search for




 

Construction of Genetic Linkage Map in Grape ‘Tano Red’ (Vitis labrusca×V. vinifera)בRuby Seedless’ (V. vinifera) F1 Population Using SNP Markers
포도 ‘Tano Red’ בRuby Seedless’ 집단에서 SNP 분자표지를 이용한 유전자지도 작성
Korean J. Breed. Sci. 2022;54(4):260-275
Published online December 1, 2022
© 2022 Korean Society of Breeding Science.

Seung Hyeon Joung1, Dongjun Im2, Youn Young Hur2, and Jundae Lee1*
정승현1⋅임동준2⋅허윤영2⋅이준대1*

1Department of Horticulture, Jeonbuk National University, Jeonju, 54896, Republic of Korea
2Fruit Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration, Wanju, 55365, Republic of Korea
1전북대학교 농업생명과학대학 원예학과, 2농촌진흥청 국립원예특작과학원 과수과
Correspondence to: E-mail: ajfall@jbnu.edu, Tel: +82-63-270-2560, Fax: +82-63-270-2581
Received August 29, 2022; Revised October 10, 2022; Accepted October 10, 2022.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Grape (Vitis vinifera L.) is a perennial fruit tree with high heterozygosity, consisting of 38 chromosomes (2n=38), and it takes a long time for grape seedlings to grow into fruit-bearing trees. Therefore, it is difficult to study grape genetics and breeding strategies. However, it has recently become possible to discover many SNPs through whole genome resequencing or genotyping-by-sequencing (GBS) analysis. In this study, we aimed to develop high-resolution melting (HRM) markers from the detected SNPs and construct a genetic linkage map using HRM markers. In a previous study, 2,553 SNPs were identified using GBS analysis. In this study, 1,336 SNPs were used to design primer sets for HRM analysis. The developed HRM markers were used for construction of a genetic linkage map in an F1 segregating population consisting of 192 individuals from a cross between ‘Tano Red’ (V. labrusca×V. vinifera) and ‘Ruby Seedless’ (V. vinifera). A total of 805 polymorphic HRM markers were developed, of which 363 were mapped onto the genetic linkage map of grape, with a total length of 1,453.5 cM consisting of 19 chromosomes. This SNP-based genetic linkage map and HRM markers can be used for QTL identification and marker development for important fruit traits of grape.
Keywords : genetic linkage map, GBS, grape, HRM, SNP marker, Vitis
서 언

포도(Vitis spp.)는 전세계적으로 생산되는 주요 과수 중의 하나로 생과는 물론 포도주와 건포도를 비롯한 가공품으로 소비되고 있다(Hur et al. 2015). 포도과(Vitaceae)는 염색체가 38개인 진정포도아속(Euvitis, 2n=38)과 염색체가 40개인 머스카딘포도아속(Muscadinia, 2n=40)으로 구분된다(Rahemi et al. 2022). 진정포도아속은 크게 세 그룹으로 분류되는데, 대목 육종에 중요한 아메리카 그룹, 약 50종으로 구성된 아시아 그룹, 그리고 전세계적으로 가장 많이 재배되고 있는 종인 Vitis vinifera L.을 포함하고 있는 유라시아 그룹으로 나눌 수 있다(Rahemi et al. 2022). 포도 재배종(V. vinifera L.)은 흑해 카스피해 인근에서 6,000년~1만년전부터 재배되기 시작하여 아시아와 지중해연안으로 전파되어 현재는 재배품종의 94%가 이에 속한다(Reisch et al. 2012).

최근 국내 포도 육종은 씨가 없고 껍질째 먹을 수 있는 유럽계 신품종과 탈립이 적은 신품종 개발에 초점을 맞추고 있다(Chung et al. 2020). 현재 씨 없는 포도의 선발은 genome-wide association study (GWAS)를 통해 개발된 SNP 분자표지를 이용하여 유묘 단계에서 조기에 선발할 수 있다(Zhang et al. 2017, Kim et al. 2020). 하지만 포도 과실 형질에 대한 몇몇 연구가 보고되었지만 과육경도, 탄닌함량, 인장강도 등의 형질에 대한 유용한 분자표지는 아직 개발되어 있지 않다(Guo et al. 2019, Im 2020, Jiang et al. 2020). 포도 육종에 있어서 분자육종기술은 많은 노동력과 비용이 요구되며 오랜 시간이 소요되는 전통적인 교배육종의 효율성을 개선시킬 수 있는 매우 유용한 기술로 생각된다(Hur et al. 2015).

최초의 포도 유전자지도는 ‘Cayuga White’בAurore’ 종간교잡 집단에서 422개의 random amplified polymorphic DNA (RAPD)와 16개의 restriction fragment length polymorphism (RFLP) 및 동위효소 (isozyme) 분자표지를 이용하여 작성되었다(Lodhi et al. 1995). 2003년에는 와인 제조용 품종인 ‘Moscato bianco (V. vinifera L.)’와 V. riparia Mchx.의 종간조합 후대에서 simple sequence repeat (SSR), amplified fragment length polymorphism (AFLP) 및 single-strand conformation polymorphism (SSCP)를 포함한 총 338개의 분자표지와 20개의 연관군으로 이루어진 모계 유전자지도와 총 429개의 유전자좌와 19개의 연관군으로 이루어진 부계 유전자지도를 작성하였다(Grando et al. 2003). 2004년에는 유럽계 와인 품종인 V. vinifera ‘Riesling’× ‘Cabernet Sauvignon’ 교배조합 후대에서 152개의 SSR 분자표지를 이용하여 20개의 연관군으로 구성된 유전자지도를 작성하였다(Riaz et al. 2004). 또한 V. vinifera ‘Syrah’בGrenache’ 교배집단과 ‘Riesling’ 품종의 자가수정 집단에서 총 245개의 SSR 분자표지를 이용하여 19개의 염색체를 나타내는 최초의 유전자지도를 보고하였다(Adam-Blondon et al. 2004). 2006년에는 5개의 집단에서 SSR 분자표지로 작성된 유전자지도를 통합하였다(Doligez et al. 2006).

2007년에는 유럽계 와인 제조용 포도인 ‘Pinot Noir’ 품종을 대상으로 전장유전체 염기서열이 보고되었고(The French-Italian Public Consortium for Grapevine Genome Characterization 2007), ‘Pinot Noir’ 품종에서 만든 bacterial artificial chromosome (BAC) 컨티그(contigs)에서 대량의 SNP 분자표지를 개발하여 19개 각각의 염색체와 연관군을 일치시킨 표준 유전자지도를 작성하였다(Troggio et al. 2007). 포도 전장유전체 염기서열이 공개된 이후에는 유전자칩(DNA chip, Lijavetzky et al. 2007), genotyping-by-sequencing (GBS, Hyma et al. 2015, Tello et al. 2019), specific length amplified fragment sequencing (SLAF-seq, Guo et al. 2015), restriction site-associated DNA sequencing (RAD-seq, Wang et al. 2012, Zhu et al. 2018), whole-genome resequencing (Jiang et al. 2020, Shi et al. 2022) 등의 최신 기술을 이용해 대량 SNP 탐색 및 유전자지도 작성을 훨씬 빠르게 수행할 수 있게 되었다. 하지만 각각의 SNP를 따로 분석할 수 있는 포도 분자표지의 개발은 아직 미흡한 실정이다.

SNP 유전자형 분석 기술은 다양하게 개발되어 있다(Kim & Misra 2007). 정확하고 빠르게 저비용으로 분석할 수 있는 SNP 유전자형 분석 방법 중 최근에 가장 많이 이용되고 있는 두 가지 방법은 high-resolution melting (HRM, Simko 2016)과 kompetitive allele specific PCR (KASP, Semagn et al. 2014)이다. HRM 분석은 전기영동 과정 없이 melting curve 분석만으로 SNP 유전자형을 구별할 수 있고, 형광 염료를 붙인 특이적 탐침(probe)을 제작할 필요없이 상대적으로 저렴한 SYBR Green, EvaGreen, LC Green, SYTO 9 등의 녹색 형광 시약만 넣으면 되기 때문에 분석 가격이 낮은 장점이 있다(Simko 2016). KASP를 이용한 SNP 유전자형 분석은 스코어링 자동화(automated scoring), 낮은 에러율(error rate), 저렴한 분석 비용, 확장 가능한 유연성(scalable flexibility) 등의 장점을 가지고 있다(Semagn et al. 2014).

선행연구에서는 ‘Tano Red’בRuby Seedless’ 교배집단 후대 269개체를 이용하여 GBS 분석을 수행해 총 8557개의 SNP를 탐색하였고, 그 중 2243개의 SNP는 총 연관거리가 2068 cM인 포도 유전자연관지도 위에 위치시켰다(Im 2020).

본 연구에서는 선행연구에서 탐색된 대량의 SNP로부터 포도 유전체 전체를 커버할 수 있는 HRM 분자표지를 개발하여 유전자연관지도를 작성하고자 하였다.

재료 및 방법

식물재료

식물재료는 국립원예특작과학원에서 2016년도부터 재배되어 온 ‘Tano Red’ (V. labrusca×V. vinifera)와 ‘Ruby Seedless’ (V. vinifera)를 교잡한 F1 분리집단 192개체를 이용하였다(Cho et al. 2017). 본 교배조합은 과방의 착립 밀도, 과립 모양, 과립중, 과립의 과피색, 과립경에서의 과립 분리 정도, 과육에서의 종자 분리 정도, 과즙량, 과육 경도, 종자 무게, 종자 형태, 과립당 종자 개수, 과립 종경, 과립 횡경, 당도, 산 함량 등의 과실 및 종자 형질을 분석하기 위해 육성되었다(Cho et al. 2017).

DNA 추출

총 192개체의 F1 식물체의 잎으로부터 각각 DNA를 추출하였다. DNA 추출은 Ryu et al. (2021)의 방법을 이용하였다. 추출된 DNA는 BioDrop Lite (BioDrop UK Ltd., Cambridge, England)를 사용하여 DNA 농도를 측정한 후, 30 ng⋅μL-1 농도로 희석하여 사용하였다.

SNP 탐색 및 분류

‘Tano Red’와 ‘Ruby Seedless’ 교배집단을 씨더스(SEEDERS, Daejeon, Korea)에서 GBS 분석을 수행하여 대량의 SNP를 탐색하였다(Im 2020). 탐색된 SNP는 양친의 유전형 데이터와 비교하여 모친(‘Tano Red’)은 동형접합형이고 부친(‘Ruby Seedless’)은 이형접합형인 경우는 ‘nn×np’, 모친은 이형접합형이고 부친은 동형접합형인 경우는 ‘lm×ll’, 그리고 양친 모두 이형접합형인 경우는 ‘hk×hk’ 유전형으로 분류하였다(Table 1).

Table 1

Summary of SNP detection and HRM primer design between grape cultivars ‘Tano Red’ and ‘Ruby Seedless’.

Segregation type Number of SNP markers Number of HRM primers designed (A) Number of polymorphic HRM primers (B) Success rate (%) (B/A*100)
‘Tano Red’ ‘Ruby Seedless’ Symbol
Homozygous Heterozygous nn×np 853 449 251 55.9
Heterozygous Homozygous lm×ll 951 509 353 69.4
Heterozygous Heterozygous hk×hk 749 378 201 53.2
Total 2,553 1,336 805 60.3


HRM 분석용 프라이머 디자인

탐색된 SNP를 중심으로 양쪽 염기서열(총 600 bp)을 이용하여 Primer3 웹사이트(https://bioinfo.ut.ee/primer3-0.4.0/)에서 HRM 분석용 프라이머를 디자인하였고, 디자인된 프라이머의 amplicon 염기서열을 이용하여 포도 표준유전체(http://ftree.seeders.co.kr/index.php/ftree/blast)에 basic local alignment search tool (BLAST)을 이용하여 포도 표준유전체에 한 번만 나타나는 SNP를 선발하였다(Table 2).

Table 2

List of HRM primer sets used in this study.

Marker name Chr. Position (cM) Forward primer Reverse primer SNP
C01_1119888-HRM 1 0.0 CCGCTTCACGTAGACTGAACTC AGAATTGGAGTAAGTTGAGGTTGG T/C
C01_1646914-HRM 1 11.7 GCCTATAAGCCTCATCAAGACTTC AGGAAGGTTTCTCTCCCAATATCT C/T
C01_3587166-HRM 1 17.3 GATATCTTCTCCATTCATTGCTGA GGACGAAGATACCAAGAAGGTAGC A/C
C01_3978740-HRM 1 22.0 AAACAGAAACACCATATGGGAACT TATTTATTCATCATGCTTGCTGCT A/C
C01_4119172-HRM 1 24.6 CAGCTTCGCACCTATGCTAACTAC AGAGAAATGGAGTGAGAAACCCTA C/A
C01_5578917-HRM 1 30.3 TAATGCCACTTAATTTGCAGGAAT CTGAATCTTTCCAATGCTTCTGTT C/T
C01_7367827-HRM 1 32.6 AAAAATGCATAAAATTGCAACTGA CACCTATGCAAAACATTCACAGAG A/C
C01_9408352-HRM 1 38.9 TGAACATGAGCTTTGCTAGGTTAC GTGCTGTTGTAAGAAAGGAATGTG C/T
C01_10642137-HRM 1 47.4 TACCAGAAGAGCAAAAGTCTTGG CAAATGATTCCTTGTCAGTTTTTG G/A
C01_11662715-HRM 1 52.6 AGTGAAGAAGGGTCGGTGATT GTAGCTTTTGCATAGGGTTCCAT C/T
C01_16586407-HRM 1 57.3 GGTTATTAAGAGGTGAAAGCCAAA TGGAAATATTTAGTGCAGCAATTT G/A
C01_12876858-HRM 1 59.6 ATGCCATATAGTGGAAGATTGGAT GTGCACCATATGAAGAACCACTAA A/G
C01_14656510-HRM 1 60.5 TTTATCAAACAGCCCAATGTCTTA GTGCAGCTGAATCCTTACTTCTTT C/T
C01_15212737-HRM 1 61.6 GCTCCCTCCCTCATTTACCTAT TCACCAATCAAAAAGCTGAATAAA G/A
C01_19514907-HRM 1 67.1 TGCTCAATGACGTATTTGAAAACT GCAGCAACCAAACAACATTAGATA G/A
C01_20364365-HRM 1 70.8 TCCTCTTTCTCATTCATTACAGCA CTAGCAAGTTTGCTGAGGTTTGT T/C
C01_20969991-HRM 1 73.8 ATTTCTAATGTGTAGCGCAAATGA ATGGAGCCTTATATAATTGCCACT T/C
C01_22138644-HRM 1 77.6 AACCACGTAGTTACAGACATGAGC AATAGGAACTAGCGGGAAATAACC G/T
C01_21845711-HRM 1 81.7 GATCTTAGATGCTGGATGCTTCTT TATACCTTTTCCAGTCCATTTTCC G/A
C01_23945977-HRM 1 88.4 TGAGCCTCCTTTAGTATCTGAAAA ATCATGCAGCCAAAATAGTTCAAT G/A
C02_525619-HRM 2 0.0 GATTGCTGCTCATCAATATCATC ATGCTTCATTTTACTCATCCATTG T/C
C02_235122-HRM 2 6.5 AAGAGGAGCTTTTGATGAAGTGAT TCACTGCTAGAGTGTATTCATTGG A/C
C02_1081253-HRM 2 11.3 ACCATATTCTGAGCAGAGTGAACA TCCTGCAGAAAATTAAAAGTCAAA C/T
C02_2209864-HRM 2 18.6 GAGTTCATGATGGCTGATTTCTTT GGGACAACATTTAACCATAGAACC A/G
C02_2365173-HRM 2 24.3 AGTTAGAACCTAACCTGAGCAGCA TAATACTACAGCGGAAGGAAGGAG A/G
C02_3529089-HRM 2 29.9 ACACTGCAAAACTCTTGAACTCAG ATGCGTCTACAAAGTTGATGGAAC G/T
C00_13513200-HRM 2 38.0 GTAGTAGTGGGCTTCCCGAGTTAT CAGACCTGTAAAAGCAGCACAATA A/G
C02_7880106-HRM 2 55.4 AACTGAAGCTGCGTATGATGTTC CCTCTAAGATCAGATACGGTGGAG T/G
C02_8030412-HRM 2 56.4 GGATTTCGATGCTCCAGGT TCGTAATCGTAAATCACAATCTGC G/A
C02_9303617-HRM 2 58.1 GCTCTTCTTCCAGAGTTATTTGTG GGCTCTTGATTCTTCTTCAAGTTC C/T
C02_8854992-HRM 2 59.3 TGAAGACATTCAATTTTGTTGGTT TATGGTGTTTGTTTTAACGGAAGA C/T
C02_8400378-HRM 2 60.3 AGCCTCATTGAAGACAATCTCATT TCTTCTAATATGCTCTCTCCCCTAA A/G
C02_10148394-HRM 2 61.3 AGAGGAATCAAATGGAGAGAATTG GAAGTAAAGCAGCAACCACTGAT C/T
C02_12868924-HRM 2 61.6 CAACAAAATCATTAGGTTTTTCAGTC GCTAACAAAGAAATCACAAAAGCA G/A
C02_18463767-HRM 2 63.3 ACGACGATTACATAGCTGAAACAC TCATTCCCCTGTCATATAAAATGT T/C
C02_10148217-HRM 2 63.8 ACAATTTTAATGGTTTTGGGTGTT TCTGTGAATAATGAAAATGTAAATGAA T/C
C02_8583872-HRM 2 65.0 AATTAAAAGGAAATGCAGCGAGT CGGACCTTTTCGATCTCTTAAT A/G
C02_17454742-HRM 2 67.3 CTTTGCTTCAGACTTTCTCACCTT CAGAGAGTAAGCATAGTGCCAGAA C/T
C02_17915790-HRM 2 69.6 CAACTCCATTTTGTCCAGCTC GAAGGAGAGAATCACAGAGCAAGT A/G
C03_46442-HRM 3 0.0 AAGAACAGGAACTTCCGAATATGA GCTGCCCCTATGCATTATTTAAG G/T
C03_3874067-HRM 3 0.0 AGAAAAAGCTGCTATTCATCCAAC TACATGATCTTGCTCCTCTAACCA C/T
C03_3253712-HRM 3 2.2 AACAGAACTCAAAGCAGGAGAACT TCAAGAAGGCATACATTAGTTTCAA C/T
C03_1613721-HRM 3 4.3 AGTATATGGACTTGGCTGAACAGG TAGCAATATTGGAACTGTCCATCA C/T
C03_2615665-HRM 3 8.4 AGTATCCTGAGATATGGGCTCTTG ATGTGCAAGTCTACAAGCAACATC A/G
C03_1541222-HRM 3 9.0 TTGCAGCAAAGGTATGAGATTACA TCCATAACCCATAATCCAACTTCT C/T
C03_5362712-HRM 3 43.4 CAAAGACGATGAACTAACTGGTCA TGTTGCTAGAAAACCCTTTAAACC T/C
C03_5799668-HRM 3 48.0 CTAATAGGAATTTTGCGAGGGAAG TGTCTGGGTTCCTTCCATCTAGT T/C
C03_18748644-HRM 3 69.3 GAAATATCAGCTGCCCTTTGTAAC TATTCAACTTGGAAAACCACTCCT T/G
C03_20276928-HRM 3 72.8 GAATACATTCTTTTCAGGGTGAAG AATTGGGGTGTGTATACCAATTCT C/A
C04_1252669-HRM 4 0.0 TCAAGTCCATATTGGATTTTCAGA ATTTCTTCACACAGCGAAAGAAG T/G
C04_1847860-HRM 4 10.3 TTAAATATGCCTGCTAACTGCTTG AGTGATGAAGAATGAAGTACACTCAC C/T
C04_2153062-HRM 4 13.4 ACATCATTCTCCAAGATACAGTGG GAGAATGGGATGAGAATGAGACC C/T
C04_5242968-HRM 4 21.4 ATCTGGATAAGCTAAGCAGCAATG GGCAACAGAATATATCCAGGAAAA T/G
C04_4199986-HRM 4 25.2 TTGATCAGTTTTAGTTGAGCTTCG CTGGTTGCTGCCTAAATCTCTC G/A
C04_4848299-HRM 4 27.0 CAGTACTTTTCTTCCACGTTTCCT GTTCTGAAGGAGATTCGGAGTG T/C
C04_7024950-HRM 4 32.4 TATGATGATGAAGTGAGGGAATTG CAGCCTCGTAAACTACTTTCTCCT G/A
C04_13595773-HRM 4 37.8 TAACTGATATTGCGAAAAACAGCA ACAGGCACTTGATCAGTTGAAATA T/C
C04_18374072-HRM 4 51.7 CTGCATTGAATGGAATTAAAATGG ATACATTCTCTTGCTCGGGTTTAG C/T
C04_19879714-HRM 4 55.1 AACCCACTTGCTCCAATCAC AGTGCATTAGCTCCTACTCTAGGC C/T
C00_24329427-HRM 4 65.9 AACTCAGTGCATTTCCTAGTGGAG AAGAGAGCTTAGAAAGGGCTTACC T/G
C04_21116712-HRM 4 69.0 ACAATTGCCATATGCTTTTCTCTT TGGTTAAGATGTGCTTCATTGACT A/G
C04_21518434-HRM 4 72.8 ATTGCAGCATTTTTATCAATTTCC ATTTCACCATGAATGTCAAAAGAA A/G
C04_21660082-HRM 4 74.7 ACCTCCTAACGATAGCAGCTTAGA CGATATAGGAAATGTAAGGCCAGT A/C
C04_22878658-HRM 4 77.5 GCTTGCTATCAATGCATTTTATTC AGAAGACGACGACTTTCATGACTA T/C
C04_23070555-HRM 4 78.6 CCAGGAAGTACAAATCGATGG CGTTCGATCACGAGGTACTTG G/A
C04_23556466-HRM 4 79.6 CAGCAGAGCATCCTGGTTCTA CCAACACTAGCACACAAGACAGTT T/C
C05_3279979-HRM 5 0.0 TTTTTAATTTCTCAATTCCGTTCC GAAGGTGTATGACACTGCTGCTC C/T
C05_4133797-HRM 5 8.7 GATGATGCTTATGATTGAGGACAC TATACTTTCCAGTGGGAAACATGG A/G
C05_4785547-HRM 5 17.2 GTGTAGTGCACGTCAAATAGCTG TGGAGCATTAATTAACCACCAGAT G/T
C05_10236780-HRM 5 34.3 TCCACTCTCTGTTGTGCAATACTT AGAGATGATGGGAGAATCTCTCTG C/A
C05_14937902-HRM 5 38.2 TCATCCAAACCCAACTATGTGTAG TTATGCAGCTGAATCACATTTAGA G/T
C05_11358427-HRM 5 40.1 CATGTTCTTATTCCATCCAAATCC GCTTGTTTTAAATGCAAGAGTCAA G/T
C05_9739227-HRM 5 41.9 AGACTGGTACGTGGTTCACTGTAA AAGGAACATTCCAATCATTCTGAG C/A
C05_10496220-HRM 5 42.7 GCTTAAACCTAGTGGGTGTTTCTC AATTAAGGCATTCATTCTCCAAAC A/G
C05_8684582-HRM 5 46.7 TGCAATAGACAAAGAAAACCTGAG CTTCGATAGGTACCCACCTCAAC A/G
C05_25379843-HRM 5 62.3 TTTAACTCTTGATTGGGACTAATGG TTCTTTTACTATGGAGCAGCCAAG C/T
C05_23840941-HRM 5 66.5 TTTATTTAATTTGCTACCCATCTGC TGACCAGATCTTCGTTTATCTTCA A/G
C05_23731971-HRM 5 69.9 ACAGGCGAGTATCCAATATGTTTT TGTCTGCTCAGTATGTTGTTCAAA A/G
C06_227318-HRM 6 0.0 ATTTAACCCATCCAACAAGTGATT GTATTAAGCCTTTAGCAGCCCTTT T/C
C06_505597-HRM 6 7.6 TCTTATATGATCCAAAGCCCTCAT GCTTGCTCTGATGTATTTTCTTGA A/G
C06_1893877-HRM 6 11.9 GGTGGATACATGTTTACATTGACA CATGTCTAGGAGACTAGCAAGCAA G/A
C06_2491848-HRM 6 21.0 GCAGTACCTGGTTTACTTCACCAT CAGGCTGCAGTTTATACCAAAAGT G/A
C06_3905961-HRM 6 26.6 TCTTCATCAATTACGTGCAACTCT CAATAGTAGTGGTGGAGCAGCTTA T/C
C06_4110746-HRM 6 28.4 CATCAATACAAATGAGAGCCAAAG GGTCAGATGAAAAGCAGGTAAAGT A/G
C06_4924458-HRM 6 31.7 CTTGGTTCAGCAGTCAAAAATTG ATTGCAATATTGGTGGTTTTCTTT C/T
C06_4133532-HRM 6 35.5 TACTGTATTTCTCCAGCCAAATGA AAACATCCAAAAGCAGTACTTTCC C/T
C06_5759296-HRM 6 40.7 AAGGTTAAAATACCCTTTGCCATA TAATTACGGTTTCACTTGGAGCAG G/A
C06_6012765-HRM 6 42.4 CATATATCCAATCAGCTGCCTTC CTATTCTTTTGCCTTTGCGGTTT C/T
C06_4924507-HRM 6 43.0 TCAATGAAAGAAATGGAACAAAGA GTCAGATGGTGGTGTTAGGTTGAT G/A
C06_5368959-HRM 6 46.3 ACTATTGTGCAAGCTAATGCAGTC CAACTCTCCAATTTCCTCATCTCT G/A
C06_6548604-HRM 6 49.3 TCAGGTACAACTGTCTCTTTCAGG AAGAGAACTTCAAGTGCATTGTCA A/C
C06_6885703-HRM 6 52.2 CAGAGTTGGATTGATTGTTCTTGT ATGTATGTCTTGCCTGGGTCTACT T/C
C06_8662992-HRM 6 54.3 ACGGATATTTTCATTGATGTGAGT GAGGAAGCTCTAGCTCTGAAACTG G/A
C06_8173832-HRM 6 56.8 CATTCTGGGCACTGTCATAGG CTACCGATGTTTTACTCACTGCTG G/T
C06_7866275-HRM 6 58.9 GCAAGAGTCTCACACACAGGTTTA ATGCTGAATCCATCACCCACTAC T/G
C06_7421678-HRM 6 59.0 GGTTTTCTTCATCTGCTTCTTCTG TCCCTGAATACCCCAGTCTAATTT C/A
C06_7723741-HRM 6 61.8 AATGGCGAATATGAACGTGAAC CTGCAACCCAGGTCTGATAAAC A/G
C06_14610116-HRM 6 64.0 GCATCCACTAGTCCACTTGTTTTA CTAAAATTGATAATTGGGCTGCAA T/C
C06_15260855-HRM 6 66.6 ATTAAGATCATGCAGTACGGTCAG AGCAGACTGTTCTTATTTGTGCAG C/A
C06_15788279-HRM 6 69.3 ATATCCGAACCAATCTCACTTGAC ACTGTGGGCAGCAAATCAAT G/A
C06_22090868-HRM 6 73.5 CCAAGTGTGAGAAAATTTGATGAT CTGTCATCCCTCAGTTTCTTGG A/C
C06_22554938-HRM 6 74.8 AATGCAGCAATATCATGGAACTAA CTCATCGTACTGGCCCTCAAT A/G
C07_923147-HRM 7 0.0 GTCTAATTGAAATTTTGGCTGCTC AAAGTCCCATTATGCTTATTTTGG C/A
C07_2237664-HRM 7 17.7 AGCTTGCTTAGTGATATTCACCTG TTCTTGTTATTTAATCCCCAAAGG G/T
C07_3333930-HRM 7 27.6 GTCACCCTGACATCGAACAGT CAAAGTTGAGGATCAGTTCACACT A/G
C07_5103728-HRM 7 37.5 AAAATAGATGAGAGCAAATCAGCA AATTCAACTTGCTGCACTTATCAA G/A
C07_6147311-HRM 7 40.0 TGTACAATTTCATGTTTTCGTTGTT CTGCCTCATGTGTGCATATAACTT T/C
C07_6997046-HRM 7 44.3 GAAGACCGAAGAGGTGACAATC GACTTCCAGCTGCCTCATTC A/G
C07_8012859-HRM 7 46.7 AGTTACTGCAGTTGCATGATTTGT ATGAAAGGTCTCTTTAGCTGCAAT G/A
C00_12159245-HRM 7 52.6 CACATTTGAACTCCTGATCTGTCT AGGATGGAGAACGGTCAAACT C/T
C00_11097524-HRM 7 54.4 AGTTTAAGCTTTTTGACGTGGAC ACCCTTAACTACACGAAACATCC C/T
C07_18243537-HRM 7 61.3 GATGTTTTCAGATTTGGAGTCTGG AAATTAAGCAATACTGGACGCTTT T/C
C07_20477520-HRM 7 69.1 CGACAATGAAGCTCTACTCAAAGA CATACGCATAGTTGGCAGAATATC A/G
C07_19669710-HRM 7 74.8 CACAATGTTGACGATCTAGTAGGC GTTACAATGTGGATCAGAACTGGA G/A
C07_19669455-HRM 7 80.2 GAGCCTTGATGCCTTTCATTT TTTTACAGGTCAAAACCAAGTTGA T/G
C07_22626199-HRM 7 87.2 TCTTCCTTTTCTTGAATTTGATCC CAACAGTTGATACACTGTGTGACG C/A
C07_24878394-HRM 7 94.6 ATTCCGCCAGACTCCATCAAT ATACGAGTGTGGTAATCACCTTGA T/C
C08_22356041-HRM 8 0.0 AAGGGAATCATCCAACTCATAGTC CTCAAAAAGCAATGAAAAATGTTG T/C
C08_1785228-HRM 8 1.0 TGGACTGTTTGTCTGATTTTCTGT CAACATCTGCTATCCCAGAGAAG C/T
C08_21038763-HRM 8 2.8 ATGTGGTGTGAGGTACAAGTCG TTTCTTATGAGAATTGGAGTGCTT C/T
C08_2033548-HRM 8 3.9 CTAATTTTTGCAACAAGGTTCTGA AATTCTGCCTGGTGTATATTCAAA T/C
C08_2436471-HRM 8 4.4 CCTCAACAATGATCTCCACTACAT GTTGCTCGAGTACATTCTTTTGAA C/T
C08_2063956-HRM 8 4.6 CCCTTATGCTTGTAGGAGATTCAG CAGTTGATACCACTGGATTTGAAG G/A
C08_345489-HRM 8 4.8 ATCAACAGAAGGTTGAATGACAAA ATAAAAGCACTAACTTGGGCAGAG T/C
C08_18892610-HRM 8 7.4 TTGTTTCCAATTCTTTGCTAAGTG GACCCATGTGTTGATCCATAATC A/G
C08_21108916-HRM 8 8.5 CGATGTTGCTTCTACTGCTATCTC TGTCTGCTAACAAAGATTTCTCCTT A/G
C08_4212583-HRM 8 9.2 AAAGGGTGATAGTTGGTCAGTCTC TGAAAGAAGTTGAACTATCAGTGGA A/G
C03_7003303-HRM 8 12.7 ACACTGTGATGTTTCTGGTGTTCT CTTCACTGGGTTCATCTTCTTTG G/A
C08_17766042-HRM 8 14.5 AACACGTGCACCAGGTAGTTC GGGTCTCCTTGAACTTCTTCCTC G/T
C08_4211870-HRM 8 14.9 TATGATGAGTTTGAGGAAGGTCAC GAGCAACAGATGAATGATCAAAAC C/A
C08_7860584-HRM 8 20.1 GGTTTGAAGTGTTACCATGTGTGT ACTCACTGATTTTTGGGTGACTG A/G
C08_16368863-HRM 8 23.4 ATGAATTGCTGAAACATTTTGATG GCCAAACAATAAACACCATGTAAT G/A
C08_8811114-HRM 8 24.8 GTTTCGAAGATATAAAGGGCTGTT CAAGCAATTGAAAATTTGGTTAGA A/G
C08_15737406-HRM 8 26.1 CTTTAAGGAACAAGGCTGCTTCT GCATTGGAAGGAGAAAGAGATAGA C/T
C08_15789555-HRM 8 27.0 TTTATGTGTTCTCAATTGCTGCAT ACATTCTAACCAGTTTGCCTTGAT G/T
C08_15249147-HRM 8 29.9 GTTAAGAAAGCAGCAACAATAGCA GGTACATGTTCATTAGCCTGTCAA C/T
C08_10772651-HRM 8 33.1 GGCACAACTAGGCATGTTTAATG ATCATGCTTGACTTATGGGCTTT T/C
C08_13739202-HRM 8 35.5 TTAGTTATTTCAACAGAGCCACCA GAAGTTGAGGTAACTGGTCCTGAT C/T
C08_13474335-HRM 8 36.7 CAAACCAGCTTAAACAAGAGCTTA TATTCTTCCTGGTACCTGATCTCC A/G
C08_14199614-HRM 8 38.0 CCAAGGTCAGAGAGGGTTAAAGTA AATCCGACGAAATAATACTCCAGA T/G
C08_12171467-HRM 8 43.2 CATGCTTTTCCACTTGAGACTGTA TTTCCATGCAGATTTTACAGAAAG C/T
C08_12304889-HRM 8 47.2 CATTTTCCCTTTCTCTTTTCCTAA AAAATGAAAGGAAGCAAGTTCAAT G/T
C08_11845006-HRM 8 50.4 GAATCTAGACACGGGGCTTAGTAG GTGGAAGCTTAGTGGGTTCTTTTA G/T
C08_13014955-HRM 8 51.6 CAAACTTTAAATCAAAACCCCTCA CTCTGTTCTGTTTGTCCTGTGACT C/T
C08_13105315-HRM 8 57.4 CGTAGATAGCATATACGCAGCACT CCACCTAGTAATGTAAACCCTTGG A/G
C09_56750-HRM 9 0.0 GGCCTCTCTGTTATCCTTCTCC AGTCAAAGGAAGACCAGTTGAGAG T/C
C09_241958-HRM 9 1.3 TAGAACAAGCCAGAGAAAAAGACA ATTGTTAGGAATGCGGAAAAATAG T/C
C09_911912-HRM 9 8.9 TTATTCCCTGTAGCCTTACCTGTG CTAGTGAGACTGAAGATGGGGATG A/G
C09_2355052-HRM 9 19.7 TCTGGTTTTCTAGGGATTTTGATT ATGTACATTGCAGGAAATTGATTG A/G
C09_3064878-HRM 9 28.4 TTTATGCATATCATTGAAGAAGCTG ACAATGGTGAACATAGCAACAAAC G/A
C09_3373885-HRM 9 29.5 AAAATCTAAGCAGCCATTTAGGTG GGTGGAACAATTTGGTTTGTTTAT T/C
C09_4791572-HRM 9 37.4 TTTGTTTAGGGATTTTATGCTGGT GAGTGTGCTCTATAGCCTCATCAA G/A
C09_10500656-HRM 9 52.6 ATGCAATGCACCATGTATATTACC GAGAAGGACAGGATAAGGCTCTTT T/C
C09_7464019-HRM 9 54.6 CCAGATGTATGTCTCTGGTGTCTC AATTCCACTCTTGGCATTTGTT A/C
C09_9647960-HRM 9 55.6 AATGATGAGCAGATCAATTCACTT TATAATTGCTGCTGTAATGCTCCT C/T
C09_10684763-HRM 9 56.9 GGGCAAAGGTTCTGTAATTCTTAG CAAGTTACAGGCCATTGATAACAG G/T
C09_19184208-HRM 9 59.9 TGATGTCAATGTTTTTCCACTGAT AGCAGCTAATACATTTCCCCTACA C/T
C09_16428592-HRM 9 61.9 CTCTTGCTTATGCTCTTGATGATG AAAAGCTGCCAGAAACTCAAAAT C/A
C10_322067-HRM 10 0.0 GCTCTGGCTTGTGAGGATATAACT CAACTCTAAAGGTTTATGGGCAAA T/C
C00_16798137-HRM 10 7.9 GTTGTATAAATGGTGAGGTTGTGC ATCCATTAACTTGATCTGCAACTG T/C
C00_16826464-HRM 10 16.2 TTGGAATTGTTTCAAATGTTTGTT TCACAAAGACAAAGCCATCAGTAT T/C
C10_4139927-HRM 10 23.8 GTAGCCGAGACAGGAAGTAATCAT TGCAGCCTACTTATGTTTTCATGT C/T
C00_12707874-HRM 10 26.7 GGCTAAGAATTCTAGGTCGTTGAT GTCCACATGCTCCATCATCTC G/A
C10_4648424-HRM 10 28.9 AGCTGCTTATACCAAGCTCAGG CAGAACAGGTGATCCTTTAGTTCA G/A
C10_6596875-HRM 10 41.9 GATGGAATCCAATGAAGAACAAG CCTTCAGTAGAACCGTTATGGAGT A/G
C10_10733529-HRM 10 57.5 GGCAGAGAGAACATAGTGAAGCTA TTAGCTGCTTTATGGAGTGAACAA A/C
C10_18789123-HRM 10 66.3 TATTCTTTTCACCAACAAGCTCAA CTAGACCAACTTCTTATGGGCTTC C/T
C10_19212316-HRM 10 69.9 AGCAACAGCACGCATGAC AAAGAGGAAACGAAGGTGAAAAA T/G
C10_23354864-HRM 10 77.7 AGGTAAAGAGGGACTTGTCCATTA TTGATGCTGAATGGAGACATTAAC A/G
C11_2739914-HRM 11 0.0 ATAATTTGTGGAACAGGACGAAAT GGAGGTGTGTATCATAACTGAGCA A/G
C11_1981023-HRM 11 5.6 AGAACAAACACTTAGATGCCCAAC AGGTGGGGAAAATTGCTATTTAGT C/T
C11_410719-HRM 11 17.9 AGAGGATCAAGCCTATCATAGCAG CATGCACTAAAGGAAGGTCTTTG C/T
C11_558574-HRM 11 22.4 TATAGAGAGATTTTCATGCGATGG CTCTCTCTCTCTCTTGCCTCAAGT T/C
C11_2829787-HRM 11 31.1 CACAATCTTCACAGCTACGATCTC ATGTTTGCTCATGTGGAAGATTT G/T
C11_6200534-HRM 11 42.9 GAGAAATCTTCATCACCTGCATC CCAAAAACACAGATGGTAGTGAAA A/G
C11_12546671-HRM 11 56.1 CCGACATTTTTCAACTTTAGGC CTAGATCAAACCCAATTCCCATAG A/G
C11_16840565-HRM 11 67.2 TTCCTTGTGAATTTCTCAGTAGGC GACATTGCACCCAAAGTAGGTC A/G
C11_18137435-HRM 11 80.2 AATTCAAGGAGCTGCATTCG AAGACTTGATCTTCGGATTTGG C/T
C11_19537380-HRM 11 96.1 CGTGAAGATAAAAGCAGATAACAA ACCAAAACCTTCATCAGTACCATT G/A
C12_1166573-HRM 12 0.0 CTGCAATGAAGGTTAAAACAGAAT TAGTCAGCAGGAGATTCATAGTGG T/C
C12_389448-HRM 12 6.8 AAGCATTGTCTGAGGTAACCTGTA CATTTCATTGAACTTCTCTTGCAC G/A
C12_846589-HRM 12 7.1 GGGTATTTCTGCTTTTAACAAGACC ATCTTAAATGTCAAACTGCTGCTG A/C
C12_1870128-HRM 12 12.8 TGGTGCTTTATGGTGAATACTGAT AGAAGCCAGCATAAAAGAGAAAGA A/G
C12_1632907-HRM 12 13.5 CAGAATGAGAATGATGACGATGA CATTAGCAATTCGAGGACCTTCTA T/C
C12_1764837-HRM 12 14.4 TAGAGGGAAAATTAACCAATGAGG GCCCAGTTCCTAAGCAAGTAGTA T/C
C12_3241415-HRM 12 22.3 CAACAAGGAGTGGTTTGTTAGAAG TGTCTCAAGTGCTCTTATCACCTC C/A
C12_4298131-HRM 12 24.6 AGTACATGGCTTGCCTGTCTAAG AGGACAAGAGTCTAGGCATTTCAA A/G
C12_4760456-HRM 12 25.7 AAGGGAGGACTCCACTTCACTAT TTATCCCTTTCAACAGCTCCTAGA C/A
C12_5385901-HRM 12 29.5 ATTTTAGGCTTCCTTCAGTTAGCA TATCTGATGTCTCTTGAAGGCTCA G/T
C12_6090453-HRM 12 32.9 AAGGGATGTAAAACGTCTCTTCAC GCTTCTGCAGCTCATTTCATATT G/A
C12_6212365-HRM 12 33.5 ACACAACTGTAGCTCATGCTGTTA CAAATGCTAGAATGAAGTTGGCTA A/C
C12_6420013-HRM 12 35.3 TCAAATTTCTTGGTTTATTGCATC TGCACACTGAGAATATAACCATCC G/T
C12_7104946-HRM 12 39.0 GGGAACCTGAGGAATAAGAGGATA TATTTTGGTTTGGTTTTCAGATTG C/T
C12_7351517-HRM 12 41.3 AGAACAATGGATCCAAGATTGTTT ATAAACCGGTCTTCCTCAAGAAAT A/G
C12_8261908-HRM 12 44.4 CTGCAACCTACTTTGGTAACTGCT TCAGTTCCTTGGTTTTTGTAGTTG G/A
C12_8068807-HRM 12 45.7 ATTGCTATCCTCCGGTTGG CGGTTTCCTTTGTCGTCGT C/A
C12_9268981-HRM 12 49.3 AGGGTGTAATTTGTCTCCAGCTAC GCGGCAGTGAAGAAGGAAG T/C
C12_9851926-HRM 12 53.7 AATTGCCTCTTCAAGAAATCAAAC AGTAGAGATGATGCCAACTGTGC T/G
C12_17188487-HRM 12 62.6 CTGACTTCAACACCAGGAAGATTA TTCCCTGGATTTCAAATATAGCAG A/C
C12_21717886-HRM 12 72.1 CTATGCTAGGGTTTCATCAGCAG GAGAGCGTCACCAATCTGATCT A/G
C12_23854341-HRM 12 87.1 CCTGACAATTCAGGAAACTTCATT CTTCTCTGATCCTCTCAACATCCT T/C
C13_360775-HRM 13 0.0 ATCTCCAACTTGCTTGGAAGG TTTTTGTGGAGATTACCCTTCATT C/T
C13_997503-HRM 13 4.2 GTAGGAGATGGTGGGAAGCTCT CCAAAACAAAATAGCCTAAAATGC A/C
C13_1888115-HRM 13 8.8 AATAGTGAGTTGGATGATGGCTTA TCCCAAGGCAGAACTAAAGTTAAA C/T
C13_1806932-HRM 13 9.8 GCTAGCTCCGTCCAATCCTT AGAGCAGTGAGTAGAGACGACCTT T/C
C13_21336532-HRM 13 11.2 CTTCCTGAAACCTTGAAAAAGAAG TCTGCAGCTTCAAAACCTACTAAA C/A
C13_2640974-HRM 13 12.1 CAAGCGATCTCCGTTTCTATATCT TTTTCTTTGTCTCTCTCGATCTCA G/T
C13_18522245-HRM 13 13.8 ATCCTATCGATCATGCTGACAAC AAAGCTTTAAGTGCCTCGGTTAG G/T
C13_2518720-HRM 13 16.8 ATTATAGAGGTGGTGAAGGTGGTG ACCATTTATCTACTTCCTGCCTCA G/A
C13_14811237-HRM 13 17.9 TGATGAGTTATCTACCAAGGAGCA CACAGTAAGAGTGAAGACCTTGGA T/G
C13_4082839-HRM 13 20.4 CCAAGTGTTTGACCGTTGACT GGGTACAGTACTACCATTGGCTTC T/C
C13_11410565-HRM 13 23.3 ACCCAAAAGATTGTTGCCTAGA ATTGAACAGAGGAAAGAAGAAGGA G/T
C13_5220211-HRM 13 23.7 CTGGAAACCACCTTCATAGAATTT GCTCTTGCTGGTAGATATGGAGTC G/A
C13_4884360-HRM 13 27.7 CAGTCTTTTAAGGTCGGTGACTG CTTCTGAGGTCTTTCACCACTACA T/C
C13_5865787-HRM 13 28.9 AAATTTACCATCTTACCCTTCACG AGCTGCCACGTCACTGTACAAC T/C
C13_24745554-HRM 13 29.3 CTCTTCTCACATGGAGTCTTCTCG GTTATGAAAAAGGGTTGGAGGAG T/C
C13_25253100-HRM 13 29.8 CCATCAATGCAGCAAAATAGTAAA ATGAACCTCAAGTAACCAAGACAA T/G
C13_4663382-HRM 13 32.1 TGCTGCTTTTACATGTACAGTTATG GATCTTGAATATCAGGTTGGTAACTT C/A
C13_6628718-HRM 13 32.9 CAGGCAATTCATCAACTTCAGTAT AGGGGTAAGAAACAAGATTCCTTT G/A
C13_8908781-HRM 13 34.4 GGGTGGATGTTGTTGTAACTTGTA AGAGAATGAACGAGGTGAATGAAG G/A
C13_7585688-HRM 13 35.2 ATGATGAGCTGCGGTGATATAGA TTCTACAAGACGTGGGTAGAATCC T/C
C13_3578346-HRM 13 35.9 TGCGATTTTTGTATTGAGAGTTGT GCCACCAGCAAGTTACGG T/C
C13_7807755-HRM 13 36.7 CTGTTACATGGAGTCAGAAGTTGG TAGAAACAACAAATCGGGTAAGGT T/G
C13_10484502-HRM 13 38.1 CTATCCAAAATGAACTGCTGCTAA TCAAAGGAACTAGGTTGTATGTGC G/T
C13_27377437-HRM 13 38.5 TGAATGGTATGCTGATGATAGACC CTTGAAGCACACACTTACTCCAAT T/C
C13_13237572-HRM 13 39.3 CAGTCATCTAGGTTTGGTTGAAAA GCAGGAATAATGAAGGACATTAGG A/G
C13_11097908-HRM 13 40.0 ATACACTTCATCCGTAGCTTCCTC TCTGCATGTTATTTTGTTTCCACT G/T
C18_22835365-HRM 13 41.1 GAAACAGATCATGAGTGAAAATGG GCAAAGATAGCCCAAAAATAGAAA A/G
C13_15061900-HRM 13 44.1 GTTTTGTAGGCTGCTCCTCCT AGCCACAGGCTACAACTAAAGAAC A/G
C13_19697506-HRM 13 46.0 CACTAAGAAGGTTGCATGCTAAAG TGTTTCTCCTGCAACAAATAAATG T/C
C13_25224999-HRM 13 47.7 GGTATGGGCTAGAAGATGTTGAGT CTGAAAGTACAGCCAATGATTTGT A/G
C13_23194288-HRM 13 51.2 ACTTGTGTCTTTGGAGGAGCAGT CCAAGTTAGCACAGCCTTTTATTT T/C
C13_24731492-HRM 13 51.8 TCAGAATTAGAGATTGCAGCAGAC ATCTTCCAATGCCTATGCTTTCT A/G
C13_25278544-HRM 13 53.1 TTTTCTTGTCACATTCTTCTGTGG CTGCTGAGGTTGTTAGGCTCACT T/G
C13_25652803-HRM 13 54.6 CCCCTAATGCTTCACAAAATGT AAGTGGCATCAATGGAGGTTT C/A
C13_26754940-HRM 13 55.9 GGAACTGTTCGAAGGACCTG TCATAGACAAAAAGCACTTCAACG A/G
C13_27035920-HRM 13 56.7 GCTCACACTTAGTCGTAACCATTG ATATGCACTCATCATCGGACTGTA C/T
C13_29030277-HRM 13 64.4 GGGTCCTTGAATTGATCTCATAAT TCTCCCTTTAATCTAATGCAGCTT G/A
C14_824294-HRM 14 0.0 TGCTTCTTCCGTGAATAATCCT CTCCAGCCTGGTACATGAAAT C/T
C14_1093807-HRM 14 4.4 TTTCTATTTTTGTCGCATGATGTT TAAAATGAAAACCACCAACTTTGC C/T
C14_3300294-HRM 14 12.1 TCTCTGAGTACTGAGCAAAAGCAG ATGTGGAAGATGCAAGTAAACGTA A/G
C14_5806875-HRM 14 17.4 TTGCACCTCTGTTGGAAAGTATAG TTCCATTTATGCAGTCTATGTTCC G/A
C14_7176510-HRM 14 21.6 ATTTCTTCGGTGAATAAGATCAGC CAATTTGGAGGAGTGAAGCAG A/G
C14_7207607-HRM 14 22.5 GTTCTTCACCAATTCTCGTACCTT CCTCATCTTTCAAGCACTCTATCA C/T
C14_10496252-HRM 14 28.1 GACCTTTGATGTAAATGCTGCTT TCATGGCTTGATTTCTCTGTCTAC C/T
C14_10293852-HRM 14 28.6 GATGCTTATGGTCTGTCAAGTGTT GTATCATCCTCCATCCTCTTTTTC C/T
C14_12525376-HRM 14 29.6 TCATCATGGGATGGTAACATTATT CTGCTAAGTGATGCATTTTCTGTA T/G
C14_16196404-HRM 14 32.4 AAAGGAAAGGAAAGGAAAGGAAC CATCCACAAACCCAGACAAAT A/G
C14_17812709-HRM 14 34.9 TTTGAATGTGTTCTTAACTTCTCCA AGCAAAGAAAGCAGCAAAGTAGTC C/T
C14_21067472-HRM 14 41.4 CATGCTTCATCCTCTTATCATTTTT AATCTTTTCATTGAAGTTCGATCC A/G
C14_21150740-HRM 14 42.1 ATGTCTCTGCTCCTTCAAGAACTC AGGTGACGATATTGCACTTGG A/G
C14_22893321-HRM 14 49.8 CAGATTATCAAGGCTATGGGTTG AGGAGAGATTACAGAAGGCTGGT G/A
C14_24956444-HRM 14 64.0 ACATGCATTCTCCAAATGAAACTA AAGGGAATTGCTATGATGAAAGAG G/A
C14_25421505-HRM 14 67.5 CAACAGCTAGCTTTCTTTCATCAG CTAACCCTGAAAAACCGGAATAC G/T
C14_26420306-HRM 14 73.7 ACAATCTGAAAATGAATGGGAAAT CACCAACAATTGAGAGTGACGTAT G/A
C14_29407924-HRM 14 84.0 GTGATGAACAGAGAGTCTCAAAGC TGTGACCCACTGCATAGATCATAG G/A
C14_29459475-HRM 14 86.1 ATTGATGACGTCGTCCTATTCTG AATATTTTTCGAAGCATCAAGCTC C/A
C15_1094204-HRM 15 0.0 GTTCAGACTGTTCAACACCTTCTC GAGCTGCTAATCAAGCAATTCAT A/C
C15_1094147-HRM 15 2.1 AGTGTCTTCGTCCTTCCATCTTC AGAAGGTGTTGAACAGTCTGAACC A/G
C15_325727-HRM 15 3.3 GGATAAGAGCTGTTCTGGAGAAGT CTTTTATCTGCAACTTCATGTGCT A/G
C15_401318-HRM 15 4.5 CTAGAAGCCTTCCTCTTCTCTTCA CCACAAAAGTGTGTTTTTATGCTT T/C
C15_3334519-HRM 15 6.6 AGGTTGCTGTTGGTAGTTTACTGG GGGAGACAATTGATGAAGCTAAAC A/G
C15_5414192-HRM 15 7.6 GATGATGATTGAACCCCATCTC GACCAACAATGCTATAACAGCAAC T/G
C15_11320218-HRM 15 13.0 AAAAGGATTAAGGAGGGGAAAACT TTTGCAGCAGAGAAATCTTAATTG T/C
C15_11929537-HRM 15 14.9 GTTCATCTGGTTTTACCAGTGTGT CGCAACTTAAACCAGAAACATAAC T/C
C15_13743409-HRM 15 23.7 AAATCAACCTCCACTTTTCAATTC GTGGACTTTGGACTTTCTCTTTGA T/C
C15_15000484-HRM 15 28.0 GGTCAGCACCGAGGAGTAAAC AGCCTAGAGGGGACCTCCTT A/G
C15_16459458-HRM 15 35.4 GGTTTCCAGTTCAAAGGAATGTAT CTAGCCTCTGCTGGTTAATGCT T/C
C15_17238769-HRM 15 41.8 AATCTAAAGCCTTGCACAATGAAC GCATTTTAAAGAGCAGCAACAATA C/A
C15_18031506-HRM 15 47.1 GAGTAGAACCTGAAAGCAAGCATA AAATTCCCTTGTCTACTACTGCTGA G/T
C15_17654072-HRM 15 53.1 CATCCTACAGCATTCCATTACAGA AAGCACGTGTGATGATTCTTTTTA T/C
C15_19031330-HRM 15 57.6 TTGGTTCCTAGATACCATGTCAAA TCCTGTTAACTAACCTTGCTTCTG T/C
C16_197523-HRM 16 0.0 CTTTCACCCTTCCCTCCTCT CACTTAAATATGACCAACCACCTG C/T
C16_245630-HRM 16 0.7 CACCTTCATTTTTCCATCTCTTTT GGCTGCAAATACATCATCTCAG A/C
C16_1728793-HRM 16 9.9 GAAGAAGATGCCATTGTGAAAAG ATTTGGAACCCTAATCCACACTAC C/T
C16_12729149-HRM 16 15.6 TCTTCTTTTTATTCGCATTGAACA CTATTCCTCGAGCATCATCAATC A/G
C16_4810044-HRM 16 20.5 TTGCTGCCAAAATAGATGAGATAA GTTTCCTCAAGAAGGCTACACATT A/G
C16_9654798-HRM 16 22.1 GCTTCTAGGTAGGAGGATTTCTCA AGTGCAAACTTTGGATCACCTATT A/G
C16_14572240-HRM 16 28.2 AGACATCAAAAAGGTTGAACATGA GCTTGAAGAACCCTAATTGTGTG A/G
C16_16242237-HRM 16 31.6 CTGAGTGGTGAGCTTTGGAGAG GCTTATACCACCACTCTTTGGAAT A/G
C16_19840371-HRM 16 44.5 CCTTCACCTTGTCGACTGCT CTCAAAGGCAATTGAGGATACAAT T/C
C16_22270702-HRM 16 55.1 CAATACCTATGGTGATGGATGAAA TTTGAGATGAATTTCCAAGAGATG C/A
C16_23150077-HRM 16 59.4 TATTCCAATGCAGACCTCTAACAA GTGCAGATATGGCTTCTTTGAGAC C/T
C16_23438632-HRM 16 67.6 GCTCATCATGACTGTTAGATGTCTTT AAAACAAATAAGGTCAGCCTTGTC T/C
C17_4412845-HRM 17 0.0 GCATTTGCTTATATAGATGCTGCT GCATAGTTGCAATGTAATTTCCTG G/A
C17_1853980-HRM 17 4.1 CAGAGTTTAGACAGCTCATGGAAA AGAAGTCTCGGTTGTTCCATCTAT A/G
C17_4527284-HRM 17 4.6 AGAACATGATAAATCCTCCACCAT ATGGCCGTGTTTCACTGTCT T/C
C17_4342827-HRM 17 6.2 CTCTTTTCATAAATGCTTGGGTCT TCACCACTAGTTCATTGTGCAGTA T/C
C17_3893863-HRM 17 8.9 TGCTGACTATAGACTTGCTTGAGG CTACCTCTGGCTTCATGTGGAT A/G
C17_3110117-HRM 17 9.3 ATGTCTTCCACCCACCAATATAAG GGATGCCTGAGCACTTATGG A/G
C17_2660840-HRM 17 10.7 TGCTCTAACAGGTCAGTTGGTAAA AGCATCTGCTGCTAGCTTCATTA T/G
C17_4085528-HRM 17 11.5 AGAAGCCAGAACACCCTGATATT GTATGCATGGTTACCAATCTCCAT A/G
C17_3643068-HRM 17 14.3 ACTCCATTTCATCCTTCACGTTAT ATGACGACGGTCCAGCTC C/T
C17_3088599-HRM 17 21.1 CAGCTCCTGATTGGCTTATTTATAG TTTTTCCCAGACACCAACTAA A/G
C17_7235628-HRM 17 26.7 TTTAGAGGATGAAGTCCAGTAGCA CAATTGGAGAAATTGCTTAGTTCA A/G
C17_7176322-HRM 17 28.2 ATTGAGCATGATTCTCTGTTTTGA CAGAAAGTACCAGGACATCTGACA G/A
C17_7755408-HRM 17 30.6 ACAATCACACGAGCTAAGAAATGA CTTTGGAGATGTTTCTATCTGCTG C/T
C17_10334200-HRM 17 38.4 TGGCACTTGATTAGTCTCCAATAG ATGTTTACAGGTATTGCCCAGTCT T/C
C17_9238389-HRM 17 43.0 CATTCTTGAGCCCATTTTAAGTTT AAGGCTCAATTATTGTCCGACTAC C/T
C17_11750695-HRM 17 47.2 CCAGTACTATGGGGAATCAACTGT TGTACTCAAACAATATAGCTGCACA C/A
C17_15538171-HRM 17 50.1 GATCTGTTCATGGAGATGGTGA CTGCTTCATTCGGAATCATCTTAT T/C
C17_12638800-HRM 17 50.9 GAAACATAATCTTTTTGGCAAAGG CCATCATCATCACCATCTCATTAC A/G
C17_11804262-HRM 17 52.5 GTTACCTTTCATGGAAAATGGTTC TTTTTGCCAATTTTCTACAGTCAG A/G
C17_16648079-HRM 17 55.6 CTGTTAATGCTCATAGGCATGTTG AGTCCAACTGAGATCTATTCAGCA T/C
C17_11510746-HRM 17 58.3 CGGGTCCTAAGAAGCTACCATTA CATATTCATTTGAAAGGCGTTG A/G
C17_11826795-HRM 17 61.1 CTTGCAAATGAAGAGTCTAATGCT CTCTAAATCTCGGAGTTCTTGACC A/G
C17_11019665-HRM 17 65.4 TGCTCATGTTGAACTAAAGTTGCT TTCCCAATACAAAGTATAAACTCCA T/C
C18_153959-HRM 18 0.0 ACAATTTCAAGGAGGAAGAATTTG CATGGACATGAAGTGTTTAGGAAG T/C
C18_1777529-HRM 18 7.7 TTATTTAGCTGCCACTTTTGTTTG GTTGGTTGAGCTAGAGGATCAAAT T/C
C18_907827-HRM 18 11.4 TGCTAGTGTCCTCCTAACAATCAG CACAAGATTCTCCAACTCTTGGTA A/C
C18_2575166-HRM 18 14.2 AAAGGTTCTTATGGAGCTATTTCA TCATCAAGTGGAACTCCAAAGTTA C/T
C18_352680-HRM 18 15.8 CAGAACCTTTGCATCTGCTTC TCTCTCAAATGCGAAAGACTATCA G/A
C18_200993-HRM 18 16.3 AAAAGAAGGGCATATGTAAGATGG GGTCAATCTCTAAATGAGGTTTGG A/C
C18_686672-HRM 18 18.3 CAATTTATCTCGTGGAGGCTAGTT CAAGAAAAGCCTGATACGAAGAAT C/T
C18_1670407-HRM 18 21.0 AAACCATGTGCCACACACAG TGTAGGTTGACTGTGCAATAAAGG G/A
C18_5335629-HRM 18 27.1 CTGTGAAAAATCTTCAAGGAGCAT CAACATGACGCACCTTCTGTAATA A/G
C18_3688904-HRM 18 28.3 ATTTGAAGATGCAAAAAGGAGCTA CTTCTCCAGATGACAAGTTTCAGA T/C
C18_5909613-HRM 18 30.0 AGATGAGAGGCAATGACTATGGTA CCACTTTGATTTCTTTCATCAACA G/A
C18_4162453-HRM 18 31.1 CTCTCTTTGAAGACAAAGCATCTG GGTTAAGAACCGTGATGAAATTCT C/A
C18_5131181-HRM 18 33.8 ACTAATGGCTCAATCACACCAAC ACCCAACGAGACGCACAC A/G
C18_6440306-HRM 18 34.2 GTTTTGATGGTTTGAGCATGAACT TGATCTGTTCACCTTCTCAAGTGT C/T
C18_6854075-HRM 18 37.4 GAGGATGGTGTTAACAATTGGTCT AATTTTTCCACCTCCCATAGAGTC G/A
C18_8290813-HRM 18 38.7 CTGCCTTCCAAGATCAAGAGTTAT CTGCAGACAAAAGTAATTTCCAAT A/G
C18_7384425-HRM 18 40.9 CTGCACTCGAAGTTATTACGATTT GCAGTCGTCACAACGTATGTTAAA C/T
C18_9381263-HRM 18 41.7 AGGTTCCCGAGTAATGCAGTCTT GGAATGTTTCAGCCTATGAATTTT G/A
C18_10516718-HRM 18 43.5 GATTAGAATGGTTTGAAGTTGCTG TCTCTGAAGAAGAGGATCACCAAT A/C
C18_10013638-HRM 18 47.2 CTGAAATCTTCTCCGAGCGTTT AAATCCTTGACATGAGTTTGGAG T/C
C18_13366981-HRM 18 52.7 GAAGGATCACATGACAGCTTTTT TTTTTCAAACCCCAACAATATGTA A/G
C18_14561354-HRM 18 58.9 TAACTTCAATCTCGATCTGGCTTT CCAATCAAGACTCAGGATGTTAGA T/C
C18_12969688-HRM 18 66.5 TATAATTCCCTCCAATTTGTGGTT GAAGCAGAGTGGGCAAGTAGTAAT A/G
C18_20428327-HRM 18 74.0 AAATGGCCAAGTCACTACTAAAGG GCCCCAACACCTTAGGATTC A/G
C18_17295638-HRM 18 75.4 ATCGGGATCATCAACGTCATA TGACCATTTCATCCTTTGTGAAC A/C
C18_18137477-HRM 18 77.0 TTTGATCAGAAACAAACAAGTGGT GACAATGAGGTCTGTTGGAGTTTA C/T
C18_20381800-HRM 18 79.2 CACACAGCGGTCAACGTC GAAACTCGGACCAATCAAACC T/C
C18_20847993-HRM 18 79.2 AGATGCAGTTGGTGACAAGCAT CAAGTCTCTCTACGCCCTTGTC C/A
C18_19961727-HRM 18 80.8 TACTATTATCGCCTTGCAGCCTTA ATCGTAGAGAGCGTTTCGGTTAC C/A
C18_22843850-HRM 18 85.0 ATATTTTCTGCAGGAATGCAATG AGCTTTTAGTCCAGGAGAGATCAA A/G
C18_24053356-HRM 18 90.9 CCAAATTTGTCTTACCAGAACAGG TCTTCAGATGCACACCTAAAAATA G/A
C18_23573813-HRM 18 95.4 AACCTTGTGTCTTTGTCAAGTGAA TGGTTACAATTGTTGGGAGTTATG C/T
C18_27841771-HRM 18 98.2 ATTGTGTTTTGTTTCCCTTCTCAT AGTCTACTGAACTCTGCTGCTCAA G/A
C18_27841647-HRM 18 103.1 ATTATTTGCAGCAAGAAACCTAGC TGGTTATTGTAGGCTAATCCACCT T/C
C18_32680428-HRM 18 104.4 GTGATGGTGAAGAAGATGCTAGTG CTTTAACTGCAGTGTCACCACTCT A/G
C18_29355370-HRM 18 105.3 AGTTCCTATGCATGTAATCCTTCC TACAGTCAGACTTTTCGGGTATTG C/T
C18_31821552-HRM 18 107.2 GGTTGACTGTAACCTGACATAGGC GTATAATCAGCCACAACCAGCAT A/G
C18_28308400-HRM 18 109.1 ATGGTCTCTTCGATTGCTTCAAC GAGACAGTTACTGCCGTCGTG G/A
C19_1029365-HRM 19 0.0 TTGATGCAACCAGATTATGAATG ACTAACAGTGAAGTGAAGCAGCAG C/T
C19_18490478-HRM 19 7.1 CTAAGCCATGTACCTTCCTTTCTC CAGTAAGAGAGCTGCAAAAGCTG A/G
C19_305299-HRM 19 12.3 ATTAGAAAAGCAGCTTACCCAGAA CAATTAGGAGAGGTGAGGAATCAT G/A
C19_2056568-HRM 19 14.7 CAGAAAACAATGGGAGAAGAATATC CTCTTTGGTTTCTTTTTCTGCTTC A/C
C19_1086336-HRM 19 17.4 AGACTGATGATCAATGAGATGGAA TGTGAGTGGCTTTCAAAAAGACTA T/C
C19_18490490-HRM 19 21.1 AGTGGTAAAACTTCATGGGTTGAT CTTTAAGTTTCCACAGCTTGGTTT G/A
C19_5919132-HRM 19 30.4 CAATCCTCCATGTCTTCAACCT CATGGGTTTGGAGCAGATAGT A/G
C19_18490483-HRM 19 35.4 CTGCAGTTCATATGGGAGGTTT CTGAGATCACAGCTAAAACAAGGA A/G
C19_18490491-HRM 19 37.7 TACTTAATGGCTTTGCTGAAACAG CTGGCCTTCTCTCCTTCTCTAAG G/A
C19_18490493-HRM 19 47.5 TCTGAGAACAAGAACAAAGCTTGA TGCTAATCCTTACTTAAGCAGCAC G/A
C19_10673361-HRM 19 53.4 AGATCACTTGAAAAGGCAGATACC TCCATTTATGTGGCTTCTAGTTCC C/A
C19_18490503-HRM 19 56.0 AAGTTGGTTACAGTCCCAGTTCAG GTTTTCCTTCAACTGTGATGCTG T/C
C19_18490494-HRM 19 58.8 TAGACAAAGATCACTGTTGTCAGC AACACTATTTTCCTTGGGGAATTT G/A
C19_18490506-HRM 19 65.0 GAGACCCAGCACCCTCTTC TCAGGTACCGGAGCAAAATTAC T/C
C19_14741231-HRM 19 66.2 TTTCTTACCCTCAGAATTCTCGTC TGATTCTTTTAGGAGCCCTAATTC G/T
C19_18490500-HRM 19 68.0 TGAGACGGTAAACTTCATTCTTGA CCACCTGATGAAATAAAACCATTA C/T
C19_23204606-HRM 19 71.7 TCTTTTATGTGAAAGTGGGTGATG CATAGCAGTCCAAGAAACAACACT G/T
C19_23959588-HRM 19 73.4 ATCAACCACAGTTGTGAGAACACT ATTCTCTCCTGAACAATCTGATGC T/G


HRM 분석

HRM 반응액은 genomic DNA 30 ng⋅μL-1 2 μL, 10× EasyTaq buffer 2.0 μL (Transgen Biotech, China), 2.5 mM dNTP mixture 1 μL, SYTO®9 green fluorescent nucleic acid stain (Life Technologies, Carlsbad, CA, USA) 0.5 μL, 0.1 units Taq DNA polymerase (Transgen Biotech, China), 각각의 Primer (Table 2) 2.0 μL, TDW 12.4 μL를 혼합하여 총 20 μL로 만들어 사용하였다. PCR 반응은 95℃에서 5분간 pre-denaturation을 진행하였고, 95℃에서 20초간 denaturation, 60℃에서 2초간 annealing 및 extension 과정을 39회 반복하였다. 그 후 72℃에서 20초간 final extension 반응을 진행하였으며, 최종적으로 생산된 PCR products는 LightCycler® Real-Time PCR (Roche, Basel, Swizerland)를 사용하여 65℃에서 97℃까지 0.2℃씩 온도를 증가시키며 SYTO®9 형광값을 측정하여 melting curve graph을 작성하였다. LightCycler® v.1.1.0.1320 프로그램(Roche, Basel, Switzerland)을 사용하여 유전자형을 분석하였다(Wittwer et al. 2003).

유전자지도 작성

유전자지도 작성은 JoinMap® 4.1 프로그램을 이용하여 수행하였다(Van Ooijen 2006). 연관 그룹은 LOD≥5.0 조건에서 최대 거리 30 cM을 기준으로 하였고, 지도 거리는 Kosambi (1944) mapping function을 이용하여 계산하였으며, 집단옵션은 CP[outbreeder full-sib family, 연관상(linkage phases)을 모르고 이형접합과 동형접합이 불균일하게 분포되어 있는 양친을 교배한 집단]을 사용하였다(Van Ooijen 2011). 최종 유전자연관지도는 MAPCHART v.2.1 프로그램을 사용하여 그렸다(Voorrips 2002).

결과 및 고찰

SNP 분류 및 HRM 분석용 프라이머 디자인

이전 연구에서 ‘Tano Red’와 ‘Ruby Seedless’의 F1 개체를 대상으로 GBS 분석을 수행하였고, 총 2,553개의 SNP가 탐색되었다(Im 2020). 모친(‘Tano Red’)은 동형접합형이고 부친(‘Ruby Seedless’)은 이형접합형인 경우 ‘nn×np’로 분류하였고, 모친은 이형접합형이고 부친은 동형접합형인 경우 ‘lm×ll’로 분류하였는데, 각각 853개와 951개가 탐색되었다(Table 1). 이 두 경우의 SNP는 F1 분리집단에서 1:1로 분리될 것으로 기대된다. ‘nn× np’인 경우의 SNP는 부친 유전자지도를, ‘lm×ll’인 경우의 SNP는 모친 유전자지도를 작성하는데 이용할 수 있다(Iwata et al. 2016). 그리고 양친 모두 이형접합형인 경우 ‘hk×hk’로 분류하였는데, 749개가 탐색되었다(Table 1). 이 경우의 SNP는 F1 분리집단에서 1:2:1로 분리될 것으로 기대된다. ‘hk×hk’인 경우의 SNP는 모친 및 부친 유전자지도에 모두 위치할 수 있어 모친 유전자지도와 부친 유전자지도를 통합할 수 있게 한다(Iwata et al. 2016). 따라서 본 연구에서 ‘hk×hk’인 경우의 SNP를 중심으로 HRM 분자표지를 개발하였고, 유전자지도가 연결되지 않는 부분에서 ‘nn×np’와 ‘lm×ll’인 경우의 SNP를 추가적으로 HRM 분자표지를 개발하였다.

탐색된 SNP의 주변 염기서열(600 bp)을 이용하여 포도 표준유전체에 BLAST 분석을 수행하여 상동(homologous) 염기서열이 존재하지 않는 SNP를 선발하여 프라이머를 디자인하였는데, 총 2,553개의 SNP 중에서 1,336개의 SNP에서 HRM 분석용 프라이머를 디자인하였다(Table 1). 그 중 ‘nn×np’는 449개, ‘lm×ll’는 509개, ‘hk×hk’는 378개였다(Table 1).

SNP 기반 HRM 분자표지 개발

총 1,336개의 HRM 분석용 프라이머를 디자인하여 SNP 기반 HRM 분자표지 개발에 사용하였다(Table 1). 먼저 양친으로 사용된 ‘Tano Red’와 ‘Ruby Seedless’를 교배한 F1 분리집단 24개 개체를 이용하여 실제로 다형성이 나타나는지 확인하기 위하여 HRM 분석을 수행하였다(Fig. 1). 그 결과 1,336개의 프라이머 조합 중 다형성이 나타난 것은 805개였으며(Supplementary Fig. 1), 나머지 531개는 다형성이 없었거나, 두 개 이상의 단편이 증폭되어 melting curve가 복잡해 유전자형을 구분할 수 없었다(Table 1). 고추(Capsicum spp.)의 경우, C. annuum ‘NB1’×C. chinense ‘Jolokia’ 종간교잡 분리집단에서 HRM 분자표지 개발 성공 확률이 80%인 것에 비하여 낮은 성공률(60.3%)을 보였는데(Table 1, Lee et al. 2013), 이는 생물정보 분석에서 거짓양성(false positive)이 선발되었거나, 포도 표준유전체의 정보가 아직 완전하지 못해 상동 염기서열(paralogous sequences)이 존재하는 SNP를 완전하게 제거하지 못하였기 때문인 것으로 생각된다(Bresadola et al. 2020).

Fig. 1. Examples of normalized melting peaks generated by three HRM markers, C01_3587166-HRM (A), C01_9408352-HRM (B) and C01-19514907 (C), developed in this study; nn, homozygous genotype of ‘Tano Red’; np, heterozygous genotype of ‘Ruby Seedless’; lm, heterozygous genotype of ‘Tano Red’; ll, homozygous genotype of ‘Ruby Seedless’; hk, heterozygous genotype of ‘Tano Red’, ‘Ruby Seedless’.

포도 유전자지도 작성

본 실험에서는 개발된 805개의 HRM 분자표지 중에서 포도 전장유전체를 전체 커버할 수 있는 363개의 HRM 분자표지를 선발하여 포도 유전자지도 작성에 사용하였다(Tables 2, 3, Supplementary Table 1). 우선 모계와 부계 유전자지도를 연결할 수 있는 ‘hk×hk’ 유전형 HRM 분자표지를 모두 선발하였고, 이를 이용하여 유전자지도를 작성하였을 때, 같은 염색체의 연관군이 연결이 되지 않는 부분은 ‘nn×np’ 또는 ‘lm×ll’ 유전형 HRM 분자표지를 추가하여 연결하였다. 그 결과 총 연관거리가 1453.5 cM이고, 363개의 HRM 분자표지와 19개의 연관군으로 구성된 포도 유전자지도를 작성하였다(Fig. 2, Table 3). 분자표지 간의 평균 거리는 4.0 cM이었다(Table 3). 본 실험에서 작성된 종내교잡 유전자지도의 총 연관거리(1453.5 cM)는 이전 다른 연구(1406.1 cM과 1460.38 cM)와 비교해 큰 차이가 없었다(Adam-Blondon et al. 2004, Jiang et al. 2020). 하지만 다양한 종간교잡에서 작성된 유전자지도에 비하면 총 연관거리가 작았다(Wang et al. 2012, Guo et al. 2015, Zhu et al. 2018, Shi et al. 2022).

Table 3

Summary of a genetic linkage map in an F1 population of grape cultivars ‘Tano Red’בRuby Seedless’ using HRM markers.

Chromosome No. Number of HRM markers Length of linkage distance (cM) Average marker interval(cM/marker)
1 20 88.4 4.42
2 19 69.6 3.66
3 10 72.8 7.28
4 17 79.6 4.68
5 12 69.9 5.83
6 24 74.8 3.12
7 15 94.6 6.31
8 28 57.4 2.05
9 13 61.9 4.76
10 11 77.7 7.06
11 10 96.1 9.61
12 22 87.1 3.96
13 37 64.4 1.74
14 19 86.1 4.53
15 15 57.6 3.84
16 12 67.6 5.63
17 23 65.4 2.84
18 38 109.1 2.87
19 18 73.4 4.08
Total 363 1453.5 4.00

Fig. 2. A genetic linkage map consisting of 363 SNP markers in an F1 segregating population of grape cultivars ‘Tano Red’בRuby Seedless’.

최근 작성되고 있는 포도 유전자지도는 next-generation sequencing (NGS) 기술을 이용하여 대량의 SNP를 탐색하고 탐색된 SNP의 유전자형을 분석하여 신속하게 만들어지고 있으나(Wang et al. 2012, Guo et al. 2015, Hyma et al. 2015, Zhu et al. 2018, Tello et al. 2019, Jiang et al. 2020, Shi et al. 2022), 유전자형 scoring 정확성에 있어서는 문제가 제기되고 있다(Bresadola et al. 2020). 예를 들면 이형접합형(heterozygous)을 동형접합형(homozygous)으로 잘못 scoring하는 경우가 있는데 이 경우가 가장 빈번하게 나타났다(Bresadola et al. 2020). 따라서 본 연구에서는 탐색된 SNP를 HRM 분자표지로 개발하여 유전자형을 분석함으로써 scoring의 정확성을 더 높였고, 이후 진행될 양적형질유전자좌(QTL) 탐색에 있어서도 그 정확성을 높일 수 있을 것으로 기대된다.

본 연구에서 개발된 HRM 분자표지는 sequence characterized amplified region (SCAR), cleaved amplified polymorphic sequence (CAPS), SSR 등의 PCR 기반 분자표지보다 훨씬 쉽고 빠르게 분석할 수 있는 장점이 있어 포도 형질 연관 분자표지 개발 및 다양한 형질 유전 연구에 큰 도움이 될 수 있을 것이라 생각된다(Simko 2016). 또한 본 연구에서 작성한 포도 유전자지도는 F1 식물체의 다양한 과실 표현형 데이터 수집을 통해 QTL 분석에 활용될 수 있을 것이다(Im 2020).

적 요

포도(Vitis vinifera L.)는 38개의 염색체를 가지고 있고 높은 이형접합성을 가지고 있는 영년생 과수 작물이다. 그리고 유묘에서 포도 열매가 맺히기까지 오랜 시간이 걸리기 때문에 포도의 유전학적 및 육종적 연구는 매우 어렵다. 그러나 최근에는 전장유전체 재분석(resequencing) 및 GBS 분석 방법을 통해 대량의 SNP를 탐색할 수 있다. 본 연구에서는 탐색된 SNP로부터 HRM 분자표지를 개발하고, 개발된 HRM 분자표지를 이용하여 포도 유전자지도를 작성하고자 하였다. 이전 연구에서 GBS 분석을 통해 탐색된 총 2,553개의 SNP를 이용하여 본 연구에서는 그 중 1,336개의 SNP에 대해 HRM 분석용 프라이머를 디자인하였다. 개발된 HRM 분자표지를 이용하고 모친인 ‘Tano Red’ (V. labrusca×V. vinifera)와 부친인 ‘Ruby Seedless’ (V. vinifera)를 교배한 F1 분리집단 192개체를 식물재료로 이용하여 포도 유전자지도를 작성하였다. 그 결과 총 805개의 다형성이 있는 HRM 분자표지를 개발하였고, 그 중 363개의 분자표지를 포도 유전자지도를 작성하는데 이용하였다. 작성된 유전자지도의 총 연관거리는 1453.5 cM이었고, 각각의 염색체에 해당하는 19개의 연관군으로 구성되었다. SNP 기반 유전자지도와 HRM 분자표지는 포도의 중요 과실 형질에 대한 QTL 탐색 및 연관 분자표지 개발에 유용하게 활용될 수 있을 것이다.

보충자료

본문의 Supplementary Fig. 1, Table 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.

사 사

본 논문은 농촌진흥청 작물분자육종생명공학혁신기술개발사업(과제번호: PJ01567901)의 지원에 의해 이루어졌습니다.

Supplementary information
Supplementary File
References
  1. Adam-Blondon AF, Roux C, Claux D, Butterlin G, Merdinoglu D, This P. 2004. Mapping 245 SSR markers on the Vitis vinifera genome: a tool for grape genetics. Theor Appl Genet 109: 1017-1027.
    Pubmed CrossRef
  2. Bresadola L, Link V, Buerkle CA, Lexer C, Wegmann D. 2020. Estimating and accounting for genotyping errors in RAD-seq experiments. Mol Ecol Resour 20: 856-870.
    Pubmed CrossRef
  3. Cho KH, Hur YY, Nam JC, Park SJ, Kim SH, Han JH, Lee HC, Jo SH. 2017. Evaluation of major fruit traits in progenies derived from a cross between 'Tano Red' and 'Ruby Seedless' grapevines (Vitis spp.). Korean J Breed Sci 49: 324-333.
    CrossRef
  4. Chung KH, Nam EY, Kwon JH, Hur YY, Kwon SI, Kim YK, Ma KB, Yun SH, Lee MH, Park YS, Lee SH, Kim E, Park MY, Park WH, Lee HI, Suh HY, Kim EG, Kang JH. 2020. The history, current status and future prospects of fruit breeding in Korea. Korean J Breed Sci 52: 144-160.
    CrossRef
  5. Doligez A, Adam-Blondon AF, Cipriani G, Di Gaspero G, Laucou V, Merdinoglu D, Meredith CP, Riaz S, Roux C, This P. 2006. An integrated SSR map of grapevine based on five mapping populations. Theor Appl Genet 113: 369-382.
    Pubmed CrossRef
  6. Grando MS, Bellin D, Edwards KJ, Pozzi C, Stefanini M, Velasco R. 2003. Molecular linkage maps of Vitis vinifera L. and Vitis riparia Mchx. Theor Appl Genet 106: 1213-1224.
    Pubmed CrossRef
  7. Guo DL, Zhao HL, Li Q, Zhang GH, Jiang JF, Liu CH, Yu YH. 2019. Genome-wide association study of berry-related traits in grape [Vitis vinifera L.] based on genotyping-by-sequencing markers. Hort Res 6: 11.
    Pubmed KoreaMed CrossRef
  8. Guo Y, Shi G, Liu Z, Zhao Y, Yang X, Zhu J, Li K, Guo X. 2015. Using specific length amplified fragment sequencing to construct the high-density genetic map for Vitis (Vitis vinifera L.×Vitis amurensis Rupr.). Front Plant Sci 6: 393.
    Pubmed KoreaMed CrossRef
  9. Hur YY, Jung SM, Yun HK. 2015. Current status and prospects of genomics and bioinformatics in grapes. J Plant Biotechnol 42: 298-311.
    CrossRef
  10. Hyma KE, Barba P, Wang M, Londo JP, Acharya CB, Mitchell SE, Sun Q, Reisch B, Cadle-Davidson L. 2015. Heterozygous mapping strategy (HetMappS) for high resolution genotyping-by-sequencing markers: a case study in grapevine. PLoS ONE 10: e0134880.
    Pubmed KoreaMed CrossRef
  11. Im DJ. 2020. Genome-wide association study on berry traits of table grapes. Seoul Nat'l Univ., Seoul, Korea.
  12. Iwata H, Minamikawa MF, Kajiya-Kanegae H, Ishimori M, Hayashi T. 2016. Genomics-assisted breeding in fruit trees. Breed Sci 66: 100-115.
    Pubmed KoreaMed CrossRef
  13. Jiang J, Fan X, Zhang Y, Tang X, Li X, Liu C, Zhang Z. 2020. Construction of a high-density genetic map and mapping of firmness in grapes (Vitis vinifera L.) based on whole-genome resequencing. Int J Mol Sci 21: 797.
    Pubmed KoreaMed CrossRef
  14. Kim MS, Hur YY, Kim JH, Jeong SC. 2020. Genome resequencing, improvement of variant calling, and population genomic analyses provide insights into the seedlessness in the genus Vitis. G3 10: 3365-3377.
    Pubmed KoreaMed CrossRef
  15. Kim S, Misra A. 2007. SNP genotyping: technologies and biomedical applications. Annu Rev Biomed Eng 9: 289-320.
    Pubmed CrossRef
  16. Kosambi DD. 1944. The estimation of map distance from recombination value. Ann Eug 12: 172-175.
    CrossRef
  17. Lee J, Park SJ, Do JW, Han JH, Choi D, Yoon JB. 2013. Development of a genetic map of chili pepper using single nucleotide polymorphism markers generated from next generation resequencing of parents. Hort Sci Technol 31: 473-482.
    CrossRef
  18. Lijavetzky D, Cabezas JA, Ibáñez A, Rodríguez V, Martínez-Zapater JM. 2007. High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology. BMC Genomics 8: 424.
    Pubmed KoreaMed CrossRef
  19. Lodhi MA, Daly MJ, Ye GN, Weeden NF, Reisch BI. 1995. A molecular marker based linkage map of Vitis. Genome 38: 786-794.
    Pubmed CrossRef
  20. Rahemi A, Dodson Peterson JC, Lund KT. 2022. Grape species. Grape rootstocks and related species. Springer, Cham.
    CrossRef
  21. Reisch BI, Owens CL, Cousins PS. 2012. Grape. pp. 225-262. In: Badebes ML, Byrne DH (Eds) Fruit breeding; handbook of plant breeding (Ⅱ). Springer, New York.
    CrossRef
  22. Riaz S, Dangl GS, Edwards KJ, Meredith CP. 2004. A microsatellite marker based framework linkage map of Vitis vinifera L. Theor Appl Genet 108: 864-872.
    Pubmed CrossRef
  23. Ryu H, Kim S, Lee HE, Han J, Lee J. 2021. Development of single nucleotide polymorphism markers linked to quantitative trait loci controlling anthocyanin content in red bulb onion (Allium cepa L.). Korean J Breed Sci 53: 116-126.
    CrossRef
  24. Semagn K, Babu R, Hearne S, Olsen M. 2014. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Mol Breed 33: 1-14.
    CrossRef
  25. Shi G, Sun D, Wang Z, Liu X, Guo J, Zhang S, Zhao Y, Ai J. 2022. Construction of a resequencing-based high-density genetic map for grape using an interspecific population (Vitis amurensis×Vitis vinifera). Hortic Environ Biotechnol 63: 489-497. https://doi.org/10.1007/s13580-021-00414-2.
    CrossRef
  26. Simko I. 2016. High-resolution DNA melting analysis in plant research. Trends Plant Sci 21: 528-537.
    Pubmed CrossRef
  27. Tello J, Roux C, Chouiki H, Laucou V, Sarah G, Weber A, Santoni S, Flutre T, Pons T, This P, Péros JP, Doligez A. 2019. A novel high-density grapevine (Vitis vinifera L.) integrated linkage map using GBS in a half-diallel population. Theor Appl Genet 132: 2237-2252.
    Pubmed CrossRef
  28. The French-Italian Public Consortium for Grapevine Genome Characterization. 2007. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449: 463-468.
    Pubmed CrossRef
  29. Troggio M, Malacarne G, Coppola G, Segala C, Cartwright DA, Pindo M, Stefanini M, Mank R, Moroldo M, Morgante M, Grando MS, Velasco R. 2007. A dense single-nucleotide polymorphism-based genetic linkage map of grapevine (Vitis vinifera L.) anchoring Pinot Noir bacterial artificial chromosome contigs. Genetics 176: 2637-2650.
    Pubmed KoreaMed CrossRef
  30. Van Ooijen JW. 2006. JoinMap® 4, Software for the calculation of genetic linkage maps in experimental populations. Kyazma B.V., Wageningen, the Netherlands..
    CrossRef
  31. Van Ooijen JW. 2011. Multipoint maximum likelihood mapping in a full-sid family of an outbreeding species. Genet Res 93: 343-349.
    Pubmed CrossRef
  32. Voorrips RE. 2002. MAPCHART: software for the graphical presentation of linkage maps and QTLs. J Hered 93: 77-78.
    Pubmed CrossRef
  33. Wang N, Fang L, Xin H, Wang L, Li S. 2012. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing. BMC Plant Biol 12: 148.
    Pubmed KoreaMed CrossRef
  34. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clinic Chem 49: 853-860.
    Pubmed CrossRef
  35. Zhang H, Fan X, Zhang Y, Jiang J, Liu C. 2017. Identification of favorable SNP alleles and candidate genes for seedlessness in Vitis vinifera L. using genome-wide association mapping. Euphytica 213: 136.
    CrossRef
  36. Zhu J, Guo Y, Su K, Liu Z, Ren Z, Li K, Guo X. 2018. Construction of a highly saturated genetic map for Vitis by next-generation restriction site-associated DNA sequencing. BMC Plant Biol 18: 347.
    Pubmed KoreaMed CrossRef


December 2022, 54 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information