search for




 

Identification of Korean Wheat Cultivars Using Multiplex STS-SSR Markers
Multiplex STS-SSR 마커를 활용한 국산밀 품종 판별
Korean J. Breed. Sci. 2022;54(2):119-129
Published online June 1, 2022
© 2022 Korean Society of Breeding Science.

Ri Choi1, Jin-Hee Yu1, Su-Min Hong1, Kyung-Min Kim2, Han-Yong Jung2, Youngjun Mo1, and Chul Soo Park1*
최리1⋅유진희1⋅홍수민1⋅김경민2⋅정한용2⋅모영준1⋅박철수1*

1Department of Crop Science and Biotechnology, Jeonbuk National University, Jeonju, 54896, Republic of Korea
2National Institute of Crop Science, Rural Development Administration, Wanju, 55365, Republic of Korea
1전북대학교 작물생명과학과
2국립식량과학원
Correspondence to: E-mail: pcs89@jbnu.ac.kr, Tel: +82-63-270-2533, Fax: +82-63-270-2640
Received February 8, 2022; Revised March 23, 2022; Accepted March 25, 2022.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
This study aimed to develop an agarose gel-based multiplex PCR assay using sequence-tagged site (STS) and simple sequence repeat (SSR) markers that can differentiate Korean wheat cultivars. Forty-nine Korean wheat cultivars were primarily classified based on seed coat color into red (36) and white (13) groups. Red wheat cultivars were further differentiated by three multiplex PCRs using molecular markers for Ppo-A1/Vrn-D1a/Rht-B1b, Glu-A3ac/TaCwi-A1b/Lr34, and Glu-A1ac/Glu-B1b/KWSM003/TaSE96. Similarly, white wheat cultivars were further differentiated using two multiplex PCRs using the molecular markers for Ppo-A1/Vrn-D1a/Pina-D1a and Ppo-B1/Glu-B3h. A multiplex PCR assay using molecular markers for Glu-A1b/Glu-D1d/Wx-B1 was developed to differentiate four Korean wheat cultivars used as government certified seeds: Baekkang, Hwanggeumal, Keumkang, and Saekeumkang. A multiplex PCR assay using molecular markers for Glu-B3h and Pin-D1a was used for colored wheat cultivars, Arijinheuk, Ariheuk, and Chinese colored wheat. The multiplex PCR assays developed in this study can provide useful molecular tools for differentiating Korean wheat cultivars, developing wheat seed management systems, and guaranteeing wheat seeds in Korea.
Keywords : wheat, sequence-tagged site (STS) marker, simple sequence repeat (SSR) marker, Multiplex-PCR
서 언

국민 일인당 밀 소비량이 32.2 kg으로 쌀 다음이지만, 국산밀 자급률은 1% 미만으로 매우 낮다(MAFRA 2021). 국산밀 자급률 제고를 위해 정부는 “밀산업 육성법”을 제정하였으며, 1차 기본계획으로 2025년까지 5% 자급률을 목표로 하고 있다(Jung et al. 2020). 이를 위하여 국산밀의 가격 경쟁력 제고 방안, 생산 기반 확충, 품질 고급화, 국산밀 유통 차별화 및 안정적 소비 시장 확보를 주요 추진 방향으로 설정하였다(Jung et al. 2020). 국산밀 자급률 제고를 위해서는 생산 및 유통 기반과 정책 지원을 통한 가격 경쟁력 확보와 함께 품질 고급화를 통한 소비 활성화가 뒷받침 되어야 한다. 국산밀 품질 고급화를 위해 보급종 공급 및 품질 검사 체계 개선과 정비가 필요하며, 품질 관리 역량 강화와 우량 종자의 안정적인 확보 및 보급 체계도 구축되어야 하고, 보급종 순도 관리 강화를 위한 신속 정확한 저비용 품종 검정 분석이 필요하다(Bae & Park 2020, Jung et al. 2020).

품종 검정 분석은 형태적 특징이나 분자표지인자를 통한 방법이 주로 이용되는데, 형태적 특징으로 신속한 검정이 가능하지만 환경에 많은 영향을 받기 때문에 최근에는 분자표지인자 검정법이 많이 이용되고 있다(Korir et al. 2012, Son et al. 2013b). 분자표지인자는 Hybridization을 기반으로 한 RFLP (Restriction fragment length polymorphism)를 시작으로 PCR 기반 마커인 RAPD (Randomly Amplified Polymorphic DNA), AFLP (Amplified Restriction Fragment Polymorphism) SSR (Simple Sequence Repeat) 및 STS (Sequence Tagged Site) 등에 관한 연구가 이루어졌으나, 최근 차세대 염기서열분석(Next Generation Sequencing, NGS)에 기반한 SNP (Single nucleotide polymorphism) chips와 KASP (Kompetitive Allele Specific PCR) 마커가 유전적 다양성 평가, 계통 선발 및 품종 구별 등 다양한 분야에서 이용되고 있다(Agarwal et al. 2008, Azizi et al. 2021).

품종판별을 위해 일본과 중국에서도 EST-SSR (Experssed Sequence Tag-SSR)과 SSR 마커를 활용한 방법이 보고되었으며(Fujita et al. 2009, Wang et al. 2015), 국산밀의 품종 판별에는 ISSR (Inter Simple Sequence Repeat), SCAR (Sequence characterized amplified region) 및 RAPD가 이용되었다(Son et al. 2013a, 2015, 2017). 최근에는 SNP 마커를 활용한 품종 판별이 보고되었으나(Jang et al. 2020), SNP 마커는 분석 비용이 많이 소모되고 제한된 수의 대립유전자로 인해 결과 해석에 많은 어려움이 있다(Butler et al. 2007). KASP 마커도 활발한 연구가 진행되고 있지만 이는 LGC社의 단독 개발로 높은 비용으로 책정되어 대용량의 품종 검정에 사용하기에는 한계가 있다(Rasheed et al. 2019). 하지만 단순 염기서열 반복을 이용한 SSR 마커와 정확한 프라이머 서열에 의해 정의된 STS 마커는 프라이머 제작에 상당한 비용과 노력이 요구되지만 기존에 보고된 분자표지인자를 사용한다면 많은 비용을 들이지 않고 대용량 품종 검정이 가능하다(Agarwal et al. 2008, Amiteye et al. 2021). 또한 두 개 이상의 유전자를 동시에 증폭하는 multiplex-PCR은 높은 편의성과 낮은 비용의 장점을 가져 최근 육종의 효율을 높이고자 단백질 관련 Glu-1, Glu-3, 개화기 관련 Vrn-B1 및 녹병 관련 Lr34 등 다양한 유전자에서 사용하는 방법이다(Milec et al. 2012, Shin et al. 2012, Skowrońska et al. 2019).

본 연구는 STS-SSR 마커에 기반한 multiplex-PCR을 이용하여 국내 육성 품종 및 보급종 판별과 국내 재배 유색밀 판별을 통한 효율적인 품종 판별로 고순도 유지를 위한 체계를 구축하고자 수행 하였다.

재료 및 방법

공시 재료

본 연구에 이용된 공시재료는 농촌진흥청 국립식량과학원 밀연구팀에서 분양 받아 이용하였다. 국산 밀 49품종은 품종 판별에 이용하였으며, 보급종 품종의 판별에는 황금알이 추가되었으며, 유색밀 품종 판별을 위해서는 아리흑과 아리진흑 및 중국 수집종인 흑맥을 이용하였다.

종피색 검정

종피색 검정은 한 품종당 10립씩 건전립을 선별하여 1M NaOH 용액에 2시간 침지 시킨 후 종피색이 밝은 노란색을 띠면 백립계로 적색을 띠면 적립계로 분류하였다.

Genomic DNA 추출

온실에서 3주간 생육시켜 자란 식물체의 3엽을 채취하여 액체질소로 급속냉동 시킨 후 유발을 이용하여 미세분말로 분쇄한 뒤 -70°C에 보관하였다. Genomic DNA는 잎 분말(100 mg)로부터 식물용 genomic DNA 분리시약(Solgent, Korea)을 이용하여 추출하였다. 추출한 genomic DNA는 Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, USA)를 사용하여 정량하였고, -20°C에 보관하여 사용하였다.

Multiplex-PCR

종피색 검정을 통하여 분리된 36개 적립계 품종과 13개 백립계 품종에 대하여 각각 multiplex-PCR을 실시하였으며, 이용된 13개 프라이머 정보는 Table 1, 적립계, 백립계에 대한 multiplex- PCR 분석 조건은 Tables 2, 3에서 보는 바와 같다. 적립계 품종에 대한 판별에는 3번의 multiplex-PCR을 실시하였는데, 첫번째는 색택 관련 Ppo-A1 (Sun et al. 2005), 반왜성 유전자 Rht-B1b (Ellis et al. 2002)과 Vrn-D1a (Fu et al. 2005)를 이용하였으며, 두번째는 종실 크기 관련 TaCwi-A1 (Ma et al. 2012), Glu-A3ac (Wang et al. 2010)와 Lr34 (Vasistha et al. 2017)를 이용하였으며, 세번째는 Glu-A1c (Lafiandra et al. 1997), Glu-B1b (Lei et al. 2006), 국내 및 일본에서 개발한 품종판별 마커 KWSM003 (Son et al. 2015), TaSE96 (Fujita et al. 2009)을 이용하였다. 백립계 품종을 구별하기 위해서는 2번의 multiplex-PCR을 실시하였는데, 첫번째 multiplex-PCR에는 종실 경도 관련 Pina-D1 (Gautier et al. 1994), Ppo-A1 (Sun et al. 2005)과 Vrn-D1a (Fu et al. 2005)를 이용하였으며, 다음으로는 Glu-B3h (Wang et al. 2009)와 Ppo-B1 (Si et al. 2012)을 이용하였다. 보급종에 대한 multiplex-PCR은 Glu-A1b (Lafiandra et al. 1997), 전분 생합성 관련 Wx-B1a (Satio et al. 2009), Glu-D1d (Ahn et al. 2014)를 이용하였으며(Table 4), 유색밀에 대한 multiplex-PCR은 Glu-B3h (Wang et al. 2009)와 Pina-D1 (Gautier et al. 1994)을 이용하였다(Table 5). PCR의 신뢰성을 높이기 위해 국내 밀 품종의 multiplex-PCR에는 공우성 프라이머를 하나 이상 추가하여 모든 품종의 PCR 산물에서 단편이 관찰되게 설계하였다. 유색밀에 대한 multiplex-PCR 분석 조건은 Table 4에서 보는 바와 같으며, PCR은 Veriti® Dx 96-Well Thermal Cycler (Applied Biosystem, USA)을 사용하였고, PCR 산물은 EtBr (0.5 ug/ml)이 포함된 1.5% agarose gel에서 135V로 1시간 동안 전기영동한 후 UV transilluminator에서 확인하였다.

Table 1

Sequence of primers for identification of Korean wheat cultivars and expected PCR fragment size

Gene Marker typez Primer Sequence
(5'→3')
Fragment size (bp) Reference
Glu-A1c STS AxNull-F ACGTTCCCCTACAGGTACTA 920 (25)
AxNull-R TATCACTGGCTAGCCGACAA
Glu-A3ac Glu-A3ac-F AACAGAATTATTAAAGCCGG 573 (51)
Glu-A3ac-R CTGTGCTTGGATGATACTCTA
Glu-B1b ZSBy85F5 TTAGCGCTAAGTGCCGTCT 527 (28)
ZSBy85R5 TTGTCCTATTTGCTGCCCTT
Glu-B3h Glu-B3h-F CCACCACAACAAACATTAA 1022 (52)
Glu-B3h-R GTGGTGGTTCTATACAACGA
Lr34 csLV34 F GTTGGTTAAGACTGGTGATGG 229/150 (50)
csLV34 R TGCTTGCTATTGCTGAATAGT
Pina-D1 STS Pina-D1F ATGAAGGCCCTCTTCCTCA 447 (13)
Pina-D1R TCACCAGTAATAGCCAATAGTG-
Ppo-A1 PPO18F AACTGCTGGCTCTTCTTCCCA 685/876 (49)
PPO18R AAGAAGTTGCCCATGTCCGC
Ppo-B1 F-8F ACCTTGACTCCAGTGGGACC 400+600/400 (43)
F-8R CCGAGTAGAAGTTGCCCAT
Rht-B1b NH-BF.2 TCTCCTCCCTCCCCACCCCAAC 360 (10)
MR1 CATCCCCATGGCCATCTCGAGCTA
TaCwi-A1b CWI21F GTGGTGATGAGTTCATGGTTAAG 404 (30)
CWI21R AGAAGCCCAACATTAAATCAAC
Vrn-D1a Intr1/D/F GTTGTCTGCCTCATCAAATCC 1671 (11)
Intr1/D/R3 GGTCACTGGTGGTCTGTGC
- SCAR KWSM003F TGCTGAGGGCATATCTCAACA 682 (46)
KWSM003R GTGTTGCACGACGCTGTACT
- SSR TaSE96F TGGGACAAGTCCCTAGGTAAGACG 295/313-317 (12)
TaSE96R GTAGTCCGCCCAGCCTCTACTTTT

zSTS = sequence-tagged site, SCAR = Sequence characterized amplified region, SSR = simple sequence repeat.



Table 2

Conditions of multiplex-PCR for identification of Korean red winter wheat cultivars

Multiplex-PCR PCR1 PCR2 PCR3
Allele Ppo-A1
Rht-B1b
Vrn-D1
TaCwi-A1b
Glu-A3ac
Lr34
Glu-A1c
Glu-B1b
KWSM003
TaSE96
PCR reaction components
Taq DNA polymerase (U) 2 4 4
Each dNTP (mmol/l) 3 4 3
Primer (μmol/l) 1/1/2z 0.5/1.5/1.5y 2/1/1/1x
Concentration of DNA (ng) 120 100 80
PCR amplification condition
C 94℃, 5 m 94℃, 5 m 94℃, 5 m
Denaturation 94℃, 1 m 94℃, 1 m 94℃, 1 m
Annealing 62℃, 1 m 62℃, 1 m 64℃, 1 m
Extension 72℃, 1 m 72℃, 1 m 72℃, 1 m
No. of cycles 35 33 33
Final extension 72℃, 10 m 72℃, 10 m 72℃, 10 m
Gel electrophoresis
Agarose (%) 1.5 1.5 1.5
Voltage (V) 135 135 135
Time (h) 1 1 1

zConcentrations of primers for Ppo-A1, Rht-B1b and Vrn-D1a, respectively.

yConcentrations of primers for TaCwi-A1b, Glu-A3ac and Lr34, respectively.

xConcentrations of primers for Glu-A1c, Glu-B1b, KWSM003 and TaSE96, respectively.



Table 3

Conditions of multiplex-PCR for identification of Korean white winter wheat cultivars

Multiplex-PCR PCR1 PCR2
Allele Pina-D1/Ppo-A1/
Vrn-D1a
Ppo-B1/Glu-B3h
PCR reaction components
Taq DNA polymerase (U) 4 4
Each dNTP (mmol/l) 3 3.5
Primer (μmol/l) 2/2/3z 2/2.5y
Concentration of DNA (ng) 100 100
PCR amplification condition
Pre-denaturation 94℃, 5 m 94℃, 5 m
Denaturation 94℃, 40 s 94℃, 1 m
Annealing 60℃, 40 s 60℃, 1 m
Extension 72℃, 1 m 30s 72℃, 1 m
No. of cycles 35 33
Final extension 72℃, 5 m 72℃, 10 m
Gel electrophoresis
Agarose (%) 1.5 1.5
Voltage (V) 135 135
Time (h) 1 1

zConcentrations of primers for Pina-D1, Ppo-A1 and Vrn-D1a, respectively.

yConcentrations of primers for Ppo-B1 and Glu-B3h, respectively.



Table 4

Conditions of multiplex-PCR for identification of government certificated wheat cultivar in Korea

Multiplex-PCR
Allele Glu-A1b/Wx-B1a/Glu-D1d
PCR reaction components
Taq DNA polymerase (U) 4
Each dNTP (mmol/l) 3
Primer (μmol/l) 1.5/1/0.5z
Concentration of DNA (ng) 100
PCR amplification condition
Pre-denaturation 94℃, 5 m
Denaturation 94℃, 1 m
Annealing 64℃, 1 m
Extension 72℃, 1 m
No. of cycles 33
Final extension 72℃, 5 m
Gel electrophoresis
Agarose (%) 1.5
Voltage (V) 135
Time (h) 1

zConcentrations of primers for Glu-A1b, Wx-B1a and Glu-D1d, respectively.



Table 5

Conditions of multiplex-PCR for identification of colored Korean wheat cultivars

Multiplex-PCR
Allele Pina-D1/ Glu-B3h
PCR reaction components
Taq DNA polymerase (U) 2
Each dNTP (mmol/l) 3
Primer (μmol/l) 1/1z
Concentration of DNA (ng) 100
PCR amplification condition
Pre-denaturation 94℃, 5 m
Denaturation 94℃, 1 m
Annealing 57℃, 1 m
Extension 72℃, 1 m
No. of cycles 33
Final extension 72℃, 5 m
Gel electrophoresis
Agarose (%) 1.5
Voltage (V) 135
Time (h) 1

zConcentrations of primers for Pina-D1 and Glu-B3h, respectively.



SDS-PAGE 분석

SDS-PAGE를 이용한 고분자량 글루테닌(high-molecular- weight glutenin subunit, HMW-GS)조성 분석은 Shin et al. (2012) 방법을 이용하였다. 분쇄된 종실 40 mg에 400 μl의 sample buffer [2% (w/v) SDS, 40% (v/v) glycerol, and 0.023% (w/v) bromophenol blue]를 추가한 후 90°C에서 5분간 방치 후 SDS- PAGE를 실시하였다. SDS-PAGE에서 running gel의 acrylamide 농도는 13.0%이며, 120 V에서 6시간 전기영동을 실시하였다. 전기영동 후에 젤을 commassie blue R-250로 18시간 염색한 후 10% trichloroacetic acid로 24시간 destaining 하였다. HMW-GS 조성 분석은 Payne & Lawrence (1983) 방법에 따라 평가하였다.

결과 및 고찰

종피색 구분

국산밀 49개 품종의 종피색 검정 이후 진행된 multiplex-PCR을 통해 효율적인 품종판별이 가능했다. 종피색 검정법은 품종판별에서 흔하게 이용되는 방법으로 KOH, NaOH, Peroxidase Test 등이 있으며(Salem et al. 2018, Chauhan et al. 2020), 적립계와 백립계로 구분이 가능한 NaOH 검정법을 국산밀 품종판별에 이용한 결과, 경광, 고분, 고소, 그루, 남해, 다중, 다홍, 밀성, 새금강, 새올, 서둔, 수강, 수안, 신미찰, 신미찰1, 안백, 알찬, 영광, 올, 올그루, 우리, 은파, 장광, 조광, 조농, 조아, 조은, 조중, 조품, 조한, 진품, 진풍, 청계, 탑동과 태중은 적색으로 착색되어 적립계로 구분되었으며(Fig. 1A), 금강, 다분, 백강, 백중, 백찰, 연백, 적중, 조경, 중모2003, 중모2004, 중모2008과 중모2012는 밝은 노란색으로 착색되어 백립계로 구분되었다(Fig. 1B).

Fig. 1. Grain color treated with 1M NaOH for 2 hours. (A) Red color wheat, (B) White color wheat. 1, Alchan; 2, Anbaek; 3, Chokwang; 4, Chunggye; 5, Dahong; 6, Dajung; 7, Eunpa; 8, Geuru; 9, Gobun; 10, Goso; 11, Hojoong; 12, Jangkwang; 13, Jinpoom; 14, Jinpoong; 15, Joah; 16, Joeun; 17, Johan; 18, Jojoong; 19, Jonong; 20, Jopoom; 21, Kyungkwang; 22, Milseong; 23, Namhae; 24, Ol; 25, Olgeuru; 26, Saekeumkang; 27, Saeol; 28, Seodun; 29, Sinmichal; 30, Shinmichal 1; 31, Sooan; 32, Sugang; 33, Taejoong; 34, Tapdong; 35, Uri; 36, Yungkwang; 37, Baekchal; 38, Baekjoong; 39, Baekkang; 40, Dabun; 41, Hanbaek; 42, Jeokjoong; 43, Jokyoung; 44, Joongmo2003; 45, Joongmo2004; 46, Joongmo2008; 47, Joongmo2012; 48, Keumkang; 49, Younbaek.

적립계 품종 판별

적립계 품종 판별을 위해 3번의 multiplex-PCR 수행 결과(Fig. 2), 첫번째로 Ppo-A1, Vrn-D1a과 Rht-B1b을 이용하여 태중이 구별 되었고(Fig. 3A), 두번째 PCR에서 Glu-A3ac, TaCwi-A1bLr34를 이용하여 14개 품종(경광, 고분, 고소, 그루, 남해, 밀성, 새금강, 새올, 수강, 안백, 올, 올그루, 조아와 조중)이 구별되었으며(Fig. 3B), Glu-A1ac, Glu-B1b, KWSM003과 TaSE96을 이용한 세번째 PCR에서 21개 품종(다중, 다홍, 서둔, 수안, 신미찰, 신미찰1, 알찬, 영광, 우리, 은파, 장광, 조광, 조농, 조은, 조품, 조한, 진품, 진풍, 청계, 탑동과 호중)이 구별 되었다(Fig. 3C).

Fig. 2. The scheme for multiplex-PCR of Korean wheat cultivars. In red wheat cultivars, Taejoong was separated from Ppo-A1, Vrn-D1a and Rht-B1b, 14 wheat cultivars were separated from Glu-A3ac, TaCwi-A1b and Lr34, 21 cultivars were separated from Glu-A1ac, Glu-B1b, KWSM003 and TaSE96. In white wheats, Baekjoong and Joongmo2003 were separated from Ppo-A1, Vrn-D1a and Pina-D1a. 9 wheat cultivars were separated from Ppo-B1 and Glu-B3h. Jokyung and Baekkang were not distinguished with any markers in this study.

Fig. 3. Agarose gel electrophoresis of multiplex-PCR1 (A), PCR2 (B) and PCR3 (C) PCR in Korean red wheat cultivars. M, Size marker; 1, Alchan; 2, Anbaek; 3, Chokwang; 4, Chunggye; 5, Dahong; 6, Dajung; 7, Eunpa; 8, Geuru; 9, Gobun; 10, Goso; 11, Hojoong; 12, Jangkwang; 13, Jinpoom; 14, Jinpoong; 15, Joah; 16, Joeun; 17, Johan; 18, Jojoong; 19, Jonong; 20, Jopoom; 21, Kyungkwang; 22, Milseong; 23, Namhae; 24, Ol; 25, Olgeuru; 26, Saekeumkang; 27, Saeol; 28, Seodun; 29, Sinmichal; 30, Shinmichal 1; 31, Sooan; 32, Sugang; 33, Taejoong; 34, Tapdong; 35, Uri; 36, Yungkwang.

국수의 색택에 관련된 Polyphenol oxidase (PPO) 활성은 소비자가 국수를 선택하는데 있어 중요하기 때문에 국수용 품종 육성에 이용되는 표지인자이다(Sun et al. 2005). Ppo-A1b 유전자를 지닌 품종은 Ppo-A1a 유전자를 지닌 품종에 비해 PPO 활성이 낮아 밀가루 색이나 국수 면대의 색택이 국수용에 적합하다(Sun et al. 2005). 경광, 고분, 그루, 다중, 새금강, 수안, 안백, 올, 은파, 조농, 조은, 조한, 탑동과 태중이 685 bp로 Ppo-A1a 을 지닌 것으로 나타났고, 876 bp로 Ppo-A1b를 지닌 품종은 고소, 남해, 다홍, 밀성, 새올, 서둔, 수강, 신미찰, 신미찰1, 알찬, 영광, 올그루, 우리, 장광, 조광, 조아, 조중, 조품, 진품, 진풍, 청계와 호중으로 이러한 결과는 국내 품종을 평가한 이전 결과와 일치하였다(Kim et al. 2012).

밀의 개화 시기를 조절하는 Vernalization (Vrn) 유전자는 Vrn-A1 (Vrn1), Vrn-B1 (Vrn2), Vrn-D1 (Vrn3), Vrn-4Vrn-B3 (Vrn5)로 5개 이상의 대립유전자에 의해 개화시기가 결정된다(Zhang et al. 2008). Vrn의 핵심 유전자는 Vrn-A1, Vrn-B1Vrn-D1로 5A, 5B 및 5D 염색체에 위치하며, Vrn-B3는 7BS 염색체에 위치한다(Zhang et al. 2008). 다수의 품종에서 변이가 관찰된 Vrn-D1a를 이용한 본 실험 결과, 고분, 밀성, 새올, 서둔, 신미찰, 신미찰1, 알찬, 우리, 은파, 조아, 조품, 진품, 청계, 탑동과 태중에서 1671 bp가 관찰되었으며, Vrn-D1a를 지닌 품종은 Vrn-D1을 지닌 품종에 비해 간장과 수장이 짧고 출수기가 빠른 것으로 보고되었다(Cho et al. 2015). 이전 보고에서 은파의 유전자형은 Vrn-D1이었으나(Cho et al. 2015), 본 실험에서 Vrn-D1a로 관찰되었는데, 이러한 차이는 종자의 증식 과정에서 이품종이 혼입되었을 가능성과 이전 실험 결과에서 분양 받은 종자와 본 논문에서 분양 받은 종자가 동일하지 않은 가능성을 배제할 수 없지만, 충분한 반복 실험으로 진행된 본 실험의 연구 결과가 정확한 것으로 판단된다.

반왜성 유전자인 Reduced height (Rht) 유전자는 식물 생장에 관여하는 지베렐린(GA) 전사 조절인자 DELLA 단백질 유전자 좌에 위치하며 이들 유전자의 돌연변이에 의해 식물 생장 억제를 통한 반왜성의 표현형이 나타난다(Shin et al. 2014). Rht 유전자는 Rht-A1, Rht-B1Rht-D1로 4번 염색체에 위치하며 Rht-B1a/ Rht-D1a를 포함하는 품종들은 키가 큰 것으로 보고되었다(Ellis et al. 2002, Shin et al. 2014). Rht-B1b를 지녀 360 bp가 관찰된 품종은 고소, 그루, 밀성, 새금강, 새올, 수강, 신미찰, 신미찰1, 안백, 영광, 장광, 조광, 조중, 진풍과 태중이었으며, 이전 결과와 일치하였다(Shin et al. 2014, Cho et al. 2016).

밀 저장 단백질인 글루텐은 글루테닌과 글리아딘으로 이루어져 있으며, 글루테닌은 단백질 분자량에 따라 HMW-GS와 저분자 글루테닌(low-molecular-weight glutenin subunit, LMW-GS)으로 분류되며 밀가루 반죽의 탄성과 강도를 결정한다(Khoshro et al. 2021). 밀 저장 단백질의 40%를 차지하며 글루텐의 신장성에 관여하는 LMW-GS는 HMW-GS와 결합을 통해 탄성에 관여한다. LMW-GS는 1번 염색체 단완에 있는 Glu-A3, Glu-B3Glu-D3에 의해 암호화되며, 현재까지 Glu-A3 유전자좌에는 8개, Glu-B3 유전자좌에는 17개, Glu-D3 유전자좌에는 22개의 대립유전자가 보고되었고, 국내 품종에서는 각각 4개(a, c, d, e), 4개(d, g, h, i)와 3개(a, b, c)가 보고되었다(Shin et al. 2012, Khoshro et al. 2021). 경광, 그루, 다중, 다홍, 밀성, 새금강, 수안, 신미찰, 신미찰1, 영광, 장광, 조광, 조아, 조중, 진풍, 태중과 호중은 573 bp로 Glu-A3ac였으며, 이전 보고에서 Glu-A3c였던 조농은 본 연구에서는 Glu-A3f로 나타났다(Shin et al. 2012).

밀의 종실 크기와 관련된 유전자인 TaCwi-A1은 설탕을 포도당과 과당으로 전환시키는 세포벽 전환효소(cell wall invartase)와 상관이 있다. 이는 밀의 수량과 종실 무게에도 상관이 있으며, TaCwi-A1a 유전자를 지닌 품종이 TaCwi-A1b를 지닌 품종보다 리터중이 높다(Ma et al. 2012). 국내 품종의 종실 특성을 평가한 결과, TaCwi-A1의 유전자형에 따른 종실 특성 차이는 나타나지 않았지만(Kim et al. 2020), 국내 품종에서 다양한 변이를 나타내어 품종판별 마커로 사용 가능하다. TaCwi-A1b를 지닌 경광, 고분, 고소, 그루, 남해, 다중, 다홍, 새금강, 서둔, 수안, 신미찰, 신미찰1, 알찬, 영광, 올, 올그루, 우리, 장광, 조광, 조농, 조아, 조은, 조품, 조한, 진품, 진풍, 청계, 태중과 호중에서 404 bp가 관찰되었으며, 이전 결과와 일치하였다(Kim et al. 2014).

녹병은 생물성 스트레스로 인해 발현된 대표적인 곰팡이병으로 이는 전세계 밀의 생산량에 위협이 되며, 잎녹병이 가장 빈번하고 광범위하게 발생된다(Kim et al. 2020). 잎녹병과 관련된 Lr34는 줄녹병 유전자 Yr18, 흰가루병 유전자 Pm38과 줄기녹병 유전자 Sr57에 동시 저항성을 나타내는 다면발현 특성을 지니며 7DS 염색체에 위치한다(Lagudah et al. 2009). Lr34a를 지녀 229 bp가 관찰된 품종은 고분, 고소, 다중, 다홍, 새금강, 서둔, 수강, 수안, 안백, 영광, 올그루, 은파, 장광, 조광, 조농, 조은, 조품, 조한, 진품, 진풍, 탑동, 태중, 호중이고, Lr34b를 지녀 150 bp가 관찰된 품종은 경광, 그루, 남해, 밀성, 새올, 신미찰, 신미찰1, 알찬, 올, 우리, 조아, 조중과 청계로 Lr34a를 지닌 품종이 Lr34b를 지닌 품종보다 잎녹병에 저항성을 갖는 것으로 알려져 있다(Lagudah et al. 2009). 국산밀의 녹병 저항성에 관한 연구가 미흡하지만 기후변화와 생산안정성을 위해 저항성 유전자원 확보 및 도입을 통한 녹병 저항성 관련 추가적인 연구 필요하다.

HMW-GS는 1번 염색체의 장완에 위치하고 있으며, 현재까지 Glu-A1, Glu-B1Glu-D1 유전자좌에 각각 22개, 52개, 36개의 대립유전자가 보고되었다(Shin et al. 2020, Li et al 2021). 국내 품종에서는 Glu-A1Glu-D1는 각각 3종의 대립유전자(a, b, ca, d, f)가 보고되었고, Glu-B1에서는 4종의(b, c, f, i) 대립유전자가 보고되었다(Shin et al. 2020). Glu-A1cGlu-B1b를 활용한 마커 판별 결과, Glu-A1c을 지녀 920 bp가 관찰된 품종은 각각 경광, 고분, 그루, 남해, 다홍, 밀성, 새올, 서둔, 수강, 신미찰1, 안백, 올, 우리, 은파, 조광, 조농, 조은, 조중, 조품, 진품, 진풍, 청계와 태중이었으며, Glu-B1b를 지녀 527 bp가 관찰된 품종은 경광, 고소, 그루, 남해, 다홍, 밀성, 새금강, 새올, 서둔, 수안, 신미찰, 알찬, 영광, 올, 올그루, 우리, 장광, 조광, 조아, 진품, 진풍, 청계, 탑동과 호중이었다.

KWSM003과 TaSE96은 각각 한국과 일본에서 육성자의 권리 보호와 품종 혼입의 문제 등을 방지하기 위해 개발한 품종판별 마커로, 국내산 밀 품종에서 변이가 관찰되어 본 연구에 활용되었다(Fujita et al. 2009, Son et al. 2015). KWSM001, KWSM002, KWSM003, KWSM004, KWSM005와 KWSM006를 사용하여 13개 품종을 구분하였고, 이 중 KWSM003으로 서둔과 진품의 구별이 가능하였다(Son et al. 2013). TaSE96은 EST (Expressed sequence tag)-SSR 마커로 식물에서 발현된 유전자를 기반으로 제작되어 식물의 형태적 특성과 높은 상관관계를 가지며, 종간 구별에도 이용에도 사용가능하기 때문에 본 연구에 이용하였다(Gupta et al. 2003). 일본밀에서 EST-SSR marker인 TaSE3, TaSE6, TaSE7 등 10개의 프라이머를 사용하여 55개 품종이 구분하였고(Fujita et al. 2009), TaSE96 을 활용하여 장광과 영광이 구분되었다. KWSM003에서 682 bp가 관찰된 품종은 경광, 고분, 남해, 밀성, 서둔, 올, 은파, 조광, 조은, 조품, 청계, 탑동과 호중이었으며, 나머지 24개 품종은 단편이 관찰되지 않았다. TaSE96에서 300 bp 이하의 낮은 단편을 나타낸 품종은 알찬, 영광과 우리였으며, 나머지 33개 품종에서는 300 bp 이상의 높은 단편이 나타났다.

백립계 품종 판별

백립계 밀 13개 품종 구분은 2번의 PCR을 수행하였으며(Fig. 4), 첫번째 multiplex-PCR에 이용된 마커는 Ppo-A1, Vrn-D1aPina-D1a로 백중과 중모2003 두 개의 품종이 구별 가능하였고, 두번째 PCR에서는 Ppo-B1Glu-B3h로 9개 품종(금강, 다분, 백찰, 연백, 적중, 중모2004, 중모2008, 중모2012와 한백)이 구별 되었으며 조경과 백강은 구분되지 않았다(Fig. 2).

Fig. 4. Agarose gel electrophoresis of multiplex-PCR1 (A) and PCR2 (B) in Korean white wheat cultivars. M, Size marker; 1, Baekchal; 2, Baekjoong; 3, Baekkang; 4, Dabun; 5, Hanbaek; 6, Jeokjoong; 7, Jokyoung; 8, Joongmo2003; 9, Joongmo2004; 10, Joongmo2008; 11, Joongmo2012; 12, Keumkang; 13, Younbaek.

백립계 품종 구분을 위해 사용된 Ppo-A1Vrn-D1a 유전자는 적립계와 동일한 마커를 사용하였으며, Ppo-A1a를 지닌 품종은 금강, 백강, 백찰, 조경, 중모2003, 중모2004과 중모2008이었으며, Ppo-A1b를 지닌 품종은 다분, 백중, 연백, 적중, 중모2012과 한백으로 나타났다. Vrn-D1a를 지닌 품종은 백강, 백중, 연백, 적중, 조경과 중모2008이었으며, 나머지 7개 품종은 증폭이 이루어지지 않았다. Ppo-B1에 관한 활성은 Ppo-A1Ppo-D1와 연관되어 나타나지만(Sadeque et al. 2018), 국산밀 품종의 Ppo-B1 유전적 조성은 평가되지 않았아 추가적인 연구가 필요하다. 본 연구에서 백립계 밀 품종에 대한 평가 결과, Ppo-B1a를 지녀 400 bp와 600 bp가 관찰된 품종은 다분, 백중, 백찰, 연백과 한백이었으며, Ppo-B1b를 지녀 400 bp가 관찰된 품종은 금강, 백강, 적중, 조경, 중모2003, 중모2004, 중모2008과 중모2012이었다.

Glu-B3h을 지녀 1022 bp가 관찰된 품종은 금강, 백강, 조경, 중모2003과 한백이었는데, 이전 연구에서 다홍과 조농은 Glu-B3h로 보고되었지만(Shin et al. 2012), 본 연구에서는 다홍은 Glu-B3i, 조농은 Glu-B3g로 나타났다. Pina-D1은 종실경도와 관련된 유전자로 제분 및 밀가루의 물리적 특성에 영향을 미치기 때문에 국내에서도 제분율 향상을 위해 Puroindoline (Pin) 유전자에 대한 관심이 높아지고 있다(Ahn et al. 2014). Pin 유전자는 5D 염색체 단완에 존재하며, 연질밀은 야생 유전자형인 Pina-D1a를 가지고 경질밀은 Pina-D1b를 가진다(Gautier et al. 1994). Pina-D1a를 지녀 447 bp가 관찰된 품종은 금강, 다분, 백강, 백중, 백찰, 조경, 중모2004, 중모2008, 중모2012과 한백이었으며, 적중은 이전 결과에서는 Pina-D1a로였지만 본 연구에서는 Pina-D1b로 나타났다(Park et al. 2010).

보급종 품종 판별

보급종은 정부에서 엄격한 생산 계획과 관리 하에 격리된 포장에서 종자를 생산하여 보급하고 있으며, 현장에서 고순도의 보급종 공급 및 품질 검사를 위해 Glu-A1b, Glu-D1dWx-B1a로 multiplex-PCR을 구성하였다. 2022년 기준 보급종은 금강, 백강, 조경과 새금강의 검정에서는 조경과 백강이 구분되지 않지만(Fig. 5A), 2023년 이후 조경이 제외되며, 2024년에는 황금알이 추가되기 때문에 2023년 이후 보급종의 구별은 가능하였다(Fig. 5B).

Fig. 5. Agarose gel electrophoresis of multiplex-PCR for 2022 Korean government certificated wheat cultivars (A) and agarose gel electrophoresis (B) and SDS-PAGE (C) after 2024 Korean government certificated wheat cultivars. (A) M, Size marker; 1, Baekkang; 2, Jokyoung; 3, Geumgang, 4, Saekeumkang; (B) M, Size marker; 1, Baekkang; 2, Hwanggeumal; 3, Geumgang, 4, Saekeumkang; (C) 1, Baekkang; 2, Hwanggeumal; 3, Keumkang, 4, Saekeumkang.

보급종 판별에 이용된 Wx-B1a는 찰성 단백질로 알려진 GBSS Ⅰ 유전자좌에서 발현되는 단백질로, GBSS Ⅰ 유전자는 Wx-A1, Wx-B1Wx-D1이며 이 중 한 개 또는 두 개가 부분적으로 결핍되면 부분찰성의 특성을 지녀 메성밀에 비해 아밀로스 함량이 낮다(Saito et al. 2008). 국산밀 품종에서는 백찰, 신미찰과 신미찰1은 찰밀의 조성을 나타내었고, 호중(Wx-B1b)과 중모2012(Wx-A1bWx-D1b)는 부분찰성밀로 다른 품종에 비하여 아밀로스 함량이 낮다(Park et al. 2021). 보급종 multiplex-PCR 결과 Glu-A1b를 지녀 1319 bp가 관찰된 품종은 금강과 새금강이었고, Glu-D1d를 지녀 450 bp가 관찰된 품종은 금강, 백강, 조경과 황금알이었으며, Wx-B1a를 지녀 778 bp가 관찰된 품종은 금강, 백강과 조경이었다. 2024년 이후 보급종에 대해서는 Glu-1의 SDS-PAGE 검정으로도 구별이 가능하였다(Fig. 5C).

유색밀 품종 판별

최근 농촌진흥청에서 국산 밀의 생산 및 소비 확대를 위해 유색밀 품종 ‘아리흑’과 ‘아리진흑(Kim et al. 2021)’을 개발하였다. ‘아리흑’은 안토시아닌이 포함되어 항산화 기능이 강화된 밀로 특히 cyanidin-3-O-glucoside 및 peonidin-3-0-glucoside의 함량이 많기 때문에 생식용, 가공용으로 활용될 수 있으며(Jin et al. 2021), ‘아리진흑’은 가공 및 통밀용으로 아리흑보다 조숙, 단간이며 색소를 고함유한 계통이다(Kim et al. 2021). 현재 이들 품종에 대한 기능성 물질 및 활용에 대한 추가적인 연구가 진행되고 있는 상황에서 중국에서 불법 유통된 흑밀은 국내 유색밀 품종과 육안으로 구별이 어렵다(Fig. 6A). 국내 유색밀 품종의 순도 유지와 보급을 위해 Glu-B3hPina-D1a를 이용한 multiplex-PCR로 3품종을 구별하였다(Fig. 6B). Glu-B3h를 나타내어 1022 bp가 관찰된 품종은 아리진흑이었으며, 중국산 흑밀과 아리진흑은 증폭이 되지 않았고, Pina-D1a를 나타내어 425 bp가 관찰된 품종은 아리진흑과 중국산 흑밀로 아리흑과 구별되었다.

Fig. 6. Grain (A) and agarose gel electrophoresis of multiplex- PCR (B) in colored wheat cultivars. M, Size marker; 1, Arijinheuk; 2, Chinese Heuk; 3, Ariheuk.
적 요

본 연구는 품종 판별을 통한 국내 밀 품종의 순도 유지 향상을 위하여, 국내 육성 49개 품종 및 보급종과 유색밀에 대한 STS와 SSR 마커 기반 multiplex-PCR 을 실시하였다. 국내 품종은 종피색으로 36개의 적립계와 13개의 백립계로 구분되었고, 적립계 품종과 백립계 품종은 각각 3번과 2번의 PCR을 통하여 품종 구분이 가능하였다. 적립계 품종은 Ppo-A1, Rht-B1Vrn-D1a을 이용한 첫 번째 PCR에서 태중이 구분되었고, 두 번째 PCR (Glu-A3ac, Lr34TaCwi-A1b)에서 14개 품종이 구분되었으며 세 번째 PCR (Glu-A1c, Glu-B1b, KWSM003과 TaSE96)에서 나머지 21개 품종이 구분되었다. 백립계 품종은 첫 번째 PCR (Pina-D1a, Ppo-A1Vrn-D1a)에서 백중과 중모2003이 구분되었고, 두 번째 PCR (Ppo-B1Glu-B3h)에서 9개 품종이 구분되었지만, 조경과 백강은 구별되지 않았다. 보급종은 Glu-A1b, Glu-D1dWx-B1a를 이용하면 2023년 이후에는 구별이 가능하였으며, Glu-B3hPina-D1a를 활용하면 국내 유색밀 품종인 아리흑과 아리진흑 및 중국산 흑맥의 구별이 가능하였다.

사 사

본 연구는 농촌진흥청 연구사업(세부과제명: 밀 품질 균일화를 위한 대규모 시범단지의 품질 분석 및 모니터링, 과제번호: PJ015965)과 전북대학교 연구기반 조성비 지원에 의해 이루어졌음.

References
  1. Agarwal M, Shrivastava N, Padh H. 2008. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep 27: 617-631.
    Pubmed CrossRef
  2. Ahn JH, Kang CS, Jeun JU, Baik BK, Park CS. 2014. Effect of allelic variations at the Glu-D1, Glu-A3, Glu-B3 and Pinb-D1 loci on flour characteristics and bread loaf volume. Int Food Res J 21: 1141-1149.
  3. Amiteye S. 2021. Basic concepts and methodologies of DNA marker systems in plant molecular breeding. Heliyon 7: e08093.
    Pubmed KoreaMed CrossRef
  4. Azizi MMF, Lau HY, Abu-Bakar N. 2021. Integration of advanced technologies for plant variety and cultivar identification. J Biosci 46: 91-110.
    Pubmed CrossRef
  5. Bae GK, Park RU. 2020. A study on the development of the Korean wheat industry in Jeollabukdo. Jeonbuk Institute.
    CrossRef
  6. Butler JM, Coble MD, Vallone PM. 2007. STRs vs. SNPs: Thoughts on the future of forensic DNA testing. Forensic Sci Med Pathol 3: 200-205.
    Pubmed CrossRef
  7. Chauhan KP, Babariya CA, Hirpara AB, Babariya PA. 2020. Characterization of bread wheat (Triticum aestivum L.) genotypes through chemical test. Indian J Pure App Biosci 8: 364-369.
    CrossRef
  8. Cho EJ, Kang CS, Yoon YM, Park CS. 2015. The relationship between allelic variation of Vrn-1 and Ppd-1 and agronomic traits in Korean wheat cultivars. Indian J Genet 75: 294-300.
    CrossRef
  9. Cho EJ, Kang CS, Yoon YM, Park CS. 2016. The effects of Rht semi-dwarfing alleles on agronomic traits in Korean wheat cultivars. Indian J Genet 76: 31-39.
    CrossRef
  10. Ellis MH, Spielmeyer W, Gale KR, Rebetzke GJ, Richards RA. 2002. "Perfect" markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor Appl Genet 105: 1038-1042.
    Pubmed CrossRef
  11. Fu D, Szűcs P, Yan L, Helguera M, Skinner JS, von Zitzewitz J, Hays PM, Dubcovsky J. 2005. Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol Gen Genet 273: 54-65.
    Pubmed CrossRef
  12. Fujita Y, Fukuoka H, Yano H. 2009. Identification of wheat cultivars using EST-SSR markers. Breeding Sci 59: 159-167.
    CrossRef
  13. Gautier MF, Aleman ME, Guirao A, Marion D, Joudrier P. 1994. Triticum aestivum puroindolines, two basic cystine-rich seed proteins: cDNA sequence analysis and developmental gene expression. Plant Mol Biol 25: 43-57.
    Pubmed CrossRef
  14. Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS. 2003. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Gen Gen 270: 315-323.
    Pubmed CrossRef
  15. Jin HY, Hee HS, Kim KH, Kang CS, Choi HS, Youn Y. 2021. Phytochemical components and physiological activities of purple wheat bran 'Arriheuk' extracts. Korean J Food Preserv 28: 372-383.
    CrossRef
  16. Jung EM, Lee DY, Kim TH, Park EJ, Song DH. 2020. Research on establishment of mid-to-long-term development plan for wheat industry in Korea. Korea Rural Economic Institute.
  17. Jung JK. 2020. Korea patent 10-0135810. SNP marker and primer set for discrimination of Korean wheat and use Thereof.
  18. Khoshro HH, Bihamta MR, Hassani ME. 2021. Relationship between allelic variation at the Glu-3 loci and qualitative traits in bread wheat. Cereal Res Commun. https://doi.org/10.1007/s42976-021-00203-8.
    CrossRef
  19. Kim KH, Kang CS, Cheong YK, Park CS, Kim KH, Kim HS, Kim YJ, Yun SJ. 2012. Selection of Korean wheat germplasms with law polyphenol oxidase using polyphenol oxidast-Specific DNA markers. Korean J Breed Sci 44: 11-18.
  20. Kim KH, Kim KM, Shin DJ, Park HH, Kang CS, Hyun JN, Oh MK. 2019. Korea patent 10-2035666.. A new variety of wheat (KCTC18591P) and food composition for anti-oxidative activity comprising thereof.
  21. Kim KM, Cho SW, Choe R, Ryu NK, Hwang JY, Kim JW, Kim KH, Kang CS, Park CS. 2020. Allelic variation at loci associated with grain properties in Korean wheat cultivars. Korean J Breed Sci 52: 362-373.
    CrossRef
  22. Kim KM, Cho SW, Kang CS, Kim KH, Choi CH, Son JH, Park CS, Mo YJ. 2020. Research advances in wheat breeding and genetics for leaf rust resistance. Korean J Breed Sci 52: 213-224.
    CrossRef
  23. Kiszonas A, Morris CF. 2018. Wheat breeding for quality: An historical review. Cereal Chem 95: 17-34.
    CrossRef
  24. Korir NK, Han J, Shangguan L, Wang C, Kayesh E, Zhang Y, Fang J. 2012. Plant variety and cultivar identification: Advances and prospects. Crit Rev Biotechnol 33: 111-125.
    Pubmed CrossRef
  25. Lafiandra D, Tucci GF, Pavoni A, Turchetta T, Margiotta B. 1997. PCR analysis of x- and y-type genes present at the complex Glu-A1 locus in durum and bread wheat. Theor Appl Genet 94: 235-240.
    CrossRef
  26. Lagudah ES, Krattinger SG, Herrera-Foessel S, Singh RP, Huerta-Espino J, Spielmeyer W, Brown-Guedira G, Selter LL, Keller B. 2009. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet 119: 889-898.
    Pubmed CrossRef
  27. Lee JY, Beom HR, Kim YT, Lim SH, Yoon UH, Kim CK, Seol YJ, Lee CH, Lee HJ, Kim YM. 2014. Low-molecular- weight glutenin subunits in common wheat (Triticum aestivum L.). Korean J Breed Sci 46: 342-352.
    Pubmed KoreaMed CrossRef
  28. Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia XC, Butow BJ, Ma W. 2006. Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J Cereal Sci 43: 94-101.
    CrossRef
  29. Li Y, Fu J, Shen Q, Yang D. 2020. High-molecular-weight glutenin subunits: genetics, structures, and relation to end use qualities. Intl J Mol Sci 22: 184-197.
    Pubmed KoreaMed CrossRef
  30. Ma D, Yan J, He Z, Wu L, Xia X. 2012. Characterization of a cell wall invertase gene TaCwi-A1 on common wheat chromosome 2A and development of functional markers. Mol Breed 29: 43-52.
    CrossRef
  31. MAFRA. 2021. Agriculture, food and rural affairs statistics yearbook.
    CrossRef
  32. Milec Z, Tomková L, Sumíková T, Pánková K. 2012. A new multiplex PCR test for the determination of Vrn-B1 alleles in bread wheat (Triticum aestivum L.). Mol Breeding 30: 317-323.
    CrossRef
  33. Park CS, Kang CS, Cheong YK, Jung WS, Woo SH. 2010. Influence of puroindoline genotypes on grain characteristics, physico-chemical properties of flour and end-use quality of Korean wheats. Breed Sci 60: 233-242.
    CrossRef
  34. Park JH, Park CS, Kang CS, Yang JW, Jung HY, Kim KM, Choi CH, Son JH, Son JY, Park TI, Kim KH. 2021. Effect of starch and hardness characteristics of Korean wheat cultivars on noodle quality. Korean J Breed Sci 53: 83-95.
    CrossRef
  35. Payne PI, Lawrence GJ. 1983. Catalogue of alleles for the complex gene loci, Glu-A1, Glu-B1 and Glu-D1 which code for high-molecular-weight subunits of glutenin in hexaploid wheat. Cereal Res Commun 11: 29-35.
  36. Rasheed A, Xia X. 2019. Form markers to genome-based breeding in wheat. Theor Appl Genet 132: 767-784.
    Pubmed CrossRef
  37. Sadeque A, Turner M, Khan A, Ahmed N, Adhikari K. 2018. Identification of quantitative trait loci markers using diversity arrays technology for polyphenol oxidase activity in hexaploid wheat. New Zeal J Crop Hort 46: 243-253.
    CrossRef
  38. Salem RO, Alzweek SM, Abraheem AA, Heba M, Farhat N. 2018. Characterization of some wheat (Triticum aestivum L.) genotypes by qualitative chemical tests. Libyan J Agr 23: 63-76.
  39. Satio M, Vrinten P, Ishikawa G, Graybosh R, Nakamura T. 2009. A novel codominant marker for selection of the null Wx-B1 allele in wheat breeding programs. Mol Breed 23: 209-217.
    CrossRef
  40. Shin DJ, Cha JK, Lee SM, Ko JM, Lee JH. 2020. Validation and selection of functional allele-specific molecular markers to analyze high-molecular-weight glutenin subunit composition in Wheat. Korean J Breed Sci 52: 235-243.
    CrossRef
  41. Shin SH, Kang CS, Kim KH, Park CS. Analysis of glutenin compositions in Korean wheat cultivar using SDS-PAGE and PCR. Korean J Breed Sci. 44. p. 245-257.
  42. Shin SH, Kim KH, Son JH, Kang CS, Cheong YK, LEE CK, Park JC, Park CS. 2014. Analysis of semi-dwarf gene (Rht) construction and its relationship with agronomic characteristics, pre-harvest sprouting, and fusarium head blight in Korean wheat cultivar. J Agr Rural Life Sci 45: 72-79.
    CrossRef
  43. Si H, Zhou Z, Wang X, Ma C. 2012. A novel molecular marker for the polyphenol oxidase gene located on chromosome 2B in common wheat. Mol Breed 30: 1371-1378.
    CrossRef
  44. Skowrońska R, Kwiatek M, Tomkowiak A, Nawracala J. 2019. Development of multiplex PCR to detect slow rust resistance genes Lr34 and Lr46 in wheat. J Appl Genetics 60: 301-304.
    Pubmed KoreaMed CrossRef
  45. Son JH, Kang CS, Cheong YK, Park JC, Kim YK, Park JH, Kim KH, Park TI, Kim BK. 2017. Assessment of genetic diversity and identification of Korean wheat varieties using RAPD markers. Korean J Breed Sci 49: 65-71.
    CrossRef
  46. Son JH, Kang CS, Kim KH, Shin SH, Kim HS, Kim KH, Lee CK, Hyun JN, Park KG, Park KH. 2015. Korea patent 10-1546428. SCAR marker for cultivar discrimination in Korean breeding wheat and use thereof.
  47. Son JH, Kang CS, Kim KH, Shin SH, Kim HS, Kim NS, Hyun JN, Shim SI, Lee CK, Park KG. 2013a. ISSR-derived molecular markers for Korean wheat cultivar identification. Korean J Breed Sci 1: 262-269.
    CrossRef
  48. Son JH, Kang CS, Kim KH, Shin SH, Kim HS, Kim NS, Hyun JN. 2013b. Current status and future prospects for Korean wheat research using molecular markers. Korean J Breed Sci 45: 189-200.
    CrossRef
  49. Sun DJ, He ZH, Xia XC, Zhang LP, Morris CF, Appels R, Ma WJ, Wang H. 2005. A novel STS marker for polyphenol oxidase activity in bread wheat. Mol Breed 30: 1371-1378.
    CrossRef
  50. Vasistha NK, Balasubramaniam A, Mishra VK, Srinivasa J, Chand R, Joshi AK. 2017. Molecular introgression of leaf rust resistance gene Lr34 validates enhanced effect on resistance to spot blotch in spring wheat. Euphytica 213: 262-272.
    CrossRef
  51. Wang L, Li G, Peña RJ, Xia X, He Z. 2010. Development of STS markers and establishment of multiplex PCR for Glu-A3 alleles in common wheat (Triticum aestivum L.). J Cereal Sci 51: 305-312.
    CrossRef
  52. Wang L, Zhao XL, He ZH, Ma W, Appels R, Peña RJ, Xia XC. 2009. Characterization of low molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common wheat (Triticum aestivum L.). Theor Appl Genet 118: 525-539.
    Pubmed CrossRef
  53. Wang LX, Qiu J, Chang LF, Liu LH, Li HB, Pang BS, Zhao CP. 2015. Assessment of wheat variety distinctness using SSR markers. J Integr Agr 15: 1923-1935.
    CrossRef
  54. Zhang XK, Xiao YG, Zhang Y, Xia XC, Dubcovsky J, He ZH. 2008. Allelic variation at the vernalization genes Vrn-A1, Vrn-B1, Vrn-D1, and Vrn-B3 in Chinese wheat cultivars and their association with growth habit. Crop Sci 48: 458-470.
    CrossRef


June 2022, 54 (2)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information