Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

MutMap 분석에 의한 벼 왜성 돌연변이 계통의 변이 유전자 탐색

오준1, 천경성1, 강도유1, 김송림1, 이은경1, 김년희1, 오효자1, 최인찬1, 백정호1, 윤인선1, 김경환1, 정남진2, 지현소1,*

MutMap Analysis of a Rice Dwarf Mutant Line

Korean Journal of Breeding Science 2020;52(1):9-19.
Published online: March 1, 2020

1농촌진흥청 국립농업과학원

2전북대학교 작물생명과학과

1National Institute of Agricultural Sciences, Rural Development Administration (RDA), Jeonju 54874, Republic of Korea

2Department of Crop Science and Biotechnology, Chonbuk National University, Jeonju 54896, Republic of Korea

* Corresponding Author (E-mail: jhs77@korea.kr, Tel: +82-63-238-4657, Fax: +82-63-238-4654)
• Received: October 17, 2019   • Revised: October 21, 2019   • Accepted: November 14, 2019

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 128 Views
  • 0 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Genetic mapping of regions associated with root system architecture in rice using MutMap QTL-seq
    Nakul D. Magar, Kalyani M. Barbadikar, Vishal Reddy, Padmashree Revadi, Pritam Guha, Dhiraj Gangatire, Divya Balakrishnan, Shailendra Sharma, M. Sheshu Madhav, Raman M. Sundaram
    Plant Physiology and Biochemistry.2024; 213: 108836.     CrossRef
  • Combined strategy employing MutMap and RNA-seq reveals genomic regions and genes associated with complete panicle exsertion in rice
    Anil A. Hake, Suneel Ballichatla, Kalyani M. Barbadikar, Nakul Magar, Shubhankar Dutta, CG Gokulan, Komal Awalellu, Hitendra K Patel, Ramesh V. Sonti, Amol S. Phule, Embadi Prashanth Varma, Pradeep Goud Ayeella, Poloju Vamshi, R. M. Sundaram, Sheshu Madha
    Molecular Breeding.2023;[Epub]     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

MutMap Analysis of a Rice Dwarf Mutant Line
Korean. J. Breed. Sci.. 2020;52(1):9-19.   Published online March 1, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
MutMap Analysis of a Rice Dwarf Mutant Line
Korean. J. Breed. Sci.. 2020;52(1):9-19.   Published online March 1, 2020
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
MutMap Analysis of a Rice Dwarf Mutant Line
Image Image Image Image Image Image
Fig. 1 Phenotype comparison between Dongjin plants and dwf1 mutants. (A) Plant architecture. dwf1 mutant line showed phenotypes of dense green leaf color and reduced plant height. These photographs were taken at 68 days after seeding. (B) Culm structure. White lines indicate location of nodes (bar: 30 cm). (C) The third internode of dwf1 is shortened remarkably (bar: 1 cm). (D) The dwf1 mutant line showed phenotypes of small and round seeds. upper part: hulled seeds. lower part: dehulled seeds.
Fig. 2 Phenotype of Dogjin, dwf1 mutant line and dwf1/Dongjin F1. (A) wild-type parental line (Dongjin). (B) dwf1. (C) dwf1/Dongjin F1.
Fig. 3 SNP-index graph for MutMap analysis of dwf1. Red regression lines were obtained by averaging SNP-indices from a moving window of five consecutive SNPs and shifting the window one SNP at a time. Y-axis shows SNP-index as 0~1 and X-axis is the SNP position in units of mega base pair (Mbp). The red bar of chromosome 4 indicates region including the causal SNP for the mutant phenotype.
Fig. 4 Gene structure of Os04g0469800 (D11) and its mutation in dwf1. Red boxes represent exons for coding sequence, empty boxes represent untranslated regions, and lines represent introns. The mutation occurred in exon 4 changing G to T which caused amino acid change from aspartic acid to tyrosine in dwf1.
Fig. 5 Result of bulked segregant analysis (BSA) with dwf1/Dongjin F2 population using J10402 marker. PCR products cut with restriction enzyme were run on 3% agarose gel. WB1-WB3: DNA bulk samples each containing DNA samples from 10 out of 30 wild type F2 plants; MB1-MB3: DNA bulk samples each including DNA samples from 10 out of 30 mutant type F2 plants.
Fig. 6 Linkage map of rice chromosome 4 showing the location of dwf1 gene. The gene harboring causative mutation for phenotypes of dwf1 mutant line was designated dwf1. The dwf1 gene was located at the same location with J10402 marker.
MutMap Analysis of a Rice Dwarf Mutant Line

List of CAPS markers on chromosome 4 used in bulked segregant analysis and genetic mapping of dwf1.

Marker name Position (bp) Primer sequence (5´ -3´) Restriction enzyme

Forward sequence Reverse sequence
J10401 5,112,849 GCAAGGTTCAAGAGCGATTC AGCATCAGCCTCGCTACAAC PvuⅡ
J10402 23,469,810 GCTCTGTCTTTTTCAGCA GCATGCAACTCAACATCT HinfⅠ
J10403 25,851,000 ACCTGTGTGGGAGAGGTGAG AGATCGATCGTTTTGCTTGC FokⅠ
J10404 28,260,138 TCAGGATTGGAGGGAAAAGA TTTCCTGCCCCTGCATATAA ClaⅠ
J10405 33,484,779 CGTCGATTTTAATCGGTCGT CTCGCTGGCTCACATATTCC AluⅠ

Phenotype segregation of F2 plants derived from crosses between Dongjin and dwf1 mutant line.

Cross combination No. of F2 plants χ2 (3:1) P value

Wild type Mutant type
dwf1/Dongjin 341 100 1.150 0.284

Summary of sequence data amount.

raw sequencing data after quality trimming (Q20) after read mapping



nucleotides (Gbp) nucleotides (Gbp) sequencing depth (X) nucleotides (Gbp) average mapping depth (X) Covered 3+ sites (Mbp)z mapping coverage (%)y
Dongjin 20.7 17.2 46.13 15.0 40.18 350.5 93.90
dwf1 13.9 11.9 31.83 9.9 26.55 352.9 94.54
dwf1/Dongjin F2MPx 29.1 21.4 57.43 15.8 42.23 355.4 95.21

Number of detected SNPs on chromosomes.

Chromosome Comparison pairz

DJ-NP SNP dwf1-NP SNP DJ-dwf1* SNP DJ-dwf1homo SNP F2MP-NP SNP DJ-dwf1 homo SNP-F2MP common
1 5,020 4,974 2,231 548 5,180 406
2 5,702 5,107 2,626 1,310 5,913 1,014
3 2,150 2,093 1,216 159 2,085 119
4 15,613 10,902 6,805 5,045 15,376 3,303
5 12,702 2,690 11,931 10,467 10,642 7,360
6 9,449 9,072 1,650 374 9,824 319
7 24,303 20,384 5,705 4,072 24,904 2,950
8 12,500 3,231 10,768 9,126 10,183 6,365
9 3,713 6,820 6,875 5,826 7,280 4,571
10 11,851 7,961 5,631 3,894 11,022 2,532
11 56,185 52,226 2,759 674 58,574 337
12 66,365 59,799 2,893 891 68,193 588
Total 225,553 185,259 61,090 42,386 229,176 29,864

List of SNPs in the dwf1 target region and their SNP-index.

Position Reference nucleotide Dongjin nucleotide dwf1 nucleotide No. of Dongjin allelesz No. of dwf1 allelesy SNP-index
23,469,810 C C A 0 55 1.00
23,546,254 T T A 1 35 0.97
23,637,440 T T G 41 472 0.92
24,652,472 - - A (Ins)x 4 16 0.80
24,787,274 G G A 2 30 0.94
25,328,061 T T A 0 44 1.00
25,423,834 A A T 1 45 0.98
25,851,000 G G A 6 48 0.89
25,970,046 T T A 10 31 0.76
26,040,458 C C T 3 39 0.93
26,045,753 T T A 1 53 0.98
26,130,501 T T C 4 50 0.93
26,310,900 A A T 5 27 0.84
26,385,509 A A C 7 48 0.87
26,539,330 A A T 4 43 0.91
27,265,670 A A T 2 45 0.96
27,393,577 T T A 7 23 0.77
27,416,635 - - T (Ins) 7 8 0.53
27,423,468 G G A 4 28 0.88
27,655,011 T T A 10 27 0.73
27,656,683 G G A 8 28 0.78
27,851,565 G G T 8 49 0.86
27,865,807 C C A 4 37 0.90
27,911,046 C C T 1 39 0.98
28,042,325 G G A 2 35 0.95
28,109,890 G G A 8 17 0.68
28,151,383 A A T 2 15 0.88
28,153,342 T T A 7 39 0.85
28,196,188 A A T 3 27 0.90
28,260,138 C C A 6 38 0.86
28,334,098 C C T 8 30 0.79
28,575,184 C C A 1 19 0.95
29,071,503 G G A 6 23 0.79

Detected SNPs with SNP-index of 1 in the genic region of genes located in the dwf1 target region analyzed by MutMapz.

Gene ID Start Endy 5’ UTR CDS Intron 3’ UTR sum Gene description

NS SY
Os04g0469800 23,467,167 23,471,592 1 1 Cytochrome P450 family protein (D11)
Os04g0507000 25,323,826 25,340,028 1 1 Similar to DNA mismatch repair protein.
Table 1 List of CAPS markers on chromosome 4 used in bulked segregant analysis and genetic mapping of dwf1.
Table 2 Phenotype segregation of F2 plants derived from crosses between Dongjin and dwf1 mutant line.
Table 3 Summary of sequence data amount.

sites in Nipponbare reference genome sequence where over 3 reads were mapped.

percent of covered 3+ sites in Nipponbare reference sequence.

mutant type DNA pool of dwf1/ Dongjin F2 population.

Table 4 Number of detected SNPs on chromosomes.

DJ-NP SNP = SNP between Dongjin and Nipponbare, dwf1-NP SNP = SNP between dwf1 and Nipponbare, DJ-dwf1* SNP = SNP between Dongjin and dwf1, DJ-dwf1 homo SNP = homozygous SNP between Dongjin and dwf1, F2MP-NP SNP = SNP between F2MP (mutant type DNA pool of dwf1/ Dongjin F2 population) and Nipponbare, DJ-dwf1 homo SNP-F2MP common = common SNP of homozygous SNP between Dongjin and dwf1 and SNP between F2MP and Nipponbare.

Table 5 List of SNPs in the dwf1 target region and their SNP-index.

No. of Dongjin alleles in F2MP (mutant type DNA pool of dwf1/ Dongjin F2 population) sequencing data.

No. of dwf1 alleles in F2MP (mutant type DNA pool of dwf1/ Dongjin F2 population) sequencing data.

Ins indicates insertion.

Table 6 Detected SNPs with SNP-index of 1 in the genic region of genes located in the dwf1 target region analyzed by MutMapz.

Start = start position of the gene in reference genome, End = end position of the gene in reference genome, UTR = untranslated region, CDS = coding sequence, NS = non-synonymous SNP, SY = synonymous SNP.