search for




 

Evaluation of Molecular Markers Linked to Rice Blast Resistance Gene in Korean Rice Varieties
국내 벼 품종의 도열병 저항성 유전자 유전형 분석
Korean J. Breed. Sci. 2022;54(4):375-384
Published online December 1, 2022
© 2022 Korean Society of Breeding Science.

Hyun-Sook Lee, Su-Kyung Ha, Chang-Min Lee, Hyun-Su Park, and Ji-Ung Jeung*
이현숙⋅하수경⋅이창민⋅박현수⋅정지웅*

Department of Crop Breeding, National Institute of Crop Scienceb(NICS), Rural Development Administration(RDA), Wanju, 55365, Republic of Korea
농촌진흥청 국립식량과학원 작물육종과
Correspondence to: E-mail: jrnj@korea.kr, Tel: +82-63-238-5231
Received November 13, 2022; Revised November 20, 2022; Accepted November 21, 2022.
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Rice blast is one of the most serious agricultural diseases in the world. Rice blast can be managed using low nitrogen fertilizers, treatment with chemical fungicides, and the most effective resistant varieties. Many genetic resources have been investigated and used along with molecular markers to breed blast-resistant rice varieties. In this study, the genetic diversity of blast resistance genes using 27 functional/linked markers and rice blast incidence over three years was investigated in 296 Korean rice varieties. Blast incidence was determined using a 0-9 scoring system (0=no lesions to 9=dead leaves) in nursery tests. The blast incidence of 296 rice varieties showed a significant correlation between years (r>0.64, p<0.001). The 261 Japonica varieties showed blast resistance compared to 114 mid-late maturing varieties or 96 medium-maturing varieties. 35 Tongil-type varieties also exhibited greater resistance than Japonica varieties. DNA marker-trait association analysis was conducted using 27 DNA markers linked to 19 blast resistance genes. Twelve DNA markers showed significant associations with the average blast incidence over 3 years. The ‘9871.T7E’ marker linked with Pi40 was strongly associated with blast disease, with a phenotypic variance of 24% over 3 years (p<0.001). Among the varieties harboring the Pi40 allele, early maturing varieties accounted for 87%. These results imply that the blast resistance of early maturing Korean varieties is associated with the Pi40 gene. These results will be beneficial for breeding blast-resistant rice in Korea.
Keywords : Oryza sativa L, leaf blast, DNA marker, association analysis
서 언

벼 도열병은 벼의 수량과 품질을 저하시키는 주요 원인 중 하나로 Pyricularia grisea (유성세대: Magnaporthe oryzae B. Couch)에 의해 유발되는 곰팡이병 가운데 하나이다. 도열병은 벼 생육 전 기간에 걸쳐 발생하며 발병부위에 따라 모도열병, 잎도열병, 마디도열병, 목도열병, 가지도열병, 벼알도열병으로 구분된다(Ra et al. 1995, Shim et al. 2003). 최근 국내에서는 이상기후 현상인 강수량 증가 및 일조량 감소 등의 영향으로 도열병 발생이 쉬운 과습 조건이 길어지면서 도열병이 큰 문제가 되고 있다(Jeong et al. 2014, Kang et al. 2019). 도열병은 매년 세계적으로 10-30%의 수량 손실을 발생시키고 있으며 이는 50억 달러의 경제적 손실에 해당된다(Skamnioti & Gurr 2009). 국내에서는 1970년대 통일계 벼 품종 재배 이후 1978-1980년대 전국적으로 대발생하였고(Lee & Park 1979), 1999년과 2000년(Han et al. 2001), 2003년(Lee et al. 2010), 2014년(Kang et al. 2019), 그리고 2021년에 도열병이 심하게 발생한 사례가 있다.

도열병의 방제에는 저항성 품종의 이용, 시비조절 등 재배법 개선, 살균제를 사용한 화학적 방제가 주로 사용된다. 이중 화학적 방제법은 병 발생이 시작되면 회복이 어려워 예방차원에서 사용되고 있지만, 방제비용, 환경오염과 같은 문제점을 내포하고 있다. 그러므로 저항성 품종의 사용이 수량 손실 억제와 방제 비용 절감의 경제적 효과를 보여 가장 효과적인 방법으로 여겨진다.

국내 벼 육종가들은 오랜기간동안 저항성 품종 육성에 많은 노력을 기울였다. 국내외적으로 지금까지 잎도열병 저항성 유전자는 118개 동정 되었고 그중 25개는 유전자가 분자수준에서 확인되었다(Kalia & Rathour 2019). 하지만 이러한 품종 개발에도 도열병균의 빠른 분화로 인한 저항성 품종의 내구저항성, 지속저항성 유지가 어렵다.

신속한 품종육성을 위하여 육종현장에서는 PCR 기반 DNA 마커가 활용되고 있다. DNA마커는 저항성 유전자(R 유전자)와 근접하게 연관된 연관마커와 저항성 유전자와 완전히 연관을 이루는 기능적 마커(functional marker 또는 perfect markers)가 이용된다. 완전마커 활용 예로 현재 국내의 벼 육종에서는 줄무늬잎마름병 저항성 마커 Indel7과 흰잎마름병 저항성 유전자 Xa3마커 등이 활용되고 있다(Kwon et al. 2012, Hur et al. 2013). 도열병 저항성 유전자원의 유전자 탐색 및 분석 연구에서도 연관마커 및 기능적 마커의 활용이 보고되었다(Wu et al. 2015, Kitazawa et al. 2019, Yadav et al. 2019, Baek et al. 2021).

본 연구에서는 이미 보고된 도열병 저항성 27개 DNA 마커를 활용하여 국내 육성 296개 벼 품종의 저항성 유전자형 분석을 실시하고자 한다. 기존의 연구에서는 일부 우수 벼 품종을 활용한 분석 보고가 대부분이지만 본 연구에서는 국내 육성 300여 벼품종의 분석을 통하여 국내 벼품종의 도열병 저항성 유전자형과 주요 유전자좌, 활용도 높은 마커에 관한 주요한 정보를 제공함으로써 신속한 저항성 품종 육성에 기여할 것이다.

재료 및 방법

시험재료

본 실험에 사용된 시험재료는 농촌진흥청 국립식량과학원에서 1979년도에서 2017년도까지 육성된 296개 벼 품종들로 261개 자포니카형과 35개 통일형 품종들이다(Supplementary Table 1). 시험재료는 국립식량과학원 벼 시험포장에서 2017~2019년까지 3년간 재배된 종자를 사용하여 2018~2020년까지 벼 도열병 검정을 실시하였다.

밭못자리 도열병 검정

도열병 저항성 유전자 분석을 위하여 도열병 밭못자리 검정을 실시하였다. 밭못자리 검정포장은 국립식량과학원 전주 검정포장에서 2018~2020년까지 조사하였다. 전주 검정포장의 시비량은 N-P2O5-K2O=21-17-17 kg/10a 수준으로 시비하였고, 질소 비료는 기비로 80%, 종자 파종 후 12일과 20일에 각각 10% 추비하여 도열병 발생 유도 환경을 조성하였다. 종자 파종 후 30일경부터 조사하여 감수성 비교품종인 호평벼의 이병성이 7이상이 되는 시기부터 조사하였다. 이병성 평가 기준은 국제벼연구소(IRRI)의 표준평가 기준에 따라 전형적인 도열병 잎 병반이 전혀 없는 0에서 식물체가 고사한 상태의 9까지 달관조사를 실시하였다(IRRI 1996). 이병성 정도가 0~3은 저항성 품종으로 4~6은 중도저항성, 7~9는 감수성 계통으로 분류하였다.

도열병 저항성 관련 유전자형 조사

벼품종의 DNA는 종자 파종 후 20일 정도된 유식물체로부터 BioSprint 96 (Qiagen Co., Germany)을 이용하여 추출하였다. 국내 벼품종에서 도열병 저항성 유전자형을 분석하기 위하여 기존에 보고된 Pit, Pi35, Pib, Piz, Pi9, Pigm, Pi40, Piz-t/Piz-5, Pizt, Pi2/Piz-5, Pi9/Pi2, Pi13, Pia, Pi54, Pi1, Pik, Pita, Pi20, Pta-2의 유전자 또는 유전자좌와 연관된 27개의 DNA 마커를 이용하였다(Table 1). PCR은 추출된 DNA 10 ng을 10 pmol primers, 1.5 mM MgCl2, 0.2 mM dNTP와 1 U의 Taq polymerase (Inclone, Yongin, Korea)을 총 20 uL 용량으로 반응시켰다. PCR 조건은 95℃에서 5분 denaturing 후, 95℃에서 30초, 55℃ 또는 60℃에서 30초, 72도에서 1분간 35회 반복 반응시키고 72℃에서 10분 처리하였다. PCR 생성물 1~2 uL는 ZAG DNA Analyzer (Agilent Technologies, Inc, USA)로 전기영동하여 유전자형을 분석하였다. 기존에 보고된 DNA 마커 정보를 활용하여 저항성 유전자형의 PCR 생성물 크기(bp)를 기준으로 이와 같은 경우 저항성 유전자형(R-allele type)으로 이외의 크기일 경우 감수성 유전자형(S-allele type)으로 조사하였다(Table 1).

Table 1

List of 27 DNA markers used for blast resistance genes.

Gene Chr. Marker Primer sequence Size (bp) Reference
Pit 1 Pit-ID003 For-seq CCTGAAACACATTATCTATGTTG 190 Kitazawa et al. 2019
Rev-seq AGAAAGAAGCATAAGTTTAAAATAGA
Pit 1 tdDN For-seq GGAAAAATAGAGTCAAACCGCC 142 Hayashi et al. 2010Wu et al. 2015
Rev-seq CCTTTCGATGTTTTTTCTATATAAGC
Pi35 1 Pish-ID010 For-seq TGCTACATATATATGATAATTGTCGAGG 81 Kitazawa et al. 2019
Rev-seq TCAATCTACACCGTTAGATCAT
Pib 2 Pib-ID11 For-seq AGAGTGGTTGGTTGGAGGTG 92 Kitazawa et al. 2019
Rev-seq GCCCATATTGCTTTGCTCCAAA
Pib 2 Pibdom For-seq GAACAATGCCCAAACTTGAGA 365 Fjellstrom et al. 2004
Rev-seq GGGTCCACATGTCAGTGAGC
Pib 2 Lys145 For-seq TCGGTGCCTCGGTAGTCAGT 803(susceptible pib allele) Wu et al. 2017
Rev-seq GGGAAGCGGATCCTAGGTCT
Piz 6 Piz-ID18 For-seq CTGCTGCTACCGTTTGGAAGTCA 84 Kitazawa et al. 2019
Rev-seq CTCCTGGCCCCACGCGTC
Pi9 6 F9 For-seq TGATTATGTTTTTTATGTGGGG 111(Pi2/Piz-t allele) Qu et al. 2006
Rev-seq ATTAGTGAGATCCATTGTTCC
Pigm 6 S29742 For-seq CAGTGAAACGAACGCTATG 555 Deng et al. 2006
Rev-seq AATAGGAAGGGTTGATGTTG
Pi40 6 9871.T7E For-seq CCATCCCATCTGAAACCATGC 300 (Mlu CI) Jeung et al. 2007
Rev-seq CCCCCAGGTCGTGATACCTTC
Piz-t/Piz-5 6 Piz-ID31 For-seq CCAATTTCAGGCTTAGTTTGAT 84 Kitazawa et al. 2019
Rev-seq AGCTATTTATTAAGCTGATTTCTCA
Pizt 6 M-pi2 For-seq CAGCGATGGTATGAGCACAA 470 Feng et al. 2013
Rev-seq CGTTCCTATACTGCCACATCG
Pigm 6 ZJ58.7-6 For-seq ACTTGCTGGGAGAAGGATT 210 Yu et al. 2013
Rev-seq AGTTCGTACTTTTCAGGCT
Pi2/Piz-5 6 AP22 For-seq GTGCATGAGTCCAGCTCAAA 140 Zhu et al. 2012
Rev-seq GTGTACTCCCATGGCTGCTC
Pi9/Pi2 6 R2123 For-seq GGTGCCTCCTTCCATATGCCAGCA 229 (Hinf I) Zhou et al. 2006Tacconi et al. 2010
Rev-seq TGCAGCACAAGTTATCAGCTTGGCGACT
Pi13 6 Pi13-ID008 For-seq GTGAGCTGGAATACTAGATCGA 88 Kitazawa et al. 2019
Rev-seq GTCAAAGTTCCTGCAATTTTGTGA
Pia 11 PiaSTS For-seq CTTTTGAGCTTGATTGGTCTGC 120 Okuyama et al. 2011
Rev-seq CTATTGCACCAGAGGGACCAG
Pia 11 Pia-ID01_2 For-seq ACGGTAGAGCAATTTAGAAGCAGTGA 152 Kitazawa et al. 2019
Rev-seq AGTGCGACTGACACTTTCAATAGCA
Pi54 11 Pikh-1 For-seq CAATCTCCAAAGTTTTCAGG 216 Ramkumar et al. 2011
Rev-seq GCTTCAATCACTGCTAGACC
Pi1 11 RM224 For-seq ATCGATCGATCTTCACGAGG 139 (Pi-Kh allele)120 (Piks allele) Anushree et al. 2016
Rev-seq TGCTATAAAAGGCATTCGGG
Pik 11 Pik-ID007 For-seq AACGAATATTTATGACTAAAGAAAGT 120 Kitazawa et al. 2019
Rev-seq AGAAGCTTGACTCCGTTAG
Pik 11 Pik-ID018 For-seq ATCCTCTGTGTCTGAAGCCAT 110 (Pik, Pik-m, Pik-p, Pik-s, Pik-h, Pi7, or Pi1 allele) Kitazawa et al. 2019
Rev-seq AGGCTTCTCTGCTCCTATAACA
Pik 11 Pik-ID014 For-seq TTCTTCTTTATCCCGTCTTCTT 149, 150 (Pik-m, Pik-s, or Pi1 allele) Kitazawa et al. 2019
Rev-seq ATGAGGAAAACGAAGATGAGAG
Pita 12 YL155/YL87 For-seq AGCAGGTTATAAGCTAGGCC 1042 (Pita allele) Jia et al. 2004
Rev-seq CTACCAACAAGTTCATCAAA
Pita 12 YL183/YL87 For-seq AGCAGGTTATAAGCTAGCTAT 1042 (susceptible pita allele) Jia et al. 2004
Rev-seq CTACCAACAAGTTCATCAAA
Pi20 12 Pita-2-ID009 For-seq CACATAGCATTAGAGCACTAAACT 114 (Pi20 allele) Kitazawa et al. 2019
Rev-seq AACCATCATACCGGCCTATTTA
Pita-2 12 Pita-2-ID016_3 For-seq AAAGTTCATCGCATCGAATTTA 123 (Pita-2 allele) Kitazawa et al. 2019
Rev-seq ACACGCGTTGGGATCTTCCTC


통계분석

통계분석은 Jamovi (Version 2.3.18, 2022, the jamovi project, https://www.jamovi.org) 통계프로그램과 Excel (Microsoft Co., USA)을 사용하였다. 도열병 이병성 평가 결과(0~9)를 관측치로 사용하여 연차간 비교를 위한 상관분석, 유전자형 이나 생태형 그룹간 이병성 비교를 위하여 ANOVA, T-test, Tukey's test을 실시하였다.

결과 및 고찰

국내 296 벼품종의 도열병 저항성 분석

국내 벼 296개의 밭못자리 검정포장에서 2018~2020년까지 3년간 이병성 평가 결과는 Fig. 1a와 같다(Supplementary Table 1). 2018년의 이병성 정도의 평균은 4.9±2.3으로 중도저항성(4~6)을 보이는 품종의 분포가 높았다. 하지만 2019년은 이병성 정도가 평균 3.4±2.5로 저항성(1~3)에 포함되는 품종의 분포가 높았으며 2020년에는 평균이 6.0±2.2로 이병성(7~9) 분포가 높은 경향을 보였다. 이들 이병성 정도의 연차간 관계를 조사하기 위하여 연도별 상관분석을 실시한 결과, 모든 년도 사이의 상관계수는 0.64이상으로 유의한 상관관계를 보였다(Fig. 1b). 이러한 도열병 이병성 정도의 변화는 도열병 병균의 병원성 변화에 의한 것으로 추정된다. Kim et al. (2016)에 의하면 2014년에서 2015년까지 12개의 밭못자리 시험지에서 분리된 벼 도열병균을 한국형 판별품종 시스템으로 분류한 결과, 2014년 34종이었던 레이스가 2015년 51종으로 크게 변화함을 보고하였다. 이러한 결과는 빠른 도열병 균계 변화에 대응하여 매년 새로운 벼 도열병 저항성 품종 개발의 필요성을 뒷받침해준다.

Fig. 1. Frequency distribution of blast incidence degree at blast nursery test (a) and correlation analysis between incidence degree for each year (b) in 296 Korean rice varieties from 2018 to 2020.

벼 296개 품종의 3년간 도열병 이병성 정도를 벼의 생태형, 조만형으로 구분하여 비교하였다(Fig. 2). 벼 생태형에 따른 구분에서 자포니카형 품종 261개는 통일형 35개에 비하여 유의적으로 높은 이병성을 보였다(Fig. 2a). 조생 품종 86개는 중생 96개, 중만생 114개 품종보다 유의적으로 낮은 이병성 정도를 보였다(Fig. 2b). 이들 296 국내 벼 품종 중에서 3년간 지속적으로 저항성(1~3)의 이병성 정도를 보이는 품종을 29개 선발하였다(Supplementary Table 1). 이들 29개 품종 중에서 조생종은 14개, 중생은 12개, 중만생 품종은 3개였으며, 자포니카 17개 품종, 통일형 12개 품종의 분포를 보였다. 최근 8년 이내에 개발된 품종으로는 통일형인 미면과 새미면이 해당되며, 조생종으로 백일미, 단평, 운백찰이 3년간 지속적인 저항성을 보였다. 이중에서 백일미는 3년간 이병성 평균이 1.3±0.58로 296개 품종에서 가장 강한 저항성을 보였다. 백일미는 도열병에 강한 극조생 벼 품종으로 전국10개 밭못자리 검정포장에서 강한 저항성을 보이는 품종으로 개발되었다(Mo et al. 2019). 29개 품종의 생태형과 조만성을 보면 통일형이면서 중생종인 품종이 34.5%(10 품종), 자포니카형이면서 조생종인 계통이 48.3%(14 품종)를 차지하였다. 296개 전체 품종에서 생태형과 조만성에 따른 도열병 저항성을 비교한 결과 Fig. 2와 같다. 통일형 35개 벼 품종은 자포니카형 261개 벼 품종에 비하여 3년간 이병성 정도가 유의적으로 낮은 값을 보여 강한 저항성을 증명하였다(T-test, p<0.001) (Fig. 2a). 조만성에 따른 비교 결과를 보면, 조생종 86개 품종의 이병성 정도는 3년간 96개 중생종과 114개 중만생종의 이병성과는 높은 유의적 차이를 보였다(Fig. 2b). 이렇게 강한 도열병 저항성을 보이는 대표 조생 품종 중에는 도열병 이외에도 흰잎마름병, 줄무늬잎마름병에 모두 강한 저항성을 보이는 조평과 조일이 보고되었다(Nam et al. 2013, 2018). 본 실험에서도 이 두 품종은 3년간 이병성 평균값이 2.7로 강한 저항성을 보였다(Supplementary Table 1). 통일형 벼 품종은 조생 품종들에 비하여 더 강한 도열병 저항성을 보이지만(Fig. 2), 수량이 높은 통일형 품종은 일반 밥쌀용벼에 비하여 밥맛이 낮은 단점이 있어 가공적성 품종 개발로 육종 목표 전환되면서 가공용벼 품종(다산 1호, 다산2호, 미면, 새미면, 한강찰1호 등)이 대부분으로 활용에 한계가 있다(Cho et al. 2012).

Fig. 2. Box plots of blast incidence degree for two rice subgroups (a) and for rice varieties in different maturing type (b), for three years. Different lowercase letters above the box plots indicate a significant difference according to Tukey’s multiple comparisons (p<0.001).

본 연구는 국내 주요 벼품종 296개의 도열병 저항성 검정을 3년간 지속적 조사하여 국내 벼의 도열병 저항성 정도를 알 수 있는 기초적 데이터를 구축하였다(Supplementary Table 1). 이를 활용하여 생태형, 조만성에 맞는 교배친을 선정하여 육종 효율을 증진하거거나 내구 저항성 품종 육성을 할 수 있다.

도열병 저항성 유전자형 분석

국내 벼 품종의 3년간 저항성 조사를 통하여 강한 저항성의 생태형, 조만형과 안정적인 저항성을 보이는 품종들을 관찰하였다. 이들의 저항성을 조절하는 유전자 탐색을 위하여 주요 19개 유전자에 대한 27개 DNA 마커를 선발하였다(Table 1). 최근까지 118개의 잎 도열병 저항성 유전자가 동정되었고 이중 25개는 클로닝을 통한 특성검정까지 완료되었으며 이들 유전자의 연관마커 또는 근접마커도 많이 보고되었다(Kalia & Rathour 2019). 본 연구에서 사용된 도열병 연관 DNA 마커는 이전에 벼 유전자원 또는 품종의 주요 저항성 유전자 탐색 및 다양성 조사에서 사용된 것을 참고하여 선발하였다(Wu et al. 2015, Kitazawa et al. 2019, Yadav et al. 2019, Baek et al. 2021). Wu et al. (2015)의 연구에서는 중국 대표 우량품종들의 양친 277 품종의 18개 저항성 유전자형을 DNA 마커로 조사하였다. Kitazawa et al. (2019) 는 24개 도열병 저항성 유전자에서 저항성 품종 및 단인자 계통의 염기서열 분석을 통하여 96개의 SNP 마커를 제작하여 활용하였다. 국내 연구에서도 18개 도열병 저항성 유전자의 44개 DNA 마커를 사용하여 33개 국내 우량 벼 품종의 11년간 이병성 결과로 품종별 저항성 유전자를 제시하였다(Baek et al. 2021).

본 연구에서 수행한 국내 벼 296개의 27개 마커 분석결과는 Supplementary Table 2와 같다. 기존에 보고된 DNA 마커 정보를 참고하여 저항성 품종이나 자원과 PCR 생성물 크기(bp)가 같은 경우만 저항성 유전자를 보유하는 (R-allele type, + 표기)것으로 조사하였다. 그 결과, 27개 마커 중 품종당 유전자 보유 개수는 최소 4개에서 최대 15개 범위를 보였다. 저항성 유전자형을 14개~15개 보유한 품종은 총 11 품종으로 7개(64%)가 조생형으로 오봉벼, 금오3호, 황금보라, 조광, 설백, 조품, 새상주가 포함된다. 이 품종의 3년간 이병성 평균은 오봉벼(7)와 황금보라(6)를 제외하고 모두 2~3으로 강한 저항성을 보인다. 반대로 저항성 유전자형을 최소 4개에서 6개까지 보유한 품종은 총 11품종으로 대부분 화성벼, 남평벼, 보석찰, 동진찰, 목양, 녹우와 같은 중생 또는 중만생 품종 8개가 포함된다. 이들의 이병성 평균은 4~8로 중도저항성 또는 감수성을 보였다.

도열병 저항성 유전자형과 표현형(이병성 정도의 3년 평균값) 사이의 연관분석 결과 Table 2와 같다. 27개 DNA 마커 중에서 Pit 유전자의 Pit-ID003와tdDN에서 각각 R형과 S형의 유전자형을 보유한 품종이 없었고 이외에도 Pish-ID010, Pibdom, AP22, Pi13-ID008에서도 R 또는 S유전자형의 개체가 1개이거나 존재하지 않아 비교분석이 불가능하였다. 연관분석 결과, 표현형과 유전자형이 p<0.001의 유의수준에서 연관되어 있다고 선발된 마커는 11개 유전자의 12개 마커이다. 이들 12개 마커 중에서 Piz-ID18, F9, 9871.T7E, Piz-ID31, M-pi2, PZJ58.7-6, Pi9/Pi2 의 7개 마커는 모두 염색체 6번 단완에 위치하는 multiple-gene family 구간에 존재한다. 나머지 유의성을 보이는 4개 마커는 모두 12번 염색체에 존재하는 YL155/YL87, YL183/YL87, Pita-2-ID009, Pita-2-ID016_3로 Pita 유전자 그룹에 포함되었다. Pi35 유전자에서는 1개 품종, 백일미에서만 저항성 유전자형을 보였다. 이는 백일미와 고시히카리 교배집단으로 염색체 1번에서 도열병 저항성 QTL, qBL1.1이 탐지되었고 Pish/Pi35 유전자를 포함하는 유전자좌라는 결과와 일치한다(Ha et al. 2020). Pik 유전자의 Pik-ID007, Pik-ID018, Pik-ID014 마커는 유의적인 연관관계를 보이지 않았다. 이러한 결과는 Baek et al. (2021)이 국내 우수품종 33개에서 Pik-multiple family 유전자좌의 유전자들은 우리나라 도열병 균계에 저항성 효과를 보이지 못한다는 결과와 일치한다.

Table 2

Summary of association analyses between DNA marker genotypes and mean of disease incidence degree at blast nursery test.

Gene Maker Chr. Map positionz(Mb) No. of varieties Px R2(%)
R-allele typey S-allele type Missing
Pit Pit-ID003 1 2.67 0 294 2 - -
Pit tdDN 1 2.68 295 0 1 - -
Pi35 Pish-ID010 1 33.21 1 293 2 - -
Pib Pib-ID11 2 35.09 166 128 2 0.20 0.6
Pib Pibdom 2 No hits 296 0 0 - -
Pib Lys145 2 35.11 167 129 0 0.06 1.2
Piz Piz-ID18 6 10.35 48 246 2 <0.001 14.7
Pi9 F9 6 10.38 8 283 5 <0.001 4.6
Pigm S29742 6 10.38 142 146 8 0.78 0
Pi40 9871.T7E 6 10.38 60 211 25 <0.001 24.7
Piz-t/Piz-5 Piz-ID31 6 10.43 8 287 1 <0.001 4.4
Pizt M-pi2 6 10.47 8 286 2 <0.001 4.4
Pigm ZJ58.7-6 6 10.48 210 84 2 <0.001 9.7
Pi2/Piz-5 AP22 6 10.87 296 0 0 - -
Pi9/Pi2 R2123 6 11.67 24 271 1 <0.001 14.7
Pi13 Pi13-ID008 6 17.12 0 296 0 - -
Pia PiaSTS 11 6.54 135 160 1 0.01 2.4
Pia Pia-ID01_2 11 6.54 137 155 4 0.02 2.1
Pi54 Pikh-1 11 25.26 178 105 15 0.01 2.6
Pi1 RM224 11 27.67 217 78 1 <0.001 7.9
Pik Pik-ID007 11 27.8 23 86 187 0.11 1.5
Pik Pik-ID018 11 27.9 243 50 3 0.35 0.2
Pik Pik-ID014 11 No hits 66 188 42 0.08 1.7
Pita YL155/YL87 12 10.61 75 218 3 <0.001 11.2
Pita YL183/YL87 12 10.61 66 227 3 <0.001 12.1
Pi20 Pita-2-ID009 12 10.81 25 270 1 <0.001 15.5
Pita-2 Pita-2-ID016_3 12 10.83 55 236 5 <0.001 14.3

zThe physical position of DNA marker in Nipponbare sequence (Os-Nipponbare-Reference-IRGSP 1.0.).

yNo. of varieties having R- and S-allele type on each marker. The S-allele type means varieties having genotypes that differ from R-allele type. Missing types means varieties having not PCR amplification in each markers.

xT-test results between two group, R-allele type and S-allele type.



도열병 저항성과 유의적으로 연관된 12개 마커와 표현형 간의 R2 값을 비교해 보면, Pi40의 987.T7E 마커의 R2 값이 가장 높은 24.7%였고 F9에서 가장 낮은 4.6%를 보였다. 이 중에서 R2 값이 10% 이상을 보이는 Piz-ID18, 9871.T7E, R2123, YL155/YL87, YL183/YL87, Pita-2-ID009, Pita-2-ID016_3의 이병성 정도를 3년 각각에서 유전자형별로 나누어 비교하였다(Fig. 3). 7개 모든 유전자형에서 연차별 상관없이 R 유전자형과 S 유전자형의 이병성 정도는 유의적으로 차이를 보였다(T-test, p<0.001). 저항성 유전자 Pi40 마커(987.T7E)는 가장 높은 R2 값(24.7%)과 모든 연차에서 R과 S 유전자형 간의 이병성에서 유의적인 차이를 보였다. 이 결과는 Pi40 유전자가 국내 296품종의 밭못자리 잎도열병 저항성과 가장 높은 연관성을 보인다는 결론을 도출한다. Pi40 유전자가 도열병 저항성이 강한 조생 품종과 통일형 품종에서는 어느 정도의 비율을 차지하는지 확인하였다(Fig. 4). Pi40 유전자를 보유한 품종들에서 조생 품종이 차지하는 비율은 87%로 가장 높았고 중생 품종이 10%, 중만생 품종이 3.3%를 차지하였다(Fig. 4a). 생태형에 따른 비율을 살펴보면, Pi40 유전자를 보유한 품종들과 그렇지 않은 품종들 간의 자포니카 비율은 각각 91.7%와 97.2%로 큰 차이를 보이지 않았다. 이들 결과는 이전 연구에서 조생 품종인 조평, 해담쌀, 해들은 염색체 6번의 Piz/Piz-t, Pi9, Pi40 전체 유전자좌를 보유하는 것으로 확인했다는 보고와 일치한다(Baek et al. 2021). 본 연구결과는 국내 조생종의 강한 도열병 저항성은 Pi40 유전자의 영향에 의한 것임을 보였다.

Fig. 3. Comparison of blast incidence degree between varieties harboring R allele or S allele in blast resistance gene for three years. Each column represents the mean of blast incidence±SD.
Fig. 4. The proportion of rice maturing groups (a) and of rice two subgroups (b) in each R-allele type and S-allele type by Pi40 gene genotype using DNA marker (9871.T7E).
적 요

본 논문은 전주 잎도열병 밭못자리 시험포장에서 2018~2020년까지 국내 벼 296개 품종의 도열병 이병성 정도를 검정하였다. 국내 벼 품종의 통일형은 자포니카 품종에 비하여 강한 저항성을 보이고 조생종은 중생과 중만생종에 비하여 강한 저항성을 보였다. 최근 8년 이내에 육성된 품종 중에서 3년간 도열병 검정에서 강한 저항성을 보인 품종은 통일형 미면과 새미며, 조생종의 백일미 단평, 운백찰이다. 이중 백일미는 3년간 이병성 평균이 1.3으로 가장 강한 저항성을 보였다. 도열병 저항성 유전자의 연관/완전 DNA 마커 27개의 유전형과 도열병 저항성 사이의 연관분석한 결과, Piz, Pi9, Pi40, Piz-t/Piz-5, Pigm, Pi9/Pi2 등 multiple gene family 포함 유전자좌가 가장 유의한 연관관계를 보였다. 이 중에서 Pi40 유전자는 국내 조생 품종의 도열병 저항성과 강력히 연관된 것으로 보인다. 본 연구에서 조사된 국내 육성 품종의 이병성 정도, 유전형과 마커의 영향력에 관한 정보는 저항성 품종 육성에 효과적으로 활용 가능할 것이다.

보충자료

본문의 Supplementary Tables 1, 2는 한국육종학회지 홈페이지에서 확인할 수 있습니다.

사 사

본 논문은 농촌진흥청 연구사업(과제번호: PJ01683002)의 지원에 의하여 이루어졌다.

Supplementary information
Supplementary File
References
  1. Anushree PU, Naik RM, Satbhai RD, Gaikwad AP, Nimbalkar CA. 2016. Differential biochemical response of rice (Oryza sativa L.) genotypes against rice blast (Magnaporthe oryzae). Cogent Bio 2: 1264162.
    CrossRef
  2. Baek MK, Park HS, Lee CM, Lee HJ, Jeong JM, Ahn EK, Hyun WJ, Lee JY, Jeong OY, Jeung JU, Lee JH, Cho YC. 2021. Identification of stable resistance genes based on resistance evaluation to blast for monogenic lines and leading japonica varieties in rice. Korean J Breed Sci 53: 217-229.
    CrossRef
  3. Cho JH, Park NB, Song YC, Yeo US, Ha UG, Jung KH, Lee JY, Lee JH, Kim CS, Kwak DY, Kim SY, Yi G, Oh SH, Kang HW, Ahn JG. 2012. 'Saegyejinmi': Multiple disease resistance and mid-late maturing tongil type rice cultivar. Korea J Bree Sci 44: 611-616.
    CrossRef
  4. Deng Y, Zhu X, Shen Y, He Z. 2006. Genetic characterization and fine mapping of the blast resistance locus Pigm(t) tightly linked to Pi2 and Pi9 in a broad-spectrum resistant Chinese variety. Theor Appl Genet 113: 705-713.
    Pubmed CrossRef
  5. Feng H, Yang C, Wu X, Liu Y, Peng Y. 2013. Detection and analysis of rice blast resistance gene in some hybrid rice parents and 32 resistant materials of Sichuan province. Southwest China J Agric Sci 26: 987-993. (in Chinese with English abstract).
  6. Fjellstrom R, Conaway-Bormans CA, McClung AM, Marchetti MA, Shank AR, Park WD. 2004. Development of DNA markers suitable for marker assisted selection of three Pi genes conferring resistance to multiple Pyricularia grisea pathotypes. Crop Sci 44: 1790-1798.
    CrossRef
  7. Ha SK, Jeung JU, Jeong JM, Kim J, Mo Y. 2020. Genetic and agronomic analysis of a recombinant inbred line population to map quantitative trait loci for blast resistance and select promising lines in rice. Korean J Crop Sci 65: 172-181.
  8. Han SS, Ryu JD, Shim HS, Lee SW, Hong YK, Cha KH. 2001. Breakdown of resistant cultivars by new race KI-1117a and race distribution of rice blast fungus during 1999~2000 in Korea. Res Plant Dis 7: 86-92.
  9. Hayashi K, Yasuda N, Fujita Y, Koizumi S, Yoshida H. 2010. Identification of the blast resistance gene Pit in rice cultivars using functional markers. Theor Appl Genet 121: 1357-1367.
    Pubmed CrossRef
  10. Hur YJ, Jeung JU, Kim SY, Park HS, Cho JH, Lee JY, Sohn YB, Song YC, Park DS, Lee CW, Sohn JG, Nam MH, Lee JH. 2013. Functional markers for bacterial blight resistance gene Xa3 in rice. Mol Breed 31: 981-985.
    CrossRef
  11. International Rice Research Institute(IRRI). 1996. Standard evaluation system for rice. 4th ed. IRRI, Manila, Philippines.
    CrossRef
  12. Jia Y, Wang Z, Fjellstrom RG, Moldenhauer KAK, Azam MA, Correll J, Lee FN, Xia Y, Rutger JN. 2004. Rice Pi-ta gene confers resistance to the major pathotypes of the rice blast fungus in the United States. Phytopathology 94: 296-301.
    Pubmed CrossRef
  13. Jeong HK, Kim CG, Moon DH. 2014. An analysis of impacts of climate change on rice damage occurrence by insect pests and disease. Korean J Environ Agric 33: 52-56.
    CrossRef
  14. Jeung JU, Kim BR, Cho YC, Han SS, Moon HP, Lee YT, Jena KK. 2007. A novel gene, Pi40(t), linked to the DNA markers derived from NBS-LRR motifs confers broad spectrum of blast resistance in rice. Theor Appl Genet 115: 1163-1177.
    Pubmed CrossRef
  15. Kalia S, Rathour R. 2019. Current status on mapping of genes for resistance to leaf- and neck-blast disease in rice. 3 Biotech 9: 209.
    Pubmed KoreaMed CrossRef
  16. Kang WS, Seo MC, Hong SJ, Lee KJ, Lee YH. 2019. Outbreak of rice panicle blast in southern provinces of Korea in 2014. Res Plant Dis 25: 196-204.
    CrossRef
  17. Kim Y, Go J, Kang IJ, Shim HK, Shin DB, Heu S, Roh JH. 2016. Distribution of rice blast disease and pathotype analysis in 2014 and 2015 in Korea. Res Plant Dis 22: 264-268.
    CrossRef
  18. Kitazawa N, Shomura A, Mizubayashi T, Ando T, Nagata K, Hayashi N, Takahashi A, Yamanouchi U, Fukuoka S. 2019. Rapid DNA-genotyping system targeting ten loci for resistance to blast disease in rice. Breed Sci 69: 68-83.
    Pubmed KoreaMed CrossRef
  19. Kwon T, Lee JH, Park SK, Hwang UH, Cho JH, Kwak DY, Youn YN, Yeo US, Song YC, Nam J, Kang HW, Nam MH, Park DS. 2012. Fine mapping and identification of candidate rice genes associated with qSTV11SG, a major QTL for rice stripe disease resistance. Theor Appl Genet 125: 1033-1046.
    Pubmed CrossRef
  20. Lee EW, Park SZ. 1979. Interpretation on the epidemic outbreak of rice blast disease in Korea, 1978. J Korean Soc Crop Sci 24: 1-10.
  21. Lee YH, Ra DS, Yeh WH, Choi HW, Myung IS, Lee SW, Lee YH, Han SS, Shim HS. 2010. Survey of major disease incidence of rice in Korea during 1999-2008. Res Plant Dis 16: 183-190.
    CrossRef
  22. Mo Y, Jeong JM, Kim WJ, Kim BK, Jeung JU. 2019. 'Baegilmi', an extremely early maturing blast resistant rice with good grain appearance. Korean J Breed Sci 51: 151-159.
    CrossRef
  23. Nam JK, Ko JK, Kim KY, Kim BK, Kim WJ, Ha KY, Shin MS, Ko JC, Kang HJ, Park HS, Baek MK, Shin WC, Mo YJ, Choi IB, Kim YD, Yang HS, Kim JG. 2013. A new early-maturing rice with blast, bacterial blight, rice stripe virus resistant and high grain quality, 'Jopyeong'. Korean J Breed Sci 45: 177-182.
    CrossRef
  24. Nam JK, Park HS, Kim KY, Kim BK, Cho YC, Ko JK, Baek MK, Kim JJ, Kim WJ, Shin WC, Ko JC, Lee JH, Jeong JM, Jeung JU, Kang KH. 2018. Multiple disease resistant early maturing rice cultivar 'Joil' with high grain quality adaptable to early transplanting cultivation in the southern plain area. Korea J Breed Sci 50: 280-288.
    CrossRef
  25. Okuyama Y, Kanzaki H, Abe A, Yoshida K, Tamiru M, Saitoh H, Fujibe T, Matsumura H, Shenton M, Galam DC, Undan J, Ito A, Sone T, Terauchi R. 2011. A multifaceted genomics approach allows the isolation of the rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant J 66: 467-479.
    Pubmed CrossRef
  26. Qu S, Liu G, Zhou B, Bellizzi M, Zeng L, Dai L, Han B, Wang GL. 2006. The broad-spectrum blast resistance gene Pi9 encodes a nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in rice. Genetics 172: 1901-1914.
    Pubmed KoreaMed CrossRef
  27. Ra DS, Oh JH, Han SS, Kim CK. 1995. Temporal and spatial blast incidence in new cultivars and elite lines of rice in Korea(III). Korean J Plant Pathol 11: 338-343.
  28. Ramkumar G, Srinivasarao K, Mohan KM, Sudarshan I, Sivaranjani AKP, Gopalakrishna K, Neeraja CN, Balachandran SM, Sundaram RM, Prasad MS, Rani NS, Prasad AMR, Viraktamath BC, Madhav MS. 2011. Development and validation of functional marker targeting an InDel in the major rice blast disease resistance gene Pi54 (Pikh). Mol Breed 27: 129-135.
    CrossRef
  29. Shim HS, Kim YK, Han SS, Sung JM. 2003. Assessments of rice yield loss according to infection time of neck blast. Res Plant Dis 9: 68-71.
    CrossRef
  30. Skamnioti P, Gurr SJ. 2009. Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol 27: 141-150.
    Pubmed CrossRef
  31. Tacconi G, Baldassarre V, Lanzanova C, Faivre-Rampant O, Cavigiolo S, Urso S, Lupotto E, Vale G. 2010. Polymorphism analysis of genomic regions associated with broad-spectrum effective blast resistance genes for marker development in rice. Mol Breed 26: 595-617.
    CrossRef
  32. Wu Y, Xiao N, Yu L, Pan C, Li Y, Zhang X, Liu G, Dai Z, Pan X, Li A. 2015. Combination patterns of major R genes determine the level of resistance to the M. oryzae in rice (Oryza sativa L.). Plos One 10: e0126130.
    Pubmed KoreaMed CrossRef
  33. Wu Y, Yu L, Xiao N, Dai Z, Li Y, Pan C, Zhang X, Liu G, Li A. 2017. Characterization and evaluation of rice blast resistance of Chinese indica hybrid rice parental lines. Crop J 5: 509-517.
    CrossRef
  34. Yadav MK, Aravindan S, Ngangkham U, Raghu S, Prabhukarthikeyan SR, Keerthana U, Marndi BC, Adak T, Munda S, Deshmukh R, Pramesh D, Samantaray S, Rath PC. 2019. Blast resistance in Indian rice landraces: genetic dissection by gene specific markers. Plos One 14: e0211061.
    Pubmed KoreaMed CrossRef
  35. Yu MM, Dai ZY, Pan CH, Chen XJ, Yu L, Zhang XX. 2013. Resistance spectrum difference between two broad-spectrum blast resistance genes, Pigm and Pi2, and their interaction effect on Pi1. Acta Agron Sin 39: 1927-1934.
    CrossRef
  36. Zhou B, Qu S, Liu G, Dolan M, Sakai H, Lu G, Bellizzi M, Wang G-L. 2006. The eight amino-acid differences within three leucine-rich repeats between Pi2 and Piz-t resistance proteins determine the resistance specificity to Magnaporthe grisea. MPMI 19: 1216-1228.
    Pubmed CrossRef
  37. Zhu X, Chen S, Yang J, Zhou S, Zeng L, Han J, Su J, Wang L, Pan Q. 2012. The identification of Pi50(t), a new member of the rice blast resistance Pi2/Pi9 multigene family. Theor Appl Genet 124: 1295-1304.
    Pubmed CrossRef


December 2022, 54 (4)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Funding Information