Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

자포니카 벼 입형 다양화 육종소재 개발 및 특성 분석

Development and Characterization of Breeding Materials with Diverse Grain Size and Shape in japonica Rice

Korean Journal of Breeding Science 2017;49(4):369-389.
Published online: November 30, 2017

National Institute of Crop Science, RDA, Wanju, 55365, Korea

*Corresponding author : (mayoe@korea.kr), +82-63-238-5216, +82-63-238-5205
• Received: September 25, 2017   • Accepted: November 7, 2017

© Korean Society of Breeding Science. All rights reserved.

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 267 Views
  • 0 Download
  • 11 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Mid-Late Maturing Japonica Rice Cultivar ‘JJ625LG’ with Long and Spindle-Shaped Grains
    Hyun-Su Park, Man-Kee Baek, Jung-Pil Suh, O-Young Jeong, Chang-Min Lee, Choon-Song Kim, Ji-Ung Jeung, Woo-Jae Kim, Jong-Min Jeong, Youngjun Mo, Su-Keyong Ha, Hyun Gu Choi, Seul-Gi Park, Mina Jin, Jae-Ryoung Park, Jeonghwan Seo, Songhee Park
    Korean Journal of Breeding Science.2025; 57(3): 301.     CrossRef
  • QTL Analysis for Yield and Grain-Related Traits Using the Recombinant Inbred Lines Derived from a Cross between ‘Boramchan’ and ‘Pecos’
    Hyun-Su Park, Chang-Min Lee, Jeonghwan Seo, Songhee Park, Keon-Mi Lee, Jae-Ryoung Park, O-Young Jeong
    Korean Journal of Breeding Science.2025; 57(2): 131.     CrossRef
  • ‘Amissal’: A Region-specific, Mid-late Maturing Long-grain Japonica Rice Cultivar
    Hyun-Su Park, Chang-Min Lee, Ki-Young Kim, O-Young Jeong, Ji-Ung Jeung, Su-Keyong Ha, Sang-Chul Park, Sang-Hyeok Lee, Jung-Pil Suh, Mina Jin, Hyun-Sook Lee, Jeonghwan Seo, Songhee Park, Jae-Ryoung Park, Kyeongmin Kang
    Korean Journal of Breeding Science.2025; 57(4): 547.     CrossRef
  • Analysis of Yield- and Quality-Related Traits of Risotto Rice Varieties in a Korean Environment
    Songhee Park, Jeonghwan Seo, Chang-Min Lee, Jae-Ryoung Park, Keonmi Lee, O-Young Jeong, Youngjun Mo, Hyun-Su Park
    Korean Journal of Breeding Science.2025; 57(1): 13.     CrossRef
  • Analysis of Agricultural Traits of O. sativa and O. glaberrima under Korean Climatic Conditions
    Jae-Ryoung Park, Hyun-Su Park, Jeonghwan Seo, Chang-Min Lee, Songhee Park, Mina Jin, Keon Mi Lee, Keunpyo Lee, Sukyeung Lee, Ebrima Jallow, O-Young Jeong
    Korean Journal of Breeding Science.2024; 56(2): 97.     CrossRef
  • Application of a Novel Quantitative Trait Locus Combination to Improve Grain Shape without Yield Loss in Rice (Oryza sativa L. spp. japonica)
    Hyun-Su Park, Chang-Min Lee, Man-Kee Baek, O-Young Jeong, Suk-Man Kim
    Plants.2023; 12(7): 1513.     CrossRef
  • QTL Analysis Related to Grain Size Using the Population Derived from a Cross Between Hopum and Basmati 370
    Da-Eun Im, Seong-Gyu Jang, Backki Kim, Jeonghwan Seo, D. S. Kishor, Hee-Jong Koh, Soon-Wook Kwon
    Korean Journal of Breeding Science.2023; 55(2): 118.     CrossRef
  • Characterization of Grain-Related Traits and Pasting and Texture Properties of United State Rice Varieties in Korea
    Jae-Ryoung Park, Chang-Min Lee, Man-Kee Baek, Ju Hyeon An, Jeonghwan Seo, Ha-Cheol Hong, O-Young Jeong, Hyun-Su Park
    Korean Journal of Breeding Science.2022; 54(2): 81.     CrossRef
  • Climatic yield potential of Japonica‐type rice in the Korean Peninsula under RCP scenarios using the ensemble of multi‐GCM and multi‐RCM chains
    Joong‐Bae Ahn, Young‐Hyun Kim, Kyo‐Moon Shim, Myoung‐Seok Suh, Dong‐Hyun Cha, Dong‐Kyou Lee, Song‐You Hong, Seung‐Ki Min, Seong‐Chan Park, Hyun‐Suk Kang
    International Journal of Climatology.2021;[Epub]     CrossRef
  • Development of Near-Isogenic Line of japonica Rice Cultivar Saenuri without Lipoxygenase-3
    Hyun-Su Park, Keon-Mi Lee, Ki-Young Kim, Jeong-Ju Kim, Woon-Cheol Shin, Man-Kee Baek, Choon-Song Kim, Seul-Gi Park, Chang-Min Lee, Jung-Pil Suh, Young-Chan Cho
    Korean Journal of Breeding Science.2019; 51(3): 190.     CrossRef
  • Development and Characterization ofjaponicaRice Line with Long and Spindle-shaped Grain
    Hyun-Su Park, Man-Kee Baek, Jeong-Kwon Nam, Woon-Cheol Shin, Gun-Mi Lee, Seul-Gi Park, Chang-Min Lee, Choon-Song Kim, Young-Chan Cho
    Korean Journal of Breeding Science.2018; 50(2): 116.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development and Characterization of Breeding Materials with Diverse Grain Size and Shape in japonica Rice
Korean. J. Breed. Sci.. 2017;49(4):369-389.   Published online December 1, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development and Characterization of Breeding Materials with Diverse Grain Size and Shape in japonica Rice
Korean. J. Breed. Sci.. 2017;49(4):369-389.   Published online December 1, 2017
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
Development and Characterization of Breeding Materials with Diverse Grain Size and Shape in japonica Rice
Image Image Image Image Image Image Image
Fig. 1 Image of rough rice of the parents.
Fig. 2 Cluster analysis of doubled haploid lines based on rough rice length, width, thickness, and ratio of length to width in 2013.
Fig. 3 Relationship among the traits (A) and lines (B) in the principal component analysis (PCA) diagram composed of component 1 and 2. GL, GW, GT, RLW, and TGW mean grain length, grain width, grain thickness, ration of length to width, and 1000-grain weight of rough rice, respectively. GLb, GWb, GTb, RLWb, and TGWb mean grain length, grain width, grain thickness, ration of length to width, and 1000-grain weight of brown rice, respectively.
Fig. 4 Distribution of the breeding materials and Korean rice cultivars using brown rice length and width. Korean rice cultivars were classified into japonica (blue round mark, n=264), black rice (brown x-mark, n=13), and Tongil-type (green triangle mark, n=32).
Fig. 5 PCR analysis to confirm the allele types of the breeding materials using gene specific DNA markers. GW2, GS3, and qSW5 were confirmed by PCR products amplified with primer, GW2-HpaⅠ (cleaved by Hpa Ⅰ, A), GS3-PstⅠ (Pst Ⅰ, B), and N1212del (C). DGS1: Deuraechan, 2: Boramchan, 3: Jizi1560, 4: Jizi1581, 5: Daeripbyeo 1, 6-96: the breeding materials.
Fig. 6 Comparison of the genetic effects of GW2, GS3, and qSW5 on grain length (A), grain width (B), grain thickness (C), ratio of length to width (D), and 1,000-grain weight (E). Gene symbols of small and capital letters indicate homozygote alleles with loss-of-function mutant type and function wild type of GW2, GS3, and qSW5, respectively. Solid bar and open bar indicate rough rice and brown rice, respectively. Comparison was carried out in each rough and brown rice by Duncan's multiple range test. Different letters over the bars indicate significant differences at p<0.05.
Fig. 7 Path analysis diagram for the influence of loss-of-function allele types of grain size-related genes GW2, GS3, and qSW5 on the grain and yield-related traits of rough (A) and brown rice (B). GL, GW, GT, TGW, NS, PN, and RRG mean grain length, grain width, grain thickness, 1,000-grains weight, number of spikelets per panicle, number of panicles per hill, and ratio of ripened grain, respectively. Continuous and dotted arrows indicate positive and negative effects, respectively. The arrow line thickness means proportion of the effect. ns, *, and ** indicate no significant, significant at 5 and 1% probability level, respectively.
Development and Characterization of Breeding Materials with Diverse Grain Size and Shape in japonica Rice

The information of markers used for the identification of grain-related genes, GW2, GS3, and qSW5.

Gene Chromosome Marker Sequence (5'-3') Product size (bp) Reference

GW2 2 GW2-HpaI F: CCAATAAAGATGTCCATTCTGTTA 23+151/174 Yan et al. 2009
R: GCTCTTCCTGTAACACATATTATG (dCAPS/Hpa I) Yan et al. 2011
GS3 3 GS3-PstI F: TATTTATTGGCTTGATTTCCTGTG 294+218/512 Yan et al. 2009
R: GCTGGTTTTTTACTTTCATTTGCC (CAPS/Pst I) Yan et al. 2011
qSW5 5 N1212del F: CGTCTTGCAACCAACGCCGATGTTATAC 759/1021/1971 Shomura et al. 2008
R: GAGCGTGTGTAGGGAAGGAGCTGCATGA (Indel) Yan et al. 2011

Anther culture ability of the crosses and doubled haploid lines used in this study.

Cross combination Anther cultured (no.) Cali induced (no. and %) Plant regeneration (no. and %)z Green plants (no. and %)y Albino (no. and %)x Doubled haploid (DH) lines (no.)w Selected DH lines (no.)v

Deuraechan/Jizi1560 10,700 6,280(58.7) 1241(19.8) 146(11.8) 1095(88.2) 99 88
Deuraechan/Jizi1581 11,600 2,780(24.0) 577(20.8) 110(18.8) 467(80.9) 105 70
Boramchan/Jizi1560 11,800 4,320(36.6) 817(18.9) 112(13.7) 705(86.3) 72 62
Boramchan/Jizi1581 6,300 4,380(69.5) 1184(27.0) 228(19.3) 956(80.7) 84 70
Total 360 290

zPercent plant regeneration is the number of plants regenerated over number of cali plated

yPercent green is the number of green plants regenerated over total plants regenerated

xPercent albino is the number of albino plants regenerated over total plants regenerated

wDouble haploid lines are harvested plants having fertile grain

vSelected DH lines are used in this study

Relationship between the grain-related traits of the doubled haploid lines (n=303).

Trait GW GT RLW TGW

GLz 0.330**y 0.285** 0.638** 0.789**
GW 0.817** -0.510** 0.658**
GT -0.399** 0.655**
RLW 0.174**

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

y** means significant at p<0.01

Grain-related and agronomic traits of the groups divided by cluster analysis in 2013.

Group n Rough rice HD (DAS) CL (cm) PL (cm) PN

GLz (mm) GW (mm) GT (mm) RLW TGW (g)

A A1 15 10.42by 4.08c 2.54cd 2.56c 46.0b 96bc 84abc 23bcde 9abcd
A2 25 9.76c 3.62efg 2.37fgh 2.70b 37.9def 97bc 80bc 24abc 8bcd
A3 13 9.69c 4.46b 2.68b 2.18f 43.3bc 104bc 80bc 23cde 8cd
Mean 53 9.93Cx 3.96B 2.49B 2.53B 41.5B 98B 81B 24AB 8B
C.V.(%) 53 3.9 9.8 6.4 9.5 11.5 11.2 13.8 10.1 24.7

B B1 24 8.70f 3.78ef 2.40efg 2.31de 35.0ef 96bc 83abc 23cde 9abcd
B2 36 8.79ef 4.10c 2.53cd 2.15f 37.7def 99bc 79bc 22cde 8abcd
B3 19 8.44g 4.21c 2.60bc 2.01g 37.1def 101bc 77bc 23cde 8abcd
B4 5 8.97e 4.52b 2.61bc 1.98gh 38.3de 105bc 72c 22cde 8bcd
B5 10 9.32d 4.15c 2.50cde 2.25ef 40.1cd 109b 89ab 26a 7d
B6 13 9.23d 3.81de 2.37fgh 2.43d 35.9ef 95bc 76bc 23cde 9abcd
Mean 107 8.82D 4.04B 2.49B 2.20C 37.0C 99B 80B 23B 8B
C.V.(%) 107 3.6 5.9 4.8 7.3 9.3 13.1 15.3 10.5 21.2

C C1 73 8.10h 4.01cd 2.53cd 2.03g 34.2f 97bc 75bc 22cde 9abcd
C2 1 7.59i 4.05c 2.42def 1.88h 30.2g 106b 80bc 20e 9abcd
C3 22 7.77i 3.63efg 2.34fgh 2.15f 29.3g 97bc 75bc 22cde 9abcd
C4 18 7.19j 3.59fg 2.34fgh 2.01g 27.0g 100bc 76bc 21de 10abc
C5 19 8.22gh 3.44gh 2.29ghi 2.40d 29.8g 105bc 83abc 23bcde 9abcd
C6 2 7.68i 3.16ij 2.09j 2.43d 23.5h 98cb 72c 21e 10abc
C7 3 8.80ef 3.30hi 2.20i 2.67bc 29.9g 109b 79bc 22cde 9abcd
Mean 138 7.95E 3.79B 2.43B 2.11C 31.6D 99B 76B 22B 9AB
C.V.(%) 138 5.0 7.9 5.8 8.5 11.7 10.1 11.8 8.7 17.8

D D 3 11.56aA 5.26aA 2.97aA 2.20efC 55.3aA 89cB 83abcAB 24abcdAB 8cdB
C.V.(%) 3 1.5 3.6 1.7 2.7 2.9 0.0 3.4 8.5 13.2

E E 2 10.60bB 3.07jC 2.27hiC 3.45aA 35.0eCD 125aA 95aA 26abA 11aA
C.V.(%) 2 4.8 1.6 2.6 3.2 1.2 0.0 3.3 0.8 41.7

Total Mean 303 8.66 3.91 2.47 2.23 35.5 99 78 23 9
C.V.(%) 303 10.2 9.0 6.1 11.7 16.0 12.1 13.8 10.2 20.7

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight, HD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill

yMeans with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

xCapital letters indicate statistic difference among main groups defined by culstering analysis

Grain-related traits of the breeding materials.

Group n Rough rice Brown rice

GLz (mm) GW (mm) GT (mm) RLW TGW (g) GL (mm) GW (mm) GT (mm) RLW TGW (g)

A A1 6 10.43by 4.19cd 2.57bc 2.49bc 47.1b 7.64b 3.42bcde 2.31abcd 2.24bc 39.8b
A2 10 9.49c 3.62ef 2.37def 2.63b 37.7de 7.04c 3.09fgh 2.14cdef 2.29b 32.9de
A3 8 9.53c 4.53bc 2.70b 2.12efg 45.2bc 6.81cd 3.60ab 2.41a 1.90def 37.5bc
Mean 24 9.74Bx 4.07B 2.53B 2.43B 42.6B 7.12B 3.34A 2.27AB 2.15BC 36.1B
C.V.(%) 24 4.7 11.6 7.0 10.9 11.6 5.5 8.6 6.5 10.4 9.6

B B1 6 8.88d 3.87de 2.37ef 2.30cde 35.2efg 6.39de 3.25cdef 2.18bcdef 1.97de 30.6def
B2 13 8.87d 4.18cd 2.56bcd 2.13defg 39.7de 6.32ef 3.49abcd 2.31abc 1.81efg 33.1de
B3 7 8.31e 4.23bcd 2.54bcde 1.97fg 37.1de 5.96fgh 3.57ab 2.35ab 1.67gh 31.5de
B4 4 8.79d 4.58b 2.70b 1.93g 41.5cd 6.15efg 3.72a 2.41a 1.66gh 34.1cd
B5 4 9.38c 4.24bcd 2.51bcde 2.22cdef 40.9d 6.81cd 3.51abc 2.22bcde 1.95de 34.0cd
B6 4 9.30c 3.94de 2.40cdef 2.63b 37.5de 6.77cd 3.23def 2.17bcdef 2.10bcd 31.5de
Mean 38 8.86C 4.16B 2.52B 2.17B 38.6BC 6.34C 3.47A 2.28AB 1.84CD 32.4BC
C.V.(%) 38 4.8 6.3 5.6 12.5 8.5 6.0 5.5 5.9 9.8 7.0

C C1 9 8.02ef 4.17cd 2.58bc 1.93g 35.5ef 5.64hij 3.49abcd 2.35ab 1.62gh 29.5ef
C2 1 7.49g 3.94de 2.36ef 1.90g 29.9h 5.24jk 3.34bcdef 2.13cdef 1.57h 24.9ghi
C3 5 7.58g 3.64ef 2.36ef 2.09efg 30.1h 5.46ijk 3.20efg 2.12def 1.71fgh 25.0ghi
C4 5 7.25g 3.66ef 2.34ef 1.99fg 28.0hi 5.18k 3.08fgh 2.13cdef 1.69gh 22.6hi
C5 6 8.06ef 3.35f 2.26fg 2.41bcd 28.9hi 5.80ghi 2.83hi 2.03ef 2.05cd 24.0hi
C6 2 7.66fg 3.50f 2.24gf 2.22cdef 24.9i 5.49ijk 2.89hi 1.99f 1.93de 21.8i
C7 3 8.37e 3.48f 2.29fg 2.42bc 31.1gh 6.20efg 2.96gh 2.07ef 2.11bcd 25.9gh
Mean 31 7.83D 3.73B 2.39BC 2.12B 30.8D 5.60D 3.16A 2.16CB 1.79D 25.6D
C.V.(%) 31 5.3 9.7 6.7 10.6 13.1 6.2 9.1 7.6 12.1 13.6

D D 1 11.52aA 5.41aA 2.97aA 2.13defgB 56.6aA 8.17aA 3.57abA 2.45aA 2.29bB 48.1aA

E E 2 9.65cB 3.00gC 2.14gC 3.22aA 32.4fghCD 7.52bB 2.69iB 1.99fC 2.81aA 27.9fgCD

Total Mean 96 8.79 4.00 2.47 2.24 37.1 6.34 3.32 2.23 1.93 31.2
C.V.(%) 96 10.2 11.2 7.3 13.9 17.2 11.5 8.9 7.2 14.5 17.3

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

yMeans with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

xCapital letters indicate statistic difference among main groups defined by culstering analysis

Eigenvectors for the principal component analysis of the traits and correlation coefficient between the traits and principal components.

Trait Eigenvector Correlation coefficient

Prin1y Prin2 Prin3 Prin1 Prin2 Prin3

GLz 0.232 0.425 -0.171 0.551**x 0.822** -0.089ns
GW 0.392 -0.109 -0.411 0.931** -0.212* -0.213*
GT 0.393 -0.112 0.422 0.933** -0.218* 0.218*
RLW -0.165 0.447 0.280 -0.391** 0.865** 0.145ns
TGW 0.386 0.189 -0.028 0.918** 0.365** -0.014ns
GLbw 0.170 0.466 -0.180 0.405** 0.902** -0.093ns
GWb 0.375 -0.179 -0.320 0.890** -0.347** -0.166ns
GTb 0.376 -0.143 0.627 0.894** -0.277** 0.325**
RLWb -0.106 0.491 0.122 -0.253* 0.950** 0.063ns
TGWb 0.373 0.223 0.052 0.887** 0.431** 0.027ns

Eigen value 5.64 3.75 0.27
Contribution (%) 56.4 37.5 2.7
Cumulative contribution (%) 56.4 93.9 96.6

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

yPrin1, Prin2, and Prin3 indicate the first, second, and third component, respectively

xns, *, and ** mean no significant, significant at p<0.05, and p<0.01, respectively

wb means brown rice

Comparison of grain-related traits of brown rice between the breeding materials and Korean rice cultivars.

Group n GLz (mm) GW (mm) GT (mm) RLW TGW (g)

Deuraechan 1 5.44 3.19 2.12 1.71 24.7
Boramchan 1 5.09 3.06 2.13 1.67 22.9
Jizi1560 1 8.17 3.57 2.45 2.29 48.1
Jizi1581 1 7.89 3.43 2.29 2.30 38.0
Daeripbyeo 1 1 6.36 3.48 2.25 1.83 34.6

DH lines 91 6.34±0.68ay 3.32±0.30a 2.23±0.16a 1.93±0.28c 31.1±5.1a
(5.09-7.69) (2.66-3.91) (1.83-2.63) (1.53-2.83) (18.6-41.5)
japonica 264 5.03±0.23dx 2.82±0.11b 1.94±0.13b 1.79±0.09d 22.0±2.0b
(4.29-6.20) (2.51-3.20) (1.23-2.30) (1.55-2.02) (14.1-34.8)
black rice 13 5.34±0.63c 2.57±0.12c 1.78±0.11c 2.08±0.25b 19.5±2.9c
(3.76-5.96) (2.33-2.75) (1.57-1.97) (1.46-2.36) (14.8-23.5)
Tongil-type 32 5.69±0.30b 2.57±0.13c 1.83±0.13c 2.22±0.19a 22.5±2.1b
(5.09-6.49) (2.30-2.91) (1.60-2.14) (1.79-2.65) (18.9-28.2)

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

yMeans with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

xThe data of japonica, black rice, and Tongil-type cultivars were used the value on registration of national variety and in the website of 'Nongsaro' (http://www.nongsaro.go.kr/)

Yield-related traits of the breeding materials.

Group n HDz (DAS) CL (cm) PL (cm) PN NS RRG (%) Yield (g)

A A1 6 95bcy 80ab 24abc 11abc 68de 66.6abcd 468cdef
A2 10 94bc 80ab 26a 9bc 136ab 52.7de 494bcdef
A3 8 102bc 84ab 23abc 9abc 88cde 39.9e 405ef
Mean 24 97Bx 82B 24A 9A 103AB 51.9A 458AB
C.V.(%) 24 10.5 13.9 8.2 19.6 38.2 36.2 16.7

B B1 6 97bc 79b 24abc 11abc 95bcde 55.7cde 483bcdef
B2 13 102bc 80ab 23abc 10abc 94bcde 68.2abcd 511abcdef
B3 7 106bc 81ab 23abc 8c 125abc 59.8bcde 527abcde
B4 4 107bc 73b 22bc 10abc 93bcde 53.4de 453def
B5 4 109abc 90ab 24abc 8c 112abc 54.1de 446def
B6 4 98bc 82ab 25ab 11abc 105abcd 56.5cde 544abcde
Mean 38 103B 81B 23A 10A 103AB 60.4A 500AB
C.V.(%) 38 13.2 14.4 8.3 19.5 24.2 26.2 17.9

C C1 9 99bc 75b 23abc 10abc 118abc 64.7abcde 523abcdef
C2 1 109abc 83ab 21c 12a 123abc 84.6ab 632abc
C3 5 109abc 76b 22bc 12ab 118abc 77.5abcd 554abcde
C4 5 104bc 76b 21c 12ab 135ab 81.5abc 641ab
C5 6 115ab 83ab 21c 10abc 125abc 86.9a 596abcd
C6 2 104bc 73b 22bc 11abc 150a 69.1abcd 666a
C7 3 110abc 81ab 23abc 10abc 122abc 78.8abcd 556abcde
Mean 31 106B 78B 22A 11A 125A 76.1A 577A
C.V.(%) 31 10.3 8.2 8.1 18.0 18.5 15.4 17.8

D D 1 92cB 91abAB 24abcA 10abcA 55eB 7.1fB 362fB

E E 2 128aA 98aA 24abcA 10abcA 123abcA 73.8abcdA 542abcdeA

Total Mean 96 103 80 23 10 110 63.0 513
C.V.(%) 96 12.4 12.9 8.8 18.4 27.7 29.7 19.9

zHD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

yMeans with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

xCapital letters indicate statistic difference among main groups defined by culstering analysis

Correlation coefficient among grain and yield-related traits in the breeding materials.

Traitz GLy GW GT RLW TGW HD CL PL PN NS RRG Yield
(x1, 6) (x2, 7) (x3, 8) (x4, 9) (x5, 10) (x11) (x12) (x13) (x14) (x15) (x16) (x17)

x1, 6 0.364** 0.322** 0.478** 0.801** -0.255* 0.237* 0.475** -0.168ns -0.427** -0.508** -0.476**
x2, 7 0.066nsx 0.887** -0.576** 0.768** -0.310** -0.127ns 0.043ns -0.230* -0.463** -0.561** -0.491**
x3, 8 0.088ns 0.850** -0.534** 0.770** -0.190ns -0.068ns 0.038ns -0.249* -0.431** -0.417** -0.427**
x4, 8 0.759** -0.591** -0.467** -0.043ns 0.075ns 0.255* 0.396** 0.037ns 0.048ns 0.080ns 0.012ns
x5, 10 0.741** 0.639** 0.680** 0.177ns -0.270** 0.103ns 0.292** -0.213* -0.576** -0.498** -0.554**
x11 -0.220* -0.208* -0.166ns -0.024ns -0.276** 0.525** -0.257* -0.007ns 0.290** 0.440** 0.434**
x12 0.289** -0.133ns -0.090ns 0.324** 0.106 0.525** 0.141ns -0.192ns 0.108ns 0.115ns 0.209*
x13 0.477** 0.057ns 0.033ns 0.355** 0.366** -0.257* 0.141ns -0.425** 0.132ns -0.324** -0.274**
x14 -0.150ns -0.269** -0.285** 0.033ns -0.243* -0.007ns -0.192ns -0.425** -0.451** 0.462** 0.240*
x15 -0.345** -0.381** -0.359** -0.022ns -0.506** 0.290** 0.108ns 0.132ns -0.451** 0.038ns 0.507**
x16 -0.447** -0.398** -0.375** -0.100ns -0.522** 0.440** 0.115ns -0.324** 0.462** 0.038ns 0.575**
x17 -0.420** -0.410** -0.367** -0.081ns -0.529** 0.434** 0.209* -0.274** 0.240* 0.507** 0.575**

zUpper and lower diagonal indicate the value of rough and brown rice, respectively

yGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight, HD: heading date, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

xns, *, and ** mean no significant, significant at p<0.05, and p<0.01, respectively

Number of allele types and frequency of GW2, GS3, and qSW5 in each group of the breeding materials.

Group n GW2 GS3 qSW5 Remark

gw2 GW2 gs3 GS3 qsw5 qSW5

A1 6 3 3 6 0 5 1 Jizi1581 (gw2gs3qSW5)
A2 10 6 4 10 0 1 9
A A3 8 7 1 6 2 8 0
Total 24 16 8 22 2 14 10
(66.7)z (33.3) (91.7) (8.3) (58.3) (41.7)

B1 6 0 6 3 3 6 0 Daeripbyeo 1 (gw2GS3qsw5)
B2 13 9 4 3 10 11 2
B3 7 6 1 2 5 7 0
B B4 4 4 0 1 3 4 0
B5 4 3 1 3 1 3 1
B6 4 1 3 3 1 3 1
Total 38 23 15 15 23 34 4
(60.5) (39.5) (39.5) (60.5) (89.5) (10.5)

C1 9 5 4 0 9 8 1
C2 1 0 1 0 1 1 0 Deuraechan (GW2GS3qsw5)
C3 5 0 5 0 5 5 0
C4 5 0 5 0 5 4 1 Boramchan (GW2GS3qsw5)
C C5 6 0 6 1 5 1 5
C6 2 1 1 0 2 1 1
C7 3 0 3 1 2 1 2
Total 31 6 25 2 29 21 10
(19.4) (80.6) (6.5) (93.5) (67.7) (32.3)

D D 1 1 0 1 0 1 0 Jizi1560 (gw2gs3qsw5)
(100) (0) (100) (0) (100) (0)

E E 2 0 2 2 0 0 2 DGS79, 83 (GW2gs3qSW5)
(0) (100) (100) (0) (0) (100)

Total 96 46 50 42 54 70 26
(47.9) (52.1) (43.8) (56.3) (72.9) (27.1)

zThe value in the parenthesis is the frequency of the allele type of GW2, GS3, and qSW5

The influence of GW2, GS3, and qSW5 on the phenotypic variation of grain-related traits.

Source of variance df Rough rice Brown rice

GLz GW GT RLW TGW GL GW GT RLW TGW

MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2 MS F R 2

GW2 1 2.13 5.72*y 0.035 5.61 90.34** 0.340 0.71 53.57** 0.276 1.26 39.77** 0.156 668.91 32.63** 0.202 0.19 0.92ns 0.005 2.72 123.16** 0.372 0.54 53.22** 0.268 0.83 47.10** 0.131 431.83 30.77** 0.182
GS3 1 25.04 67.36** 0.411 0.00 0.01ns 0.000 0.01 0.50ns 0.003 2.15 67.75** 0.266 417.16 20.35** 0.126 20.71 98.71** 0.513 0.04 1.70ns 0.005 0.01 0.55ns 0.003 2.43 137.72** 0.383 412.70 29.41** 0.174
qSW5 1 0.10 0.26ns 0.002 5.02 80.83** 0.304 0.64 48.78** 0.251 1.54 48.57** 0.191 387.05 18.88** 0.117 0.21 0.99ns 0.005 2.39 108.30** 0.327 0.54 52.58** 0.265 1.29 73.23** 0.204 235.22 16.76** 0.099
GW2*GS3 1 0.73 1.97ns 0.012 0.00 0.02ns 0.000 0.02 1.49ns 0.008 0.18 5.65* 0.022 11.85 0.58ns 0.004 0.62 2.97ns 0.015 0.01 0.28ns 0.001 0.04 3.76ns 0.019 0.09 5.00* 0.014 25.40 1.81ns 0.011
GW2*qSW5 1 0.12 0.33ns 0.002 0.09 1.41ns 0.005 0.00 0.02ns 0.000 0.03 0.89ns 0.003 12.64 0.62ns 0.004 0.06 0.29ns 0.002 0.19 8.70** 0.026 0.00 0.02ns 0.000 0.10 5.52* 0.015 27.71 1.97ns 0.012
GS3*qSW5 1 0.01 0.02ns 0.000 0.26 4.17* 0.016 0.00 0.22ns 0.001 0.10 3.03ns 0.012 5.44 0.27ns 0.002 0.08 0.40ns 0.002 0.00 0.13ns 0.000 0.00 0.01ns 0.000 0.05 2.84ns 0.008 0.04 0.00ns 0.000
GW2*GS3*qSW5 1 0.00 0.00 ns 0.000 0.05 0.79 ns 0.003 0.02 1.46 ns 0.008 0.02 0.57 ns 0.002 2.06 0.10 ns 0.001 0.00 0.00 ns 0.000 0.02 0.82 ns 0.002 0.01 0.59 ns 0.003 0.00 0.01 ns 0.000 0.36 0.03 ns 0.000
Model 7 4.02 10.81** 0.462 1.57 25.37** 0.669 0.20 15.15** 0.546 0.75 23.75** 0.654 215.01 10.49** 0.455 3.13 14.90** 0.542 0.77 34.73** 0.734 0.16 15.82** 0.557 0.68 38.77** 0.755 161.89 11.54** 0.479
Error 88 0.372 0.062 0.013 0.032 20.50 0.210 0.022 0.010 0.018 14.03

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

2)ns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by three-way ANOVA, respectively

Comparison of the value of grain-related traits according to allele types.

Gene combination Genotype n Rough rice Brown rice

GLz (mm) GW (mm) GT (mm) RLW TGW (g) GL (mm) GW (mm) GT (mm) RLW TGW (g)

Single gene gw2 46 9.05±0.797**y 4.27±0.373** 2.58±0.159** 2.14±0.240** 40.6±5.31** 6.46±0.656ns 3.50±0.211** 2.33±0.139** 1.86±0.237* 34.0±4.16**
GW2 50 8.55±0.921 3.73±0.341 2.38±0.136 2.33±0.340 33.9±5.61 6.23±0.774 3.15±0.260 2.15±0.127 1.99±0.303 28.7± 5.15

gs3 42 9.51±0.633** 4.01±0.434ns 2.46±0.174ns 2.43±0.339** 40.2±5.65** 6.98±0.494** 3.34±0.281ns 2.22±0.132ns 2.14±0.255** 34.1±4.46**
GS3 54 8.23±0.621 3.97±0.421 2.48±0.185 2.09±0.180 34.8±5.97 5.84±0.431 3.29±0.308 2.25±0.181 1.76±0.166 29.0±4.99

qsw5 70 8.76±0.921ns 4.14±0.366** 2.53±0.161** 2.14±0.250** 38.3±6.33** 6.26±0.714ns 3.43±0.213** 2.29±0.141** 1.83±0.218** 32.1±5.25**
qSW5 26 8.88±0.829 3.56±0.372 2.32± 0.125 2.51±0.298 34.0±5.57 6.55±0.729 3.02±0.276 2.09±0.117 2.19±0.269 28.9±5.15

Three genes gw2gs3qsw5 14 9.57±0.852ax 4.51±0.296a 2.64±0.133a 2.13±0.160c 44.4±5.45a 6.84±0.600a 3.57±0.127a 2.35±0.070a 1.92±0.185de 36.6±4.87a
gw2gs3qSW5 9 9.56±0.433a 3.85±0.274b 2.39±0.069b 2.50±0.192b 39.4±2.82b 7.08±0.363a 3.25±0.164b 2.16±0.088 2.18±0.121b 34.0±1.55ab
gw2GS3qsw5 20 8.53±0.507b 4.33±0.305a 2.65±0.137a 1.98±0.095c 39.2±5.08b 5.98±0.384b 3.59±0.191a 2.40±0.132a 1.67±0.095g 32.7±3.76abc
gw2GS3qSW5 3 8.55±0.475b 4.03±0.220b 2.49±0.122b 2.13±0.214c 36.2±3.67bc 6.09±0.361b 3.36±0.123b 2.24±0.072b 1.81±0.150ef 30.3±2.75bcd
GW2gs3qsw5 13 9.51±0.606a 3.93±0.155b 2.43±0.120b 2.50±0.297b 39.3±5.00b 6.98±0.503a 3.26±0.104b 2.20±0.087b 2.15±0.119bc 33.9±4.31ab
GW2gs3qSW5 6 9.32±0.393a 3.24±0.189c 2.25±0.102c 2.89±0.258a 33.4±2.10c 7.11±0.391a 2.79±0.085c 2.04±0.066c 2.56±0.203a 29.0±1.98cd
GW2GS3qsw5 23 8.03±0.680b 3.88±0.242b 2.43±0.106b 2.08±0.141c 33.2±4.53c 5.74±0.492b 3.31±0.161b 2.20±0.112b 1.74±0.126gf 27.8±3.94d
GW2GS3qSW5 8 7.90±0.393b 3.32±0.122c 2.22±0.069c 2.38±0.097b 27.7±3.00d 5.72±0.279b 2.80±0.092c 1.99±0.077c 2.05±0.082cd 22.5±2.39e

zGL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

yns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by t-test, respectively

xMeans with the same letters in a column are not significantly difference at p<0.05 (ANOVA followed by DMRT)

The influence of GW2, GS3, and qSW5 on the phenotypic variation of yield-related traits.

Source of variance df HDz CL PL PN NS RRG Yield

MS MS R 2 MS MS R 2 MS MS R 2 MS MS R 2 MS MS R 2 MS MS R 2 MS MS R 2

GW2 1 456.17 3.03nsy 0.030 69.24 0.66ns 0.007 1.92 0.57ns 0.005 71.89 32.69** 0.251 68.69 0.09ns 0.001 4710.60 23.28** 0.161 25221.91 3.04ns 0.027
GS3 1 771.18 5.13* 0.051 23.78 0.23ns 0.002 65.81 19.50** 0.163 4.44 2.02ns 0.016 154.29 0.21ns 0.002 5093.57 25.17** 0.174 92956.71 11.19** 0.099
qSW5 1 149.60 1.00ns 0.010 286.80 2.72ns 0.028 0.29 0.09ns 0.001 11.05 5.02* 0.039 10612.05 14.16** 0.128 993.58 4.91* 0.034 59012.53 7.11** 0.063
GW2*GS3 1 111.21 0.74ns 0.007 78.17 0.74ns 0.008 10.40 3.08ns 0.026 1.27 0.58ns 0.004 482.82 0.64ns 0.006 6.55 0.03ns 0.000 941.84 0.11ns 0.001
GW2*qSW5 1 300.02 2.00ns 0.020 50.81 0.48ns 0.005 2.72 0.81ns 0.007 0.17 0.08ns 0.001 756.13 1.01ns 0.009 108.65 0.54ns 0.004 22574.11 2.72ns 0.024
GS3*qSW5 1 56.82 0.38ns 0.004 23.24 0.22ns 0.002 25.33 7.51** 0.063 3.64 1.66ns 0.013 3093.87 4.13* 0.037 253.21 1.25ns 0.009 4863.55 0.59ns 0.005
GW2*GS3*qSW5 1 4.85 0.03ns 0.000 364.03 3.45ns 0.036 0.75 0.22ns 0.002 0.07 0.03ns 0.000 1746.37 2.33ns 0.021 331.32 1.64ns 0.011 2586.12 0.31ns 0.003
Model 7 264.27 1.76ns 0.123 128.01 1.21ns 0.088 15.32 4.54** 0.265 13.22 6.01** 0.323 2416.32 3.22** 0.204 1642.50 8.12** 0.392 29736.68 3.58** 0.222
Error 88 150.31 105.53 3.38 2.20 749.38 202.38 8304.46

zHD: heading date, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

yns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by three-way ANOVA, respectively

Comparison of the value of yield-related traits according to allele types.

Gene combination Genotype n HDz (DAS) CL (cm) PL (cm) PN NS RRG (%) Yield (g)

Single gene gw2 46 100±10.6nsy 79±11.6ns 23±2.0ns 9±1.5** 110±34.9ns 53.1±17.94** 478±96.7**
GW2 50 105±14.2 81±9.1 23±2.1 11±1.6 110±26.0 72.2±14.36 547±96.2

gs3 42 99±11.8* 82±10.5ns 24±2.0** 10±1.8ns 107±32.3ns 53.5±18.24** 479±79.8**
GS3 54 106±12.9 79±10.2 22±1.9 10±1.9 112±29.0 70.4±15.64 541±109.7

qsw5 70 102±12.2ns 79±10.8ns 23±2.0ns 10±2.0* 103±30.5** 61.9±18.43ns 502±105.6ns
qSW5 26 104±14.2 83±8.8 23±2.2 9±1.6 129±20.2 66.1±19.58 544±86.4

Three gene gw2gs3qsw5 14 100±9.2bx 82±12.6ab 23±1.9ab 9±1.2cd 87±27.6c 47.9±19.25d 430±74.2d
gw2gs3qSW5 9 96±6.1b 78±7.6ab 25±1.9a 8±1.1d 144±21.7a 44.7±13.97d 497±68.5bcd
gw2GS3qsw5 20 102±12.9ab 77±12.4b 23±1.9ab 9±1.8cd 109±34.8bc 57.8±16.97cd 483±96.3cd
gw2GS3qSW5 3 103±11.3ab 85±11.5ab 22±1.5bc 9±0.6cd 117±14.3abc 71.4±9.57abc 610±153.1a
GW2gs3qsw5 13 98±12.3b 80±9.2ab 24±2.1ab 11±1.9ab 97±26.4bc 58.4±18.34cd 501±81.3bcd
GW2gs3qSW5 6 104±21.0ab 89±9.7a 25±1.2a 10±1.0bc 119±15.2ab 69.4±7.18bc 519±62.4abcd
GW2GS3qsw5 23 106±12.7ab 80±9.0ab 22±1.9bc 11±1.4a 109±28.3bc 76.0±7.64ab 564±111.2abc
GW2GS3qSW5 8 115±10.8a 82±6.8ab 21±0.5c 11±1.1ab 124±16.0ab 85.8±5.38a 592±63.1ab

zHD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

yns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by t-test, respectively

xMeans with the same letters in a column are not significantly difference at p<0.05 (ANOVA followed by DMRT)

Table 1 The information of markers used for the identification of grain-related genes, GW2, GS3, and qSW5.
Table 2 Anther culture ability of the crosses and doubled haploid lines used in this study.

Percent plant regeneration is the number of plants regenerated over number of cali plated

Percent green is the number of green plants regenerated over total plants regenerated

Percent albino is the number of albino plants regenerated over total plants regenerated

Double haploid lines are harvested plants having fertile grain

Selected DH lines are used in this study

Table 3 Relationship between the grain-related traits of the doubled haploid lines (n=303).

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

** means significant at p<0.01

Table 4 Grain-related and agronomic traits of the groups divided by cluster analysis in 2013.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight, HD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill

Means with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

Capital letters indicate statistic difference among main groups defined by culstering analysis

Table 5 Grain-related traits of the breeding materials.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

Means with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

Capital letters indicate statistic difference among main groups defined by culstering analysis

Table 6 Eigenvectors for the principal component analysis of the traits and correlation coefficient between the traits and principal components.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

Prin1, Prin2, and Prin3 indicate the first, second, and third component, respectively

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01, respectively

b means brown rice

Table 7 Comparison of grain-related traits of brown rice between the breeding materials and Korean rice cultivars.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

Means with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

The data of japonica, black rice, and Tongil-type cultivars were used the value on registration of national variety and in the website of 'Nongsaro' (http://www.nongsaro.go.kr/)

Table 8 Yield-related traits of the breeding materials.

HD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

Means with the same letters in a column are not significantly different at p<0.05 (ANOVA followed by DMRT)

Capital letters indicate statistic difference among main groups defined by culstering analysis

Table 9 Correlation coefficient among grain and yield-related traits in the breeding materials.

Upper and lower diagonal indicate the value of rough and brown rice, respectively

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight, HD: heading date, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01, respectively

Table 10 Number of allele types and frequency of GW2, GS3, and qSW5 in each group of the breeding materials.

The value in the parenthesis is the frequency of the allele type of GW2, GS3, and qSW5

Table 11 The influence of GW2, GS3, and qSW5 on the phenotypic variation of grain-related traits.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by three-way ANOVA, respectively

Table 12 Comparison of the value of grain-related traits according to allele types.

GL: grain length, GW: grain width, GT: grain thickness, RLW: ratio of length to width, TGW: 1000-grain weight

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by t-test, respectively

Means with the same letters in a column are not significantly difference at p<0.05 (ANOVA followed by DMRT)

Table 13 The influence of GW2, GS3, and qSW5 on the phenotypic variation of yield-related traits.

HD: heading date, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by three-way ANOVA, respectively

Table 14 Comparison of the value of yield-related traits according to allele types.

HD: heading date, DAS: days after seeding, CL: culm length, PL: panicle length, PN: number of panicles per hill, NS: number of spikelets per panicle, RRG: ratio of ripened grain

ns, *, and ** mean no significant, significant at p<0.05, and p<0.01 by t-test, respectively

Means with the same letters in a column are not significantly difference at p<0.05 (ANOVA followed by DMRT)