonica 8/17 19.6
Aranghangchal Japonica 8/18 7.6
Hoan Japonica 8/19 19.5
Dongjinchal Japonica 8/16 7.6
Mihyang Japonica 8/17 19.5
Sindongjin Japonica 8/18 20.1
Sujin Japonica 8/21 19.1
Hojin Japonica 8/15 20.2
Heughyang Japonica 8/22 21.4
Junam Japonica 8/20 19.3
Goami Japonica 8/19 27.1
Dongin1 Japonica 8/20 19.6
Baegjinju Japonica 8/21 11.2
Seolgaeng Japonica 8/18 19.7
Goami2 Japonica 8/20 32.0
Manmi Japonica 8/18 13.6
Samkwang Japonica 8/19 19.3
Hopyung Japonica 8/19 19.5
Seopyeong Japonica - 19.0
Hwarang Japonica - 18.3
Gopum Japonica 8/17 18.8
Cheongho Japonica 8/16 20.2
Hanmaeum Japonica 8/16 18.9
Pungmi1 Japonica 8/10 16.7
Onnuri Japonica 8/17 19.3
Hanam Japonica 8/18 18.3
Dongjin2 Japonica 8/17 18.7
Baegjinju1ho Japonica 8/21 11.3
Hwangkeumnuri Japonica 8/20 19.4
Dami Japonica 8/19 19.7
Malgeumi Japonica 8/19 19.2
Hopum Japonica 8/17 18.4
Saenuri Japonica 8/19 20.2
Chilbo Japonica 8/17 18.4
Hwanggeumnodeul Japonica 8/19 19.3
Baegseolchal Japonica 8/16 7.4
Cheongcheongjinmi Japonica 8/17 20.5
Jinbaek Japonica 8/20 20.2
Dacheong Japonica 8/23 18.8
Jinsumi Japonica 8/19 19.3
Jungmo1006 Japonica 8/18 19.2
Deuraechan Japonica 8/19 19.1
Haiami Japonica 8/18 18.5
Baekogchal Japonica 8/21 6.5
Danmi Japonica 8/20 13.5
Cheonghaejinmi Japonica 8/19 19.3
Honong Japonica 8/21 19.3
Seomyeong Japonica 8/18 19.6
Younghojinmi Japonica 8/21 18.9
Jinbo Japonica 8/16 18.4
Boramchan Japonica 8/19 19.3
Anmi Japonica 8/16 16.9
Mipum Japonica 8/22 19.0
Chinnong Japonica 8/20 18.1
Geongganghongmi Japonica 8/20 20.1
Sodami Japonica 8/20 18.8
Sukwang Japonica 8/17 18.7
Huimangchan Japonica 8/16 19.0
Geonyangmi Japonica 8/18 19.7
SaeIlmi Japonica 8/19 19.7
Saegoami Japonica 8/18 27.1
Cheongun Japonica 8/18 19.4
Hyeonpum Japonica 8/20 20.5
Chindeul Japonica 8/22 17.9
Heugsujeong Japonica 8/19 18.9
Misomi Japonica 8/19 18.8
Anbaek Japonica 8/18 19.5
Manbaek Japonica 8/22 17.5
Saeshin Japonica 8/22 19.9
Cheonghyangheukmi Japonica 8/23 20.3
Sinjinbaek Japonica 8/21 19.7
Youngjin Japonica 8/20 20.3
Saechilbo Japonica 8/18 18.1
Miho Japonica 8/23 12.3
Aromi Japonica 8/20 18.1
MY299BK Japonica 8/17 18.0
Yechan Japonica 8/19 19.0
Saeilpum Japonica 8/17 17.8
Keunpum Japonica 8/15 19.3
Taebaek Tongil 8/10 17.9
Cheongcheong Tongil 8/19 17.0
Jungweon Tongil 8/12 19.3
Yongmun Tongil 8/10 16.7
Yongju Tongil 8/11 17.3
Dasan Tongil 8/12 17.0
Namcheon Tongil 8/13 17.9
Hyangmi2 Tongil 8/10 21.3
Anda Tongil 8/17 19.4
Areum Tongil 8/12 19.1
Hanareum Tongil 8/18 19.2
Dasan1 Tongil 8/14 17.3
Keunseom Tongil 8/18 17.4
Hangangchal1 Tongil 8/19 7.5
Dasan2 Tongil 8/14 18.6
Hanareum2 Tongil 8/15 17.2
Palbangmi Tongil 8/16 26.2
Mimyeon Tongil 8/13 26.6
Saemimyeon Tongil 8/20 26.6
Hanareumchal Tongil 8/19 6.8
Shingil Tongil 8/19 23.5
Hangangchal Tongil 8/19 7.5
Nampung Tongil 8/17 19.6
Jangseong Tongil 8/14 18.5
Hyangmibyeo1 Tongil 8/16 18.0
Segyejinmi Tongil 8/10 18.0
Hanareum3 Tongil 8/15 17.3
Hanareum4 Tongil 8/16 17.7
Geumgang1 Tongil 8/20 18.9
Mogwoo Tongil 8/29 25.3
Nokwoo Tongil 9/2 23.9
Yeongwoo Tongil 8/19 26.7
Cheongwoo Tongil 8/26 25.4
Miwoo Tongil 8/21 25.6

*Transplanted on 4th June, 2020



Table 2

Distribution of Amylose content of 285 Korean rice cultivars

Ecotype waxy Low amylose Intermediate amylose High amylose
Japonica 19 5 223 4
Tongil 3 0 22 9


Fig. 1. Amylose content distribution of 285 Korean rice cultivars

KASP 마커의 이점

최근에는 KASP와 같은 SNP 기반의 마커를 이용하여, Wx 유전자의 하플로타입을 더욱 다양하게 밝혀낼 수 있게 되었다. KASP 마커를 활용하면 전기영동에 걸리는 시간이 줄어들어 더욱 효율적으로 서로 다른 Wx 대립유전자를 가진 품종 및 계통 구별이 가능하다. 형광표지를 이용한 비 전기영동 방식의 분자마커 중에는 Taqman과 KASP마커가 가장 보편적인 것으로 알려져 있는데, KASP마커는 Taqman마커에 비해 제작비용이 저렴하다(Yang et al. 2020). 또한 Semagn et al. (2014)에 의하면 KASP 마커는 다른 SNP 마커들에 비해 평균 오류율이 0.7~1.6% 정도로 낮은 편이고 한 가지의 마커 세트로 다양한 집단에 대해 적용이 가능해 필요한 마커 수가 적어 효율적이다. 기존의 아가로스겔 기반의 마커는 PCR 후 전기영동 과정이 추가적으로 필요하기 때문에, 최근에는 대량 검정 및 분석 시간 단축을 위해 KASP, Taqman probe를 이용한 비 전기영동 방식의 분자마커 개발에 관한 연구가 활발히 진행되고 있다.

찰벼 품종 분류

Shao et al. (2020)Wx 유전자 특이적인 KASP 마커 6개를 보고하였으며, 이 중 K2-wx 마커는 2번 엑손의 G/23N SNP를 구별한다(Table 3, Fig. 2). 이 마커는 기존에 보고된 아가로스겔 기반 마커인 Glu-23과 타겟이 동일하다(Table 4). K2-wx 마커 검정 결과 23 bp 삽입을 가진 품종은 아랑향찰, 백설찰, 백옥찰, 보람찰, 보석찰, 보석흑찰, 청백찰, 동진찰, 해평찰, 한아름찰, 한강찰, 한강찰1호, 화선찰, 적진주찰, 진설찰, 조생흑찰, 눈큰흑찰, 상주찰, 설향찰, 신선찰, 운백찰, 운일찰로 총 22 개였고(Fig. 3A), 아밀로스 함량은 최저 6.5%, 최고 9.0%이며 평균 7.9%로 모두 찰벼 품종이다(Table 5).

Table 3

KASP marker information targeting Waxy gene

Marker Target SNP Primer Sequence
Allele X (FAM) Allele Y (HEX) Common
K1-Wxa/Wxb G/T TCATCAGGAAGAACATCTGCAAGG TCATCAGGAAGAACATCTGCAAGT GCCCAACACCTTACAGAAATTAGCA
K2-wx G/23N TTCCAGGGCCTCAAGCCCC GTTCCAGGGCCTCAAGCCCA CGCTGGTCGTCACGCTGA
YR-wxmq A/G GATGAACACACGGTCGACTCCAT ATGAACACACGGTCGACTCCAC GAGAGGGTGAGGTTTTTCCATTGCTA


Table 4

Gel-based marker information targeting Waxy gene

Marker Name Chr. Sequence Annealing Temp. (℃) Restriction Enzyme Traits related Reference
Forward Reverse
Wx_a,b 6 TGTTGTTCATCAGGAAGAACATCTCCAAG TTAATTTCCAGCCCAACACC 55 EcoT14I, 37℃, 1 h~over night high amylose Yamanaka et al. 2004. Theor Appl Genet 108:1200-1204
Glu-23 6 TGCAGAGATCTTCCACAGCA GCTGGTCGTCACGCTGAG 60 waxy Wanchana et al. 2003. Plant Sci 165: 1193-1199
Wx-mq 6 GGTGAGGTTTTTCCATTGCTACAAGCA GCCCTGGTAGGAGATGTTGTGGAT 69 low amylose Sato et al. 2002. Breeding Sci 52:131-135
CAAGTACGACGCAACCACGGTAAG GGTGGACTAGACGATCTGGGTTCAA


Table 5

Cultivars classified by Waxy SNP marker genotypes and their amylose content distribution

Marker SNP Cultivar Amylose Content (%)
Min. Max. Average
K1-Wxa/Wxb G Cheongwoo, Dodamssal, Goami, Mimyeon, Miwoo, Mogwoo, Nokwoo, Palbangmi, Saegoami, Saemimyeon, Yeongwoo 23.9 39.1 27.2
T Odae, etc. - - -
K2-wx G Odae, etc. - - -
23N Aranghangchal, Baegseolchal, Baekogchal, Boramchal, Boseogchal, Boseogheugchal, Cheongbaekchal, Dongjinchal, Haepyeongchal, Hanareumchal, Hangangchal, Hangangchal1, Hwaseonchal, Jeogjinjuchal, Jinseolchal, Josaengheugchal, Nunkeunheugchal, Sangjuchal, Seolhyangchal, Sinseonchal, Unbaekchal, Unilchal 6.5 9.0 7.9
YR-wxmq A Miho, Wolbaek 12.3 13.6 12.9
G Odae, etc. - - -

* Correlation analysis between amylose content and marker SNP type



Fig. 2. Location of SNPs of each KASP marker on Waxy gene

Fig. 3. KASP SNP marker genotyping result graph

벼의 찰성과 메성은 6번 염색체 Wx 유전자의 2번 엑손 내 염기서열의 중복에 의해서 구분된다고 보고되어 있으며, 이 영역의 InDel을 대상으로 Glu-23 마커가 개발되었다(Wanchana et al. 2003). 해당 마커는 자포니카형 및 통일형 찰벼에서 동일한 유전자형을 나타내었다(Table 6, Fig. 4A). 이와 같은 결과를 통해 기존의 아가로스 겔 기반 분자마커로도 찰벼를 선발하는 것이 가능하다고 판단된다. 그러나 아가로스 겔 기반 분자마커는 검정 과정에서 PCR 후 전기영동 과정을 수행해야 하므로, KASP 마커를 활용하는 것이 편리하다. K2-wx 마커 염기서열의 상동성을 분석한 결과 기존에 알려진 찰벼 대립유전자 wx에 있는 23 bp 중복염기서열 영역을 대상으로 제작된 마커임을 확인했다.

Table 6

Classification of Korean rice cultivars by Amylose content and KASP marker genotype

Classification Cultivars amylose content K1-Wxa/Wxb K2-wx YR-wxmq
Intermediate amylose (CK) Odae (CK) 17.6 T G G
Nampyeong (CK) 20.5 T G G
Hwayeong (CK) 17.2 T G G
Dasan (CK) 17.0 T G G
Waxy Aranghangchal 7.6 T 23N G
Baegseolchal 7.4 T 23N G
Baekogchal 6.5 T 23N G
Boramchal 7.6 T 23N G
Boseogchal 8.0 T 23N G
Boseogheugchal 9.0 T 23N G
Cheongbaekchal 8.0 T 23N G
Dongjinchal 7.6 T 23N G
Haepyeongchal 7.9 T 23N G
Hanareumchal 6.8 T 23N G
Hangangchal 7.5 T 23N G
Hangangchal1 7.5 T 23N G
Hwaseonchal 8.1 H 23N G
Jeogjinjuchal 7.9 T 23N G
Jinseolchal 8.3 T 23N G
Josaengheugchal 8.4 T 23N G
Nunkeunheugchal 8.3 T 23N G
Sangjuchal 8.3 T 23N G
Seolhyangchal 8.3 T 23N G
Sinseonchal 7.8 T 23N G
Unbaekchal 8.4 T 23N G
Unilchal 8.9 T 23N G
Low amylose Baegjinju 11.2 T G G
Baegjinju1ho 11.3 T G G
Geonyang2 11.3 T G G
Miho 12.3 T G A
Wolbaek 13.6 T G A
High amylose Cheongwoo 25.4 G G G
Dodamssal 39.1 G G G
Goami 27.1 G G G
Goami2 32.0 T G G
Mimyeon 26.6 G G G
Miwoo 25.6 G G G
Mogwoo 25.3 G G G
Nokwoo 23.9 G G G
Palbangmi 26.2 G G G
Saegoami 27.1 G G G
Saemimyeon 26.6 G G G
Shingil 23.6 T G G
Yeongwoo 26.7 G G G


Fig. 4. Gel-based marker genotyping result

밀키퀸 후대 저아밀로스벼 품종 분류

Wx 유전자의 돌연변이로 인해 저아밀로스 특성을 나타나게 하는 Wx-mq 대립유전자를 구별하기 위해 제작된 YR-wxmq 마커는 4번 엑손의 A/G SNP를 구별한다(Table 3, Fig. 2). YR-wxmq 마커 검정 시 Sato et al. (2002)이 보고한 마커와 마찬가지로 국내 육성 벼 285품종 중 밀키퀸 후대를 구별 가능했다. Wx 유전자에서 해당 마커 위치에 A SNP가 있어 Wx-mq 대립유전자를 가진 것으로 나타난 품종은 미호, 월백 두 품종이었고(Fig. 3B), 이들은 모두 밀키퀸 후대 품종이다. 두 품종의 아밀로스 함량은 각각 12.3%, 13.6%이고 평균은 12.9%이었다(Table 5). 다른 저아밀로스 품종 중 백진주와 백진주1호는 du1 유전자에 의해 저아밀로스 형질을 나타내기 때문에 YR-wxmq 마커는 월백, 미호와 달리 G SNP를 가지는 것으로 나타났다(Table 6). 또한 건양2호의 저아밀로스 형질과 밀접히 연관된 SSR 마커는 선발되었으나 원인 유전자좌는 아직 명확히 밝혀지지 않아 추가적으로 유전연구가 필요하다. 한편 아가로스겔 기반 마커 Wx-mq는 염기 치환 부위에 따라 Wx-mq 대립유전자 특이적인 유전자 단편이 증폭되도록 고안된 마커이다(Table 4). 이 마커를 이용해 국내 벼 품종 중 밀키퀸 후대 저아밀로스벼 품종 구분이 명확하게 가능하였다(Fig. 4B). 그러나 Wx-mq 마커는 KASP 마커에 비해 검정시 필요한 프라이머 수가 많고 전기영동 과정이 추가적으로 필요하여 시간 및 비용 측면에서 비효율적이다.

고아밀로스벼 품종 분류

Shao et al. (2020)이 보고한 고아밀로스 품종 특이적인 마커 K1-Wxa/Wxb를 이용하여(Table 3) 국내 육성 285개 품종의 유전자형을 분석한 결과 고아밀로스 대립유전자 Wxa 특이적인 G SNP를 가진 품종은 청우, 도담쌀, 고아미, 미면, 미우, 목우, 녹우, 팔방미, 새고아미, 새미면, 영우 11품종으로 모두 고아밀로스 품종이었다. Wxa 대립유전자를 가진 품종들의 아밀로스 함량은 최저 23.9%, 최고 39.1%, 평균 27.2%이었다(Table 5, Fig. 2). Wxb를 가진 품종은 오대벼 등 274품종이었다. 한편, 고아밀로스 품종으로 알려진 고아미2호와 신길은 T base 대립유전자형을 가지고 있었다(Table 6, Fig. 3C).

따라서 고아미 2호와 신길은 Wx 유전자좌에 위치한 고아밀로스 대립유전자 특이적인 SNP를 가지고 있지 않고 Wx 외의 다른 유전자의 변이에 의해 고아밀로스 형질을 나타내는 것으로 판단된다. Butardo et al. (2012)은 고아미 2호는 Starch Branching Enzyme (SBE) 유전자가 결실에 의해 아밀로스 함량이 증가하는 amylose extender (AE) 유전자를 가지고 있는 것으로 보고한 바 있다. 또한 신길은 기존의 고아밀로스 품종보다 아밀로스 함량이 약 2% 정도 낮은 특성을 가지고 있는데, 이러한 특성을 나타내는 원인 유전자는 기존의 Wx 유전자와 다른 염색체에 위치하는 것으로 판단된다. 위의 연구결과들을 종합하여 보았을 때, 고아미 2호와 신길의 고아밀로스 형질에 대해 유전분석과 유전자 지도 작성 등의 연구가 추가적으로 필요할 것으로 판단된다.

아밀로스 함량에 따라 벼 품종을 판별할 수 있는 분자마커들은 다양하게 보고되어 있다. SSR 마커인 RM190은 (CT)n 반복수가 10개 이하일 경우 고아밀로스 품종으로 분류 가능해 아가로스 겔 이미지만으로 쉽게 품종 판별이 가능하다. 한편, 국내 육성 고아밀로스 품종인 고아미와 새고아미는 SSR 마커를 이용한 유전자형 분석에서 일반 메벼와 구분이 불가능했다. 이는 이들 품종의 유전적 배경이 잡초성 벼(weedy rice)인 김천앵미와 영동앵미에서 유래되어 기존에 알려진 인디카 유래 Wx 대립유전자를 가져 고아밀로스 형질을 나타내는 품종들과 다른 유전적 배경을 가지기 때문인 것으로 판단된다.

한편, Yamanaka et al. (2004)이 보고한 Wx_a,b CAPS 마커는 KASP 마커인 K1-Wxa/Wxb 마커와 동일하게 Wx 유전자의 G/T SNP가 타겟이다(Table 4). Wx_a,b 마커도 고아밀로스 벼 품종 구분이 가능하였지만(Fig. 4C), PCR 후 전기영동 전에 제한효소 처리가 추가적으로 필요하기 때문에, 동일한 SNP를 타겟으로 제작된 KASP 마커를 활용하는 것이 시간 및 비용 측면에서 더 효율적이다.

적 요

본 연구는 국내 육성 벼 285품종을 이용하여 Waxy (Wx)유전자 상에서 다형성을 보이는 SNP 마커 중 아밀로스 함량 유전자 관련 마커 3개로 유전자형을 분석했다. 아밀로스 함량의 평균은 17.9%, 표준편차는 3.82이었다. 고아밀로스 대립유전자 Wxa 특이적인 K1-Wxa/Wxb 마커는 6번 염색체 1.77 Mb의 G/T SNP를 구별하며, G base 대립유전자형을 가진 품종은 고아미 등 고아밀로스 품종이었다. 해당 고아밀로스 품종들의 아밀로스 함량 범위는 23.9%~39.1%이고, 평균은 27.2%이었다. K2-wx 마커는 6번 염색체 1.77 Mb의 G/23N SNP를 구별하며, 이 중 Wx 유전자에 23 bp 삽입이 있는 wx 대립유전자를 가진 품종이 모두 찰벼로 구분되었다. 찰벼 품종의 아밀로스 함량 범위는 6.5~9.0%이고 평균은 7.9%였다. 또한 Wx 유전자 돌연변이로 인해 저아밀로스 특성을 나타나게 하는 Wx-mq 대립유전자를 갖고 있는 품종은 미호, 월백 두 품종이며 아밀로스 함량은 각각 12.3%, 13.6%, 평균은 12.9%이었다. Wx-mq 대립유전자 특이적인 YR-wxmq 마커는 A/G SNP를 구분하며 이 마커로 A SNP를 갖고 있어 Wx-mq 대립유전자로 인해 반찰성을 나타내는 월백과 미호를 다른 품종과 구분 가능했다. 따라서 Wx 유전자좌 상의 3개의 KASP 마커 모두 특정 범위의 아밀로스 함량을 가진 품종을 판별 가능한 마커인 것으로 판단된다. 이와 같은 결과는 국내 벼 품종 육성 시 아밀로스 함량 관련 유전체 선발에 유용한 정보가 될 것이다.

사 사

본 논문은 농촌진흥청 연구사업(과제번호: PJ01357203 영남지역에서의 국내 육성 벼 품종별 작물학적 특성 평가)의 지원에 의해 이루어진 것임.

References
  1. Bao J, He P, Xia Y, Chen Y, Zhu L. 1999. Starch RVA profile parameters of rice are mainly controlled by Wx gene. Chinese Sci Bull 44: 2047-2051.
    CrossRef
  2. Bao J, Corke H, Sun M. 2006. Microsatellites, single nucleotide polymorphisms and a sequence tagged site in starch-synthesizing genes in relation to starch physicochemical properties in nonwaxy rice (Oryza sativa L.). Theor Appl Genet 113: 1185-1196.
    Pubmed CrossRef
  3. Cagampang GB, Perez CM, Juliano BO. 1973. A gel consistency test for eating quality of rice. J Sci Food Agr 24: 1589-1594.
    Pubmed CrossRef
  4. Chen N, Luo Y, Xie L, Zhu Z, Duan B, Zhang L. 2006. Protein content and its correlation with other quality parameters of rice in China. Acta Agronomica Sinica 32: 1193.
  5. Fuller DQ, Qin L, Zheng Y, Zhao Z, Chen X, Hosoya LA, Sun G-P. 2009. The domestication process and domestication rate in rice: spikelet bases from the Lower Yangtze. Science 323: 1607-1610.
    Pubmed CrossRef
  6. Hansen J, Fuller F, Gale F, Crook F, Wailes E, Moore M. 2002. China's japonica rice market: growth and competitiveness. Rice situation and outlook yearbook. p. 32-37.
  7. Huang F, Sun Z, Hu P, Tang S. 1998. Present situations and prospects for the research on rice grain quality forming. Chin J Rice Sci 12: 172-176.
  8. Ise K, Akama Y, Horisue N, Nakane A, Yokoo M, Ando I, Hata T, Suto M, Numaguchi K, Nemoto H. 2001. Milky Queen, a new high-quality rice cultivar with low amylose content in endosperm. Bulletin of the National Institute of Crop Science (Japan)..
  9. Isshiki M, Yamamoto Y, Satoh H, Shimamoto K. 2001. Nonsense-mediated decay of mutant waxy mRNA in rice. Plant Physiol 125: 1388-1395.
    Pubmed KoreaMed CrossRef
  10. Juliano B. 1971. A simplified assay for milled rice amylose. Cereal Sci Today 16: 334-360.
  11. Juliano B. 1985. Criteria and tests for rice grain qualities. pp. 443-524. In: Houston DF (Ed) Rice Chemistry and Technology. American Association of Cereal Chemists, Minnesota, USA.
  12. Kumar I, Khush G, Juliano B. 1987. Genetic analysis of waxy locus in rice (Oryza sativa L.). Theor Appl Genet 73: 481-488.
    Pubmed CrossRef
  13. Lee K-H, Yoon S-D, Lee J-H, Won Y-J, Choi I, Park H-Y, Woo K-S, Oh S-K. 2016. Studies on the degree of polymerization of amylopectin and texture analysis test of brown rice after germination. Korean J Crop Sci 61: 1-8.
    CrossRef
  14. Lestari P, Ham T-H, Lee H-H, Woo M-O, Jiang W, Chu S-H, Kwon S-W, Ma K, Lee J-H, Cho Y-C. 2009. PCR marker-based evaluation of the eating quality of japonica rice (Oryza sativa L.). J Agr Food Chem 57: 2754-2762.
    Pubmed KoreaMed CrossRef
  15. Little RR. 1958. Differential effect of dilute alkali on 25 varieties of milled white rice. Cereal Chem 35: 111-126.
  16. Murray M, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8: 4321-4326.
    Pubmed KoreaMed CrossRef
  17. Ramesh M, Bhattacharya K, Mitchell J. 2000. Developments in understanding the basis of cooked-rice texture. Crit Rev Food Sci 40: 449-460.
    Pubmed CrossRef
  18. Sano Y. 1984. Differential regulation of waxy gene expression in rice endosperm. Theor Appl Genet 68: 467-473.
    Pubmed CrossRef
  19. Sato H, Suzuki Y, Sakai M, Imbe T. 2002. Molecular characterization of Wx-mq, a novel mutant gene for low-amylose content in endosperm of rice (Oryza sativa L.). Breeding Sci 52: 131-135.
    CrossRef
  20. Semagn K, Babu R, Hearne S, Olsen M. 2014. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Mol breeding 33: 1-14.
    CrossRef
  21. Shao Y, Peng Y, Mao B, Lv Q, Yuan D, Liu X, Zhao B. 2020. Allelic variations of the Wx locus in cultivated rice and their use in the development of hybrid rice in China. PloS one 15: e0232279.
    Pubmed KoreaMed CrossRef
  22. Suto M. 1996. Breeding of low amylose content paddy rice variety "milky queen" with good eating quality. Jpn J Breed 46: 221.
  23. Teng B, Zeng R, Wang Y, Liu Z, Zhang Z, Zhu H, Ding X, Li W, Zhang G. 2012. Detection of allelic variation at the Wx locus with single-segment substitution lines in rice (Oryza sativa L.). Mol Breeding 30: 583-595.
    CrossRef
  24. Wanchana S, Toojinda T, Tragoonrung S, Vanavichit A. 2003. Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.). Plant Sci 165: 1193-1199.
    CrossRef
  25. Wang Z-Y, Wu Z-L, Xing Y-Y, Zhang F-Q, Guo X-L, Zhang WG. 1992. Molecular characterization of rice Wx gene. Sci China, Ser B 35: 558-565.
  26. Wang Z-Y, Wu Z, Xing Y, Zheng F, Guo X, Zhang W, Hong M. 1990. Nucleotide sequence of rice waxy gene. Nucleic Acids Res 18: 5898.
    Pubmed KoreaMed CrossRef
  27. Yamanaka S, Nakamura I, Watanabe KN, Sato Y-I. 2004. Identification of SNPs in the waxy gene among glutinous rice cultivars and their evolutionary significance during the domestication process of rice. Theor Appl Genet 108: 1200-1204.
    Pubmed CrossRef
  28. Yang S, Yu W, Wei X, Wang Z, Zhao Y, Zhao X, Tian B, Yuan Y, Zhang X. 2020. An extended KASP-SNP resource for molecular breeding in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Ploss one 15: e0240042.
    Pubmed KoreaMed CrossRef
  29. Zhang C, Zhu J, Chen S, Fan X, Li Q, Lu Y, Wang M, Yu H, Yi C, Tang S. 2019. Wxlv, the ancestral allele of rice Waxy gene. Mol Plant 12: 1157-1166.
    Pubmed CrossRef


December 2021, 53 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information