search for




 

Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross
저항성 유전자 도입과 벼 후대계통의 열악형질간의 관계분석
Korean J. Breed. Sci. 2021;53(4):392-403
Published online December 1, 2021
© 2021 Korean Society of Breeding Science.

Chang-Min Lee1, Hyun-Su Park1, Man-Kee Baek1, Jung-Pil Suh1, O-Young Jeong1, Song-Joong Yun2, and Suk-Man Kim1,3*
이창민1⋅박현수1⋅백만기1⋅서정필1⋅정오영1⋅윤성중2⋅김석만1,3*

1Department of Crop Breeding, National Institute of Crop Science (NICS), Rural Development Administration (RDA), Wanju, 55365, Republic of Korea
2Department of Crop Science & Biotechnology, Jeonbuk National University, Jeonju, 54896, Republic of Korea
3Department of Ecological & Environmental system, Kyungpook National University, Sangju, 37224, Republic of Korea
1농촌진흥청 국립식량과학원 작물육종과, 2전북대학교 작물생명과학과, 3경북대학교 생태환경시스템학부
Correspondence to: (E-mail: s_kim@knu.ac.kr, Tel: +82-54-530-1206, Fax: +82-54-530-1209)
Received September 13, 2021; Revised November 11, 2021; Accepted November 11, 2021.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Interspecific and intersubspecific crosses have been an important strategy for rice breeding programs to obtain useful characters by expanding genetic diversity. However, the wide cross routinely causes undesirable characters in rice, such as spikelet sterility and poor quality. In this study, we developed near-isogenic lines of R-gene (Xa4+xa5+Xa21+Pi40+Bph18) introgression population to investigate the genetic relationship between the occurrence of poor characters and R-genes induced by MAS. The ANOVA analysis revealed that Pi40, Bph18, and Xa4 were associated with spikelet fertility (SF), ratio of ripened grain (RRG), third internode length (TIL), panicle extraction (PE), and protein content (Pro), whereas others showed no association with the 14 traits tested. In the three-way ANOVA, the impact of two R-genes (Pi40 and Bph18) on the poor characters was independent, with no interaction with others. Quantitative trait locus (QTL) analysis identified QTLs for PE and TIL traits near Pi40, and in particular, QTLs for five traits (SF, RRG, TIL, PE, and Pro) were negatively affected around Bph18. The occurrence of a poor character in R-gene pyramiding lines could be associated with linkage drag caused by the Bph18 gene. We speculate that the development of DNA markers that effectively eliminate poor characters will not only improve breeding efficiency using MAS, but will also help improve traits of japonica rice through wide crossing.
Keywords : rice, wide cross, poor character, resistance genes, QTLs
서 언

벼는 아시아를 중심으로 전 세계적으로 가장 넓은 면적에서 재배되고 있는 주요 식량작물 중 하나이다. 최근 이상 기후로 인한 기온 상승 및 집중 호우 등으로 병해충 발생이 빈번해지고 있으며, 새로운 병해충 발병 가능성 증대는 벼 수량 안전성을 크게 위협하고 있다(Choi et al. 2015, Seo et al. 2020, Suh et al. 2015). 국내에서는 벼흰잎마름병, 도열병 등이 벼에 가장 피해를 많이 주고 있으며, 해충은 벼멸구에 의한 피해가 가장 큰 편이다(Lee et al. 2011). 2020년 기준 흰잎마름병 발생면적은 22,372 ha였고, 도열병 발생면적은 95,196 ha, 벼멸구 발생면적은 49,868 ha였다(NCPMS: National Crop Pest Management System, http://ncpms.rda.go.kr/npms). 병해충 방제를 위한 가장 효과적인 방법은 저항성 품종을 육종 하는 것이다(Kwak et al. 2007). 국내 최근 육성 품종에는 흰잎마름병 저항성 유전자인 Xa3xa5Xa21등이 이입된 품종(신진백)과 벼멸구 저항성인 Bph18 등이 도입된 품종(안미) 등이 대표적이다. 저항성 품종 육성을 위해 분자 마커를 이용한 마커 활용 선발법(Marker-assisted selection; MAS)을 활용하고 있지만 유전자 도입과 함께 다양한 열악형질이 동반이입(linkage drag) 되어 농업형질에 영향을 준다(Kim et al. 2013).

열악형질은 품질이나 형질특성이 기준보다 매우 떨어지고 나쁜 것을 말한다. 벼의 열악형질로는 수량과 품질에 영향을 주는 등숙률 및 임실률 저하, 미질 불량, 도복, 초형 불량 등이 있다(Park et al. 2014). 저항성품종 육성과정에서 표현형 및 MAS 선발을 병행하여 우량형질을 가진 계통을 선발하고 있지만 대상 형질이 양적유전자나 환경요인에 영향을 받기 쉬워 개량이 쉽지 않은 실정이다. Park et al. (2016)은 흰잎마름병 저항성 증진을 위해 Xa1+Xa3+xa5+Xa21 유전자를 집적한 우량계통을 육성하였으나 육성계통에서 쇄미, 피해립, 분상질립이 증가하여 쌀 외관 품위가 떨어지고, 취반미의 윤기치도 낮아졌다고 보고하였다. Xa4, xa5, Xa21, Pi40, Bph18가 집적된 복합내병충성 계통육성의 경우 등숙률과 임실률이 모본보다 낮아졌으며(Suh et al. 2015), 저항성 유전자 집적 계통의 수장이 증가하여 도복위험이 증가하거나 수수와 임실률, 수당립수, 수량이 낮아졌다는 보고도 있었다(Ruengphayak et al. 2015). 한편 Park et al. (2014)Bph18이 도입되면 간장이 길어지고 임실률과 등숙률이 낮아지는 경향이 있다고 보고하였다. 또한 Lee et al. (2005)는 벼멸구 저항성 유전자와 도복지수, 임실률, 현미의 품질이 연관되어 있다고 보고하였다. 이와 같이 원연교배로 인한 수많은 교잡 불화합성 보고가 있었으나, 그 원인을 실험적으로 특정하거나, 유전자도입과 열악형질 발현 간의 유전적 규명에 대한 연구가 부족한 실정이다. 이것은 저항성 품종육성을 위해 MAS를 이용하면 정확하게 내병충성 계통을 육성할 수 있는 장점이 있지만, 예상하지 못한 열악형질이 후세대에서 확인될 때에는 품종화를 위한 육종 시간과 노력이 여전히 많이 들게 하는 이유가 되고 있다. 따라서 다양한 저항성 유전자가 이입될 때, 이와 연관된 열악형질과의 관계를 분석하고 열악형질을 효과적으로 제거할 수 있는 체계적인 연구가 필요하다.

본 연구는 진부벼와 진부벼 배경의 GPL-40을 이용하여 복합내병충성 재조합자식계통(Recombinant inbred lines; RILs)을 육성하였고 RIL 집단을 이용하여 저항성유전자와 열악형질 간 관계를 통계적으로 분석하여 그 연관성을 규명하고자 수행하였다.

재료 및 방법

시험재료 육성

진부벼는 고품질 자포니카 조생종 벼 품종으로 내냉성이 우수하며, 벼흰잎마름병과 벼멸구에 감수성을 보인다. 반면 GPL-40 (SR32816(1)-40-2-B)은 복합내병충성 자포니카 계통으로 DNA 마커를 이용한 MAB (Maker assisted breeding)에 의해 육성되었다. 이 계통은 BC3F6까지 세대 진전한 진부벼 유전배경에 흰잎마름병 저항성유전자(Xa4+xa5+Xa21), 도열병 저항성유전자(Pi40) 그리고 벼멸구 저항성유전자(Bph18)를 포함하고 있으며, 주요 작물학적 특성평가를 거쳐 최종적으로 포장 선발되었다(Fig. 1). 5개 유전자가 집적된 GPL-40은 벼흰잎마름병, 벼멸구, 도열병에 저항성을 보이지만 진부벼에 비해 임실률 등에 있어 열악한 특성이 다소 발견된다. 열악형질을 평가하기 위하여 GPL-40을 화분친으로 다시 진부벼에 인공교배한 F1을 단립계통육종법(Single seed decent; SSD)으로 F6세대까지 고정시켜 RILs을 육성하였다. 이들 계통을 2019년과 2020년에 국립식량과학원 전주 시험포장에 재식거리 30×15 cm로 주당 1본식 이앙하였다.

Fig. 1. Procedures of development of the recombinant inbred lines from a cross of Jinbubyeo and GPL-40 (SR32816(1)-40-2-B). ABL1, ABL2, and ABL3 (BC3F6) plants are R-genes introgression lines with the genetic background of Jinbubyeo.

유전자마커를 이용한 저항성 검정

Genomic DNA는 샘플을 TissueLyserⅡ (Qiagen Co., Germany)로 마쇄한 후 BioSprint 96 DNA Plant Kit (Qiagen Co., Germany)를 이용하여 추출하였다. 식물체에 이입된 저항성 유전자들의 단편 확인은 해당 유전자 판별 분자 마커들인 10571.T14 (Xa4), 10603.T10Dw (xa5), U1+I1 (Xa21), 9871.T7E2b (Pi40), 7312.T4A (Bph18) (Jena et al. 2006)을 각각 이용하였다(Table 1). PCR은 추출한 gDNA (10 ng)에 AccuPower® PCR PreMix (Bioneer Co., Korea)를 이용하여 My-Genie 96 Thermal block (Bioneer Co., Korea)에서 수행되었다. PCR 증폭 산물은 필요한 경우 제한효소 처리 후 2% agarose gel에서 전기영동 하였으며, UV trans-illuminator를 이용하여 유전자형을 판정하였다.

Table 1

List of DNA markers used for validation of bacterial blight, blast, BPH resistance genes

R-genes Chr. No.z Marker name Primer sequences used for gene detection Exp. Size (bp) Enzyme Band type Reference
Forward (5'-3') Reverse (5'-3')
Xa4 11 10571.T14 TGTTGGAGGATTGGCAAGGAA TTCGTTGCGGCGTTGTTAATC 570 Tsp 509I Co-dominant Park et al. 2012
xa5 5 10603.T10Dw GCA CTG CAA CCA TCA ATG AAT C CCT AGG AGA AAC TAG CCG TCC A 280 Rsa I Co-dominant Park et al. 2012
Xa21 11 U1+I1 CGA TCG GTA TAA CAG CAA AAC ATA GCA ACT GAT TGC TTG G 1,400 None Co-dominant Park et al. 2012
Pi40 6 9871.T7E2b CAA CAA ACG GGT CGA CAA AGG CCC CCA GGT CGT GAT ACC TTC 642 Tsp 509I Co-dominant Jeung et al. 2007
Bph18 12 7312.T4A ACG GCG GTG AGC ATT GG TAC AGC GAA AAG CAT AAA GAG TC 1,078 Hinf I Co-dominant Jena et al. 2006

zChromosome number



농업형질 및 미질특성 분석

공시재료의 농업형질조사는 농촌진흥청 연구조사분석기준을 참고하여 조사하였다(RDA 2012). 출수기는 총 경수의 약 40%가 출수하였을 때를 기준으로 설정하였고, 출수일수는 파종일부터 출수기까지의 소요일수를 나타내었다. 간장, 수장, 수수, 임실률, 이삭추출도 등은 동일 계통내에서 5반복 조사하였다. 출수 후 약 45일경을 수확기로 하여 성숙이 제대로 이루어진 개체 3주를 예취하여 등숙률, 수당립수, 천립중을 조사하였다. 현미성분분석을 위해 시험용 제현기(SY88-TH, Ssang Yong Machine Ind., Korea)를 이용하여 제영한 현미를 Infratec 1241 Grain Analyzer (Foss Tecator, Hoganas, Sweden)을 이용하여 단백질과 아밀로스 함량을 분석하였다. 육성 품종의 농업형질 값은 2019-2020년 2년간의 평균 조사 값을 이용하였다.

QTL 분석 및 통계분석

QTL 분석을 위해 KASP 마커(Kompetitive Allele-Specific PCR)를 이용하여 양친의 다형성을 분석하였다(Table 2, Supplementary Fig. 1). 연관지도 작성 및 QTL 분석을 위해 양친검정에서 다형성을 보인 마커 128개를 선발하였고 IciMapping version 4.0 (CAAS, Beijing, China)을 이용하여 유전지도를 작성하였다. 마커의 그룹핑에는 ICIM의 ‘By LOD’, ‘By Input’ 옵션을 적용하였고, 각 형질별 통계적인 유의성을 확인하기 위하여 순열검정법(permutation test, n=1000)을 이용하여 QTL 분석(ICIM-ADD)을 수행하였다(Meng et al. 2015). 조사된 표현형 형질은 연관지도와 함께 QTL 분석 프로그램인 IciMapping version 4.0을 통해 목표 형질의 유전자좌 탐색에 이용되었다. LOD 임계값(logarithm of odds threshold)은 2.59로 계산되었다. 각 QTL의 이름은 McCouch가 제안한 명령법에 따라 명명되었다(McCouch 2008).

Table 2

Distribution of Kompetitive allele specific PCR (KASP) markers on 12 rice chromosomes exhibiting polymorphisms by the parental survey

Chr. No.z No. of markers No. of Polymorphic markersy % of Polymorphismx No. of selected
markers using QTL analysis
Interval (cM)w Chr. Length (cM)v
1 102 30 29 14 8.57 111.45
2 66 0 0 - - -
3 48 8 17 7 20.55 123.33
4 60 13 22 9 9.25 73.99
5 63 23 37 12 8.91 98.09
6 61 15 25 12 12.26 134.89
7 68 15 22 9 9.40 75.17
8 67 16 24 14 4.11 53.49
9 64 20 31 12 3.15 34.66
10 44 16 36 7 10.97 65.82
11 74 30 41 21 4.66 93.17
12 54 10 19 10 3.07 27.65
Total (Average) 771 196 (25) 127 (8.63) (30)

zChromosome number

yNumber of polymorphic markers between Jinbubyeo and GPL-40

xPercentage of polymorphism between Jinbubyeo and GPL-40

wAverage marker interval (cM)

vChromosome length in centimorgan (cM)



조사형질들과 병해충저항성 유전자 간 관련성을 통계적으로 구명하기 위하여 통계프로그램인 R (Version 3.6.3, The R Foundation for Statistical Computing Platform)을 이용하였다. 삼원분산분석을 통해 농업형질과 연관된 병해충저항성 유전자 간 상호작용을 분석하였다. 형질들의 상관분석은 corrplot 패키지를, 형질의 평균간 비교는 agricolae 패키지를 이용하여 수행하였다.

결 과

열악형질 평가를 위한 RIL 집단육성 및 특성조사

저항성 유전자 도입과 관련된 열악형질 분석을 위해 GPL-40을 진부벼와 재차 여교배하여 10립의 F1 종자를 생산하고, F2세대에서는 무작위로 240개체를 선발하였다. 이후 세대 고정을 위해 단립계통육종법으로 세대를 진전시키면서, 주요 농업적 형질에 대한 특성 평가 및 MAS를 이용한 유전자형을 평가하였다. 최종적으로 F6에서 농업형질과 유전형이 고정된 RILs 225개가 선발되었다.

도입된 저항성 유전자와 열악형질 발현과의 관계를 분석하기 위하여 양친과 RILs 집단의 주요 농업형질과 미질관련 형질, 형태학적 특성을 포함하여 총 14개의 형질에 대해 조사하였다(Fig. 2, Table 3). 양친인 진부벼와 GPL-40의 출수일수는 각각 98일, 106일로 GPL-40이 진부벼보다 약 8일 늦게 출수하였다. 진부벼와 GPL-40의 간장은 각각 73.3 cm, 89.8 cm로 유의하게 GPL-40이 컸다. 반면 진부벼와 GPL-40의 등숙률은 각각 87.7%과 71.6%이고 천립중은 각각 27.7 g, 25.0 g 그리고 임실률이 각각 95.8%, 75.2%로 GPL-40이 유의하게 낮은 경향을 보였다. RILs의 출수일수는 평균 98.6±3.31, 간장은 78.3 cm±8.68, 수장은 평균 19.2 cm±1.09, 수수는 평균 11.3개±1.23였다. 수당립수는 평균 111.5개±21.15, 등숙률은 평균 60.6%±21.60였다. 천립중과 임실률의 평균은 26.8 g±1.47, 72.2%±26.41로 각각 조사되었다. 아밀로스와 단백질 함량의 평균은 각각 17.1%±3.24, 8.1%±1.08였다.

Table 3

Agronomic traits of Jinbubyeo, GPL-40 and RILs.

Cultivar/breeding line Agronomic traitsz
DTH CL PL NP NS Yield TGW SF RRG Protein Amylose PE TIL FLA
Jinbubyeo 97.5 73.3 18.9 8.7 83.7 60.4 27.7 95.8 87.7 7.6 18.5 5.4 14.5 3
GPL-40 105.5 89.8 19.4 9.6 87.5 48.3 25.0 75.2 71.6 7.8 20.0 7.4 17.0 1
RILs 98.6 78.3 19.2 11.3 111.5 60.3 26.8 72.2 60.6 8.1 17.1 5.1 15.7 3
Range 90.5~106.0 60.5-104.2 16.1~23.2 7.5~14.6 67.9-176.5 14.7~106.6 22.5~31.2 15.5~97.6 10.0~91.4 5.9~11.2 7.5~26.4 1~9 6.7~20.8 1~9

zDTH: days to heading, CL: culm length (cm), PL: panicle length (cm), NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills (g), TGW: Rough rice 1,000 grain weight (g), SF: spikelet fertility (%), RRG: ratio of ripened grain (%), Protein: content of protein (%), Amylose: content of amylose (%), PE: panicle extraction (cm), TIL: third internode length (cm), FLA: flag leaf angle degree(1:Erect-9:Horizontal).


Fig. 2. Histogram of tested traits in the RILs. P1 is Jinbubyeo, and P2 is GPL-40. DTH: days to heading, CL: culm length (cm), PL: panicle length (cm), NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills (g), TGW: Rough rice 1,000 grain weight (g), SF: spikelet fertility (%), RRG: ratio of ripened grain (%), Protein: content of protein (%), Amylose: content of amylose (%), PE: panicle extraction (cm), TIL: third internode length (cm), FLA: flag leaf angle degree (1:Erect-9:Horizontal).

저항성 유전자와 조사형질 간 분산분석

총 14개 조사형질을 주요농업형질, 수량, 미질, 초형 등 4그룹으로 나누었으며, 각 조사형질에 대해 도입된 저항성 유전자가 어떤 연관성이 있는지 확인하기 위해 분산분석을 수행하였다(Table 4). RIL 집단을 이용하여 내병충성 유전자와 주요 농업형질 간 연관을 분석한 결과, 5개 도입 저항성 유전자 중 Pi40Bph18의 존재 유무가 조사된 농업형질의 특성과 연관이 높았다. Pi40은 간장, 수장, 수당립수, 간이수량, 임실률, 단백질, 아밀로스, 이삭추출도와 연관이 있었다. Bph18의 경우, 간장, 수장, 간이수량, 임실률, 등숙률, 단백질, 아밀로스, 이삭추출도, 3절간장과 연관이 있었다. 흰잎마름병 저항성 유전자 Xa4, xa5, Xa21Xa4가 임실률과 등숙률, 단백질, 3절간장 등에 연관이 있는 것으로 조사되었다.

Table 4

ANOVA analysis between trait groups tested and five resistance genes

Group Trait Resistance genes
Xa4 xa5 Xa21 Pi40 Bph18
Main DTHz 0.23ns 0.01ns 1.60ns 0.90ns 1.12ns
CL 0.33ns 1.31ns 0.01ns 12.59** 28.11**
PL 0.01ns 0.70ns 0.54ns 31.72** 8.61**
NP 2.68ns 0.06ns 2.15ns 0.98ns 0.02ns
Yield NS 0.00ns 16.50** 7.04** 34.92** 2.94ns
Yield 7.32** 1.63ns 5.78* 19.03** 12.07**
TGW 1.70ns 0.26ns 6.23ns 5.03ns 0.02ns
SF 11.39** 0.15ns 2.90ns 5.80* 32.86**
Grain quality RRG 7.86** 0.08ns 0.68ns 1.61 27.49**
Pro 6.66* 0.18ns 1.81ns 16.45** 7.30**
Amy 0.20ns 0.12ns 0.04ns 4.89* 6.23*
Morphological PE 0.02ns 4.92* 0.02ns 5.00* 22.75**
TIL 4.53* 1.71ns 5.92* 2.28ns 27.00**
FLA 3.35ns 0.46ns 1.49ns 0.00ns 0.17ns

zDTH: days to heading, CL: culm length, PL: panicle length, NP: number of panicle per hills, NS: number of spikelet per panicle, Yield: Rough yield of 3hills, TGW: Rough rice 1,000 grain weight, SF: spikelet fertility, RRG: ratio of ripened grain, Pro: content of protein, Amy: content of amylose, FLA: flag leaf angle degree, PE: panicle extraction, TIL: third internode length.

nsnot significant

Significance levels: *p<0.05 and **p<0.001.



도입유전자 간의 상호작용

분산분석결과 도입된 저항성 유전자 중 Pi40, Bph18, 그리고 Xa4가 육성집단의 등숙률, 임실률, 3절간장, 이삭추출도, 단백질함량 등에 부정적인 영향을 미친 것으로 확인되었다. 따라서 관련 저항성 유전자들의 단독으로 조사 형질에 영향을 주었는지 다른 도입 유전자와의 상호작용에 있었는지 확인하기 위하여 삼원분산분석을 수행하였다(Table 5). 등숙률 변이에 유의하게 영향을 미친 요인은 Bph18Xa4로 이들은 각각 11.3%, 2.5%로 등숙률 변이를 설명하였다. 등숙률 변이에 대한 유전자 간 상호작용을 분석한 결과 등숙률에 대한 도입유전자들의 2가, 3가 상호작용은 모두 유의하지 않았다. 임실률 변이에 유의하게 영향을 미친 요인은 Pi40, Bph18, Xa4로 이들은 각각 2.2%, 13.0%, 3.4%로 임실률 변이를 설명하였다. 임실률 변이에 대한 도입유전자들의 2가, 3가 상호작용은 모두 유의하지 않았다. 3절간장 변이에 유의하게 영향을 미친 요인은 Bph18로 3절간장 변이의 9.8%를 설명하였으며, 3절간장에 대한 Pi40-Bph18-Xa4 간 상호작용은 낮지만 유의하였다. 이삭추출도 변이에 유의하게 영향을 미친 요인은 Pi40, Bph18 유전자로 이들은 각각 1.8% 8.7%로 이삭추출도 변이를 설명하였다. 이삭추출도 변이에 대한 저항성유전자 간 2가 상호작용은 유의하지 않았지만, Pi40-Bph18-Xa4 간 상호작용은 낮지만 유의하였다. 단백질함량 변이에 유의하게 영향을 미친 요인은 Pi40, Bph18, Xa4 유전자로 이들은 각각 6.8%, 3.4%, 2.2%로 변이를 설명하였다. 단백질 함량 변이에 대한 Pi40-Bph18 간 상호작용은 낮지만 유의하였다.

Table 5

ANOVA test of five R-genes and their interactions on traits associated with rice poor characters.

RRG SF TIL PE Pro
SSz F value PVE SS F value PVE SS F value PVE SS F value PVE SS F value PVE
Pi40 727 1.8ns 0.7 3448 6.1* 2.2 9.1 1.6 0.6ns 12.7 4.5* 1.8 17.2 16.6** 6.8
Bph18 11818 29.1** 11.3 20270 35.6** 13.0 145.2 25.3 9.8** 61 21.6** 8.7 8.6 8.3** 3.4
Xa4 2612 6.4* 2.5 5287 9.3* 3.4 21.8 3.8 1.5ns 0 0.0ns 0.0 5.6 5.4* 2.2
Pi40+Bph18 557 1.4ns 0.5 1123 2.0ns 0.7 13.7 2.4 0.9ns 1 0.4ns 0.1 4.1 4.0* 1.6
Pi40+Xa4 18 0.0ns 0.0 2 0.0ns 0.0 0.5 0.1 0.0ns 0.1 0.0ns 0.0 0.0 0.0ns 0.0
Bph18+Xa4 181 0.4ns 0.2 1595 2.8ns 1.0 2.5 0.4 0.2ns 0.1 0.1ns 0.0 0.6 0.6ns 0.2
Pi40+Bph18+Xa4 265 0.7ns 0.3 4 0.0ns 0.0 39.4 6.9* 2.7ns 16.1 5.7* 2.3 1.0 0.9ns 0.4

zSS: sum of squares, PVE: proportion of variance explained, RRG: ratio of ripened grain, SF: spikelet fertility, TIL: third internode length, PE: panicle extraction, Pro: content of protein.

nsnot significant

Significance levels: *p<0.05 and **p<0.001.



열악형질 연관 저항성 유전자 이입개체의 표현형적 특성

분산분석결과 저항성유전자와 유의한 결과를 보인 형질들을 이용하여 저항성유전자 보유계통과 비보유계통 간 농업형질을 비교하였다(Table 6). RILs 중 Pi40을 보유한 계통은 225개 중 72개, Bph18을 보유한 계통은 225개 중 168개였다. Pi40을 보유한 계통들의 임실률 평균은 78.0%로 비보유계통의 평균(69.4%)보다 유의하게 높았으며, 이삭추출도도 Pi40을 보유한 계통들의 평균이 5.5 cm로 비보유계통의 평균(5.0 cm)보다 유의하게 높은 경향을 보였다. 반면에 Pi40 보유한 계통들은 단백질함량이 평균 7.7%로 Pi40 비보유 계통(8.3%)보다 유의하게 낮은 경향을 보였다. Bph18을 보유한 계통들의 등숙률, 임실률 평균은 각각 56.6%, 67.0%로 Bph18를 비보유한 계통(각각 72.7%, 88.0%)보다 유의하게 낮은 경향을 보였지만, Bph18 보유계통의 3절간장, 이삭추출도, 단백질함량 평균은 각각 16.2 cm, 5.5 cm, 8.2%로 Bph18 보유계통(14.3 cm, 4.2 cm, 7.8%)보다 유의하게 길고 많은 경향을 보였다. 그룹 간 변이가 컸던 임실률의 경우 Pi40을 보유한 계통들은 부본인 GPL-40 수준의 임실률을 회복하였으며, Bph18 유전자 비보유 계통들은 부본인 GPL-40의 임실률보다 더 높은 경향을 보였다. 등숙률도 그룹간 평균 차이가 유의하였지만 부본인 GPL-40의 등숙률만큼 회복이 안된 것을 확인할 수 있었다.

Table 6

Comparison of lines with traits associated with rice poor characters according to two gene Pi40 and Bph18 in the population

Resistant gene No. of lines RRG (%)z SF (%) TIL (cm) PE (cm) Pro (%)
Pi40 72 63.2by 78.0b 16.0a 5.5a 7.7b
pi40 151 59.3c 69.4c 15.6a 5.0a 8.3a
Bph18 168 56.6c 67.0c 16.2a 5.5a 8.2a
bph18 55 72.7a 88.0a 14.3b 4.2b 7.8b
Jinbubyeo (P1) 1 87.7a 95.8a 14.5b 5.4b 7.6b
GPL-40 (P2) 1 71.6b 75.2b 17.0a 7.4a 7.8a

zRRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein.

yMeans with same letters in a column are not significant at p<0.05 (ANOVA followed by DMRT).



한편, 조사된 열악형질이 출수일수나 간장 같은 주요 농업형질에 영향을 받는지 추가 확인하였다(Fig. 3). 열악형질 중 3절간장과 이삭추출도는 간장 간 상관계수가 각각 0.81, 0.72로 높은 상관을 보였지만 출수일수와 수장과는 비교적 낮은 상관을 보였다. 단백질함량은 출수일수, 간장, 수장과 낮은 상관을 보였으나 열악형질인 등숙률, 임실률 간 상관계수가 각각 -0.84, -0.85으로 높은 상관을 보였다. 등숙률과 임실률은 조사된 주요농업형질과 상관이 없었다.

Fig. 3. Correlation analysis between R-genes and the five traits negatively affected. DTH: days to heading, CL: culm length, PL: panicle length, NP: number of panicle per hills, NS: number of spikelet per panicle, RRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein. Significance levels: *p<0.05, **p<0.001 and ***p<0.0001.

도입유전자와 연관된 열악형질 QTL 탐색

조사된 열악형질과 도입된 저항성 유전자 간 관계를 분자적으로 분석하기 위하여 KASP 마커를 이용하여 QTL 분석을 하였다(Fig. 4). 5개 열악형질은 1번, 3번, 6번, 8번, 11번, 12번 염색체에서 탐색되었다. 이중 12번 염색체에서 벼멸구 저항성유전자 Bph18 주변에서 5개 열악형질 관련 QTL qPE12, qTIL12, qRRG12, qSF12, qPro12가 탐색되었으며, 탐색된 QTL은 변이의 7.5%, 8.9%, 25.7%, 23.1%, 16.7%를 각각 설명하였다(Table 7). 도열병 저항성유전자 Pi40 주변에서는 QTL qPE6, qTIL6가 탐색되었으며 이들은 각각 변이의 4.7%, 4.1%를 설명하였다. 흰잎마름병 저항성유전자 Xa21 주변에서 QTL qTIL11이 탐색되었으며, 이것은 변이의 6.4%를 설명하였다.

Table 7

QTLs identified for tested traits in the RIL population.

QTLz Chromosome Left-Marker Position (Mp) Right-Marker Position (Mp) LOD PVE (%)y Addx
qRRG 8 KJ08_037 8.85 KJ08_038 9.00 6.0 7.7 -6.5
11 KJ11_016 5.68 KJ11_017 5.93 3.1 3.9 5.2
12 KJ12_059 23.26 KJ12_061 25.29 17.3 25.7 13.0
qSF 8 KJ08_040 9.49 KJ08_070 16.44 9.1 11.9 -9.6
11 KJ11_013 5.01 KJ11_015 5.56 8.2 10.1 9.8
12 KJ12_059 23.26 KJ12_061 25.29 19.0 23.1 16.2
qPE 1 KJ01_105 35.19 KJ01_116 39.81 7.0 13.5 0.7
6 KJ06_045 12.99 KJ06_055 15.20 3.6 4.7 -0.4
12 7312.T4A (Bph18) 22.89 KJ12_059 23.26 5.8 7.5 -0.6
qTIL 1 KJ01_105 35.19 KJ01_116 39.81 14.4 20.5 1.3
3 KJ03_015 4.43 KJ03_016 4.79 5.4 5.1 -0.7
6 KJ06_045 12.99 KJ06_055 15.20 4.5 4.1 -0.6
11 KJ11_092 23.75 KJ11_099 27.58 6.3 6.4 -0.8
12 KJ12_058 22.48 7312.T4A (Bph18) 22.89 9.1 8.9 -1.0
qPro 8 KJ08_038 9.00 KJ08_040 9.49 8.2 11.5 0.4
11 KJ11_013 5.01 KJ11_015 5.56 5.0 6.9 -0.3
12 KJ12_059 23.26 KJ12_061 25.29 11.3 16.7 -0.5

zRRG: ratio of ripened grain, SF: spikelet fertility, TIL: Third internode length, PE: panicle extraction, Pro: content of protein

yPVE (%): percentage of phenotypic variation explained by the QTL

xAdd: additive effect


Fig. 4. Location of QTLs for traits negatively affected identified on the linkage map for six rice chromosomes.
고 찰

지구온난화로 인한 일 평균 기온 상승은 다양한 병해충 발생 및 이들의 생태형 변화를 유발시켜 벼 작황에 더 많은 피해를 줄 것으로 예상된다(Seo et al. 2020). 이러한 문제를 극복하기 위해 복합내병충성 품종 육성이 필요하지만 저항성 유전자 도입을 위한 원연교잡시 임실률과 등숙률 감소 등의 열악형질이 동반이입(linkage drag)되어 이를 회복시키는데 많은 시간과 노력이 필요한 것이 사실이다(Jeung et al. 2016, Suh et al. 2014). 따라서 본 연구에서는 저항성 유전자 Pyramiding RIL 집단을 이용하여 저항성 유전자와 열악형질과의 관계를 분산분석하였고, 동시에 동일 집단을 이용하여 QTL분석을 수행함으로써 그 연관성을 분자 마커 수준에서 규명하였다.

본 연구에서는 열악형질 발현을 규명하기 위하여, 5개 저항성 유전자를 포함하는 GPL-40과 진부벼를 인공교배하여 잡종집단을 만들었고, 단립계통육종법을 통해 총 225 RILs 계통을 육성하였다. 육성된 RIL의 형질 및 특성은 양친의 변이 폭 사이에서 초월분리를 나타내며 정규분포하는 양상이었으나, 임실률, 등숙률 등에서는 열악형질을 보이는 방향으로 편향된 경향이 있었다. 유전적으로 유사한 양친간의 교배에서 이처럼 육성된 후대의 농업형질 변이 폭이 크게 나타난 것은 도입된 저항성 유전자가 해당 형질에 영향을 준 결과로 생각된다. Jena et al. (2017)는 원연인 병해충 유전자를 마커를 이용해 집적할 경우 목표 유전자 주변에 있는 형질이 동반 이입되어 반복친으로 여교배를 하여도 유전적회복이 예상보다 낮게 나온다고 하였다. 본 연구에서도 여교배 방법으로 육성된 계통의 유전적 회복률이 낮았던 것은 도입유전자 주변의 유전자가 동반 이입되어 형질변이에 영향을 준 것으로 생각된다.

도입된 저항성유전자와 조사된 열악형질 간 연관을 분석하기 위해 분산분석을 수행한 결과, 도열병 저항성유전자 Pi40과 벼멸구 저항성유전자 Bph18이 조사된 열악형질에 연관이 있는 것으로 나타났다(Table 4). 즉, 검정집단의 열악형질 발현은 Pi40Bph18이 육성 집단내 계통으로 도입 및 분리되면서 기인한 것으로 보이나, 흰잎마름병 저항성유전자는 열악형질 발현에 크게 영향이 없는 것으로 조사되었다. 또한 두 저항성 유전자는 도입된 다른 저항성 유전자와 열악형질에 대한 상호작용이 없는 것으로 나타났다(Table 5). 도입된 저항성유전자는 대부분 독립적으로 열악형질에 기인하였고, 열악형질의 발현 정도는 도입된 저항성 유전자의 개수에 영향을 받는 다기보다는 도입된 유전자가 가진 특이성에 따라 서로 다른 수준으로 해당 형질에 영향을 준 것으로 보인다. Suh et al. (2013)는 흰잎마름병 저항성유전자 Xa4+xa5+Xa21를 자포니카 품종인 만금에 집적한 계통들이 반복친과 품질특성도 비슷하였으며, 육성과정에서 열악형질은 동반유입되지 않았다고 하였다. 또한 Park et al. (2014)은 흰잎마름병 저항성 유전자만 있는 계통군에서는 열악형질이 발견되지 않았으나, Bph18이 유입되는 경우 Bph18 비보유계통에 비해 3절간장과 간장이 길어지고, 임실률과 등숙률이 낮아지는 경향이 있다고 하였다. 본 연구에서도 Bph18 유전자 유무에 따라 임실률, 등숙률, 3절간장 등의 변이 폭이 컸고 통계적으로 유의했던 것으로 보아, Bph18와 열악형질 유전자가 가까운 위치에 연관되어 있는 것으로 판단된다.

도입유전자와 연관된 열악형질의 물리적 위치를 분자마커로 확인하기 위해 QTL 분석을 수행한 결과, Pi40 위치 주변에서 이삭추출도와 3절간장 관련 QTL (qPE6, qTIL6)이 탐색되었고, Bph18에서는 5개 열악형질에 대한 QTL (qRRG12, qSF12, qTIL12, qPE12, qPro12)이 모두 탐색되었다(Fig. 4). Pi40Bph18이 분산분석에서 열악형질과 연관이 높고 형질에도 영향을 주었기 때문에 유전자와 가까운 위치에서 관련 QTL 탐색을 예상할 수 있었다. 그러나 Pi40 주변에서 단 2개의 형질만 탐색된 반면 Bph18 주변에서 등숙률과 임실률, 3절간장, 이삭추출도, 단백질 관련 QTL이 탐색된 것은 본 연구에서 이용된 RIL 집단의 각 열악 형질변이의 원인이 Bph18 주변에 있는 유전자에 의해 영향을 받은 것으로 판단된다. Bph18는 12번 염색체 장완 22.8 Mb 부근에 위치하고 있다. 본 연구에서 Bph18 주변에서 탐색된 QTL qRRG12qSF12는 12번 염색체 장완 22.89-25.29 Mb, qPE12는 22.8-23.2 Mb, qTIL12는 22.4-22.8 Mb, qPro12는 23.2-25.2 Mb에서 각각 탐색되었다. Bph18이 위치한 12번 염색체 장완에는 임실률과 관련된 대립유전자 hsa1hsY(t)가 존재하고 있다(Kubo & Yoshimura 2005, Yara et al. 2010). 또한 Bph18 부근에 종실 등숙과 관련된 QTL gfr12와 완전미율과 관련된 QTL bhr12 이 12번 염색체 장완(23.27-24.00 Mb)에서 탐색 되었다(Lee et al. 2005). Suh et al. (2011)Bph18 유전자를 자포니카에 도입할 경우 간장이 길어지고, 임실률 감소 등 열악형질이 발생한다고 하였다. 최근에는 Bph18와 약 2 Mb 떨어진 위치에서 3절간장과 관련이 있는 QTL (17.53-21.24 Mb)이 탐색되어 도복에 영향을 준다고 하였다(Zhao et al. 2021). 한편, 단백질(22.25-27.34 Mb)과 아밀로스(24.8 Mb, 25.7 Mb) 관련한 QTL도 Bph18과 약 2 Mb정도 떨어진 위치에서 탐색되었다(Kashiwagi & Munakata 2018, Liu et al. 2020). 본 연구 결과에서도 상관분석, 분산분석, QTL 분석 등을 통해 Bph18과 열악형질이 연관된 것을 확인하였다. 회복친으로 유전적배경이 대부분 회복이 되었던 RIL 계통 내에서 임실률, 등숙률, 3절간장 등의 변이를 보였던 것은 Bph18에 연관되어 있던 열악형질 유전자 또는 QTL이 같이 동반 이입되어 영향을 준 것이므로 마커 활용 시 육성계통 선발에 주의가 필요할 것으로 생각된다.

본 연구에서 RIL 집단을 이용하여 병해충저항성 유전자와 열악형질(임실률, 등숙률, 3절간장 등) 발현에 관한 통계/QTL 분석을 수행하였다. 특히, 12번 염색체상의 벼멸구 저항성 유전자의 유입은 기존 품종의 열악형질 발현에 영향을 주고 있음을 확인하였다. 따라서 목표 형질만을 타겟으로 한 분자마커 뿐만 아니라 열악형질까지 고려할 수 있는 분자 마커의 개발이 필요한 것으로 보인다. 현재 12번 염색체상의 임실률 관련 심화 연구를 진행 중이며, 이로부터 열악형질을 조기에 제거할 수 있는 분자마커를 개발한다면 현재의 MAS육종의 정확성 및 효율성을 극대화할 수 있을 것으로 생각되고, 개발된 마커는 기후변화대비 벼 병해충저항성 증진 육종사업에 도움이 될 것이라 기대된다.

적 요

본 연구는 주요 병해충저항성 유전자(Xa4, xa5, Xa21, Pi40, Bph18)를 자포니카 품종에 도입할 경우 열악형질이 발생되는 원인을 규명하기 위하여 저항성 유전자가 집적된 RILs을 육성하였다.

  • RILs의 조사된 형질 및 특성은 대부분 정규분포 하였으나 임실률과 등숙률 감소 등 열악형질의 경우 특이적으로 한쪽으로 편향되어 분포하는 경향을 보였다.

  • RILs 내 열악형질이 발생된 원인을 파악하기 위해 도입유전자와 열악형질 간 분산분석한 결과 Pi40Bph18이 열악형질과 비교적 연관이 높았으며, 흰잎마름병 저항성유전자 Xa4, xa5, Xa21는 연관이 없는 것을 확인할 수 있었다.

  • 또한, 열악형질과 연관이 높았던 Pi40Bph18보유계통과 비보유계통의 열악형질 특성 비교결과, 해당 유전자가 계통내로 유입될 경우 농업형질(임실률, 등숙률, 3절간장, 이삭추출도, 단백질함량) 변이에 영향을 주는 것을 확인할 수 있었다.

  • QTL 분석결과, Pi40 주변에서 이삭추출도와 3절간장관련 QTL이 탐색되었고, Bph18와 가까운 위치에서 임실률, 등숙률, 3절간장, 이삭추출도, 단백질함량 관련 QTL이 탐색되었다. 진부벼 배경으로 대부분 유전배경이 회복되었던 RILs내에서 열악형질의 변이를 보인 것은 Bph18이 도입되면서 Bph18과 가까이에 위치한 열악형질 인자가 동반이입(linkage drag)된 결과로 확인됐다.

본 연구에서 분석한 결과를 바탕으로 Bph18과 연관된 이삭 임성 관련 연구를 진행하고 있으며, 이를 바탕으로 열악형질을 조기에 제거할 수 있는 분자마커를 개발하여 MAS 정확성과 육종효율을 극대화할 수 있을 뿐만 아니라 벼 병해충저항성 증진 사업에 큰 도움이 될 것이라 기대한다.

보충자료

본문의 Supplementary Fig. 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

kjbs-53-4-392-supple.pdf
사 사

본 연구는 농촌진흥청(과제번호: PJ01480401)의 지원에 의해 이루어진 것입니다.

Supplementary information
Supplementary File
References
  1. Choi IS, Cho YC, Won YJ, Kim MK, Lee JH, Lee JH, Yang CI, Kim YG, Kim JJ, Shin YS. 2015. A medium maturity, high quality and multiple disease resistant rice 'Cheongun'. Korean J Breed Sci 47: 166-172.
    CrossRef
  2. Jena KK, Jeung JU, Lee JH, Choi HC, Brar DS. 2006. High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18 (t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor Appl Genet 112: 288-297.
    Pubmed CrossRef
  3. Jena KK, Hechanova SL, Verdeprado H, Prahalada GD, Kim SR. 2017. Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis. Theor Appl Genet 130: 2345-2360.
    Pubmed CrossRef
  4. Jeung JU, Kim BR, Cho YC, Han SS, Moon HP, Lee YT, Jena KK. 2007. A novel gene, Pi40 (t), linked to the DNA markers derived from NBS-LRR motifs confers broad spectrum of blast resistance in rice. Theor Appl Genet 115: 1163-1177.
    Pubmed CrossRef
  5. Jeung JU, Seop S, Choi IS, Chang JK, Kim MK, Lee JH, Park HM, Yang CI, Jeon YH, Suh JP, Choi IB, Jeong JM, Sung NS, Lee JH, Yoon MR, Kim CK. 2016. Blast resistant early maturing rice 'Jungmo1024' with high temperature tolerance during grain filling stage. Korean J Breed Sci 48: 72-84.
    CrossRef
  6. Kashiwagi T, Munakata J. 2018. Identification and characteristics of quantitative trait locus for grain protein content, TGP12, in rice (Oryza sativa L.). Euphytica 214: 165.
    CrossRef
  7. Kim WJ, Back SH, Shin WC, Park HS, Ha KY, Park JH, Cho YC, Kim BK, Lee JH. 2013. Development of brown planthopper resistanct lines carrying Bph18 gene using marker-assisted selection in Japonica rice (Oryza sativa L.). J Korean Soc Int Agric 25: 378-384.
    CrossRef
  8. Kubo T, Yoshimura A. 2005. Epistasis underlying female sterility detected in hybrid breakdown in a Japonica-Indica cross of rice (Oryza sativa L.). Theor Appl Genet 110: 346-355.
    Pubmed CrossRef
  9. Kwak DY, Yeo US, Lee JH, Oh BG, Shin MS, Ku YC. 2007. Mass screening method for rice virus resistance using screen house. Korean J Crop Sci 52: 129-133.
  10. Lee JH, Yeo US, Kwak DY, Park DS, Oh BG, Ku YC, Kim HY, Sohn JK. 2005. QTL analysis for ripening traits of BHP resistant backcross inbred lines in rice. Korean J Breed Sci 37: 295-299.
  11. Lee JH, Yeo US, Cho JH, Lee JY, Song YC, Shin MS, Kang HW, Sohn JK. 2011. Marker assisted selection of brown planthopper resistance and development of multi-resistance to insect and diseases in rice (Oryza sativa L.). Korean J Breed Sci 43: 413-421.
  12. Liu S, Zhong H, Meng X, Sun T, Li Y, Pinson SRM, Chang SKC, Peng Z. 2020. Genome-wide association studies of ionomic and agronomic traits in USDA mini core collection of rice and comparative analyses of different mapping methods. BMC Plant Biol 20: 441.
    Pubmed KoreaMed CrossRef
  13. McCouch SR. 2008. Gene nomenclature system for rice. Rice 1: 72-84.
    CrossRef
  14. Meng L, Li H, Zhang L, Wang J. 2015. QTL IciMapping: integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J 3: 269-283.
    CrossRef
  15. Park HS, Kim KY, Shin MS, Noh TH, Jeung JU, Kim WJ, Suh JP, Ha KY, Baek MK, Baek SH. 2012. Variation of yield and grain quality by the inoculation of K1 and K3a races of bacterial blight in early maturing japonica rice varieties. Korean J Breed Sci 44: 516-525.
    CrossRef
  16. Park HS, Baek SH, Kim WJ, Jeung JU, Lee JH, Ha KY, Park JH, Nam JK, Baek MK, Yoo JS. 2014. Development of multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus using anther culture in rice. Korean J Breed Sci 46: 78-89.
    CrossRef
  17. Park HS, Kim KY, Kim WJ, Jeong JU, Lee JH, Noh TH, Nam JK, Baek MK, Shin WC, Kim JJ. 2016. Development of japonica rice lines with four bacterial blight resistance genes using phenotypic and marker-assisted selection. Korean J Breed Sci 48: 140-158.
    CrossRef
  18. RDA. 2012. Standard of analysis and survey for agricultural research. Suwon, Korea.
  19. Ruengphayak S, Chaichumpoo E, Phromphan S, Kamolsukyunyong W, Sukhaket W, Phuvanartnarubal E, Korinsak S, Korinsak S, Vanavichit A. 2015. Pseudo-backcrossing design for rapidly pyramiding multiple traits into a preferential rice variety. Rice 8: 7.
    Pubmed KoreaMed CrossRef
  20. Seo MC, Kim JH, Choi kJ, Lee YH, Sang Wg, Cho HS, Cho JI, Shin P, Baek JK. 2020. Review on adaptability of rice varieties and cultivation technology according to climate change in Korea. Korean J Crop Sci 65: 327-338.
  21. Suh JP, Yang SJ, Jeung JU, Pamplona A, Kim JJ, Lee JH, Hong HC, Yang CI, Kim YG, Jena KK. 2011. Development of elite breeding lines conferring Bph18 gene-derived resistance to brown planthopper (BPH) by marker-assisted selection and genome-wide background analysis in japonica rice (Oryza sativa L.). Field Crops Res 120: 215-222.
    CrossRef
  22. Suh JP, Jeung JU, Kim YG, Jena KK, Cho YC, Lee JH, Kim MK, Hong HC, Lee JH, Kim JJ, Choi IS, Jeong EG, Hwang HG, Oh SK, Yang CI, Shin MS. 2014. A brown planthopper resistant and high grain quality rice variety 'Anmi' developed by molecular breeding method. Korean J Breed Sci 46: 152-159.
    CrossRef
  23. Suh JP, Cho YC, Won YJ, Ahn EK, Baek MK, Kim MK, Kim BK, Jena KK. 2015. Development of resistant gene-pyramided Japonica rice for multiple biotic stresses using molecular marker-assisted selection. Plant Breed Biotechnol 3: 333-345.
    CrossRef
  24. Yara A, Phi CN, Matsumura M, Yoshimura A, Yasui H. 2010. Development of near-isogenic lines for BPH25 (t) and BPH26 (t), which confer resistance to the brown planthopper, Nilaparvata lugens (Stål.) in indica rice 'ADR52'. Breed Sci 60: 639-647.
    CrossRef
  25. Zhao DD, Son JH, Farooq M, Kim KM. 2021. Identification of candidate gene for internode length in rice to enhance resistance to lodging using qtl analysis. Plants 10: 1369.
    Pubmed KoreaMed CrossRef


December 2021, 53 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information