Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
Search
Advanced Search
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Page Path

Article

엽록체 trnL-trnF intergenic spacers (IGS) 영역과 핵 리보솜 Internal Transcribed Spacer (ITS) 영역 염기서열을 이용한 제주도 내 ‘인창귤’(‘Inchangkyool’)과 중국 의창지( ‘Ichangensis’) 품종과의 유전학적 분석

김민주, 김미선, 신기혜, 박석만, 최철우, 윤수현, 진성범*

Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions

Min Ju Kim, Mi Sun Kim, Kihye Shin, Sukman Park, Cheolwoo Choi, Su Hyun Yun, Seong Beom Jin*
Korean Journal of Breeding Science 2021;53(1):16-31.
Published online: March 1, 2021

농촌진흥청 국립원예특작과학원 감귤연구소

Citrus Research Institute, National Institute of Horticultural & Herbal Science, RDA, Jeju 63613, Republic of Korea

* Corresponding Author (E-mail: pfad7@naver.com, Tel: +82-64-730-4146, Fax: +82-64-733-9564)

Copyright © 2021 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 28 Views
  • 0 Download
prev next

Full Article

Download PDF Download PDF
  • ‘Inchangkyool’ varieties, which are believed to have been cultivated in Jeju for a long time, have leaves and flowers with a lemon-like fragrance. They have been suggested to be given the same scientific name as Citrus ichangensis, which is known to originate from China’s Southwest and Midwest regions. However, the genetic characterization of ‘Inchangkyool’ has not been reported, and literature is not readily available. Hence, in this study, 30 citrus chloroplast (cp)DNA (trnL-trnF) regions and nuclear ribosomal DNA internal transcribed spacer (ITS) regions were tested to identify the genetic relationship between ‘Inchangkyool’ and C. ichangensis and the origin of ‘Inchangkyool’ cultivars. Our results indicated that the total nucleotide sequence length of the trnL-trnF intergenic spacer (IGS) region and the G + C content was 373 bp and 36.73%, respectively, in the cpDNA of C. ichangensis and ‘Inchangkyool’, whereas the ITS1 regions were 247 and 248 bp and the ITS2 regions were 228 and 226 bp, respectively. Furthermore, the sequence lengths of the total ITS (ITS1 + 5.8S rDNA + ITS2) regions were 638 and 637 bp, respectively, whereas the G+C content was 70.16%, 71.26%, 69.03%, 70.61%, 64.6%, and 65.49%, respectively - showing differences in the nuclear ribosomal DNA region. However, the nucleotide sequence length of the 5.8S rDNA region was 163 bp and the G + C content was 54.6%, which were the same for both varieties. In addition, sequence divergence and phylogenetic analysis of the trnL-trnF and ITS regions in chloroplast DNA showed that the sequence divergence of the trnL-trnF region on the chloroplast was 0–0.008. This result indicates that ‘Inchangkyool’ is most closely related to Jeju eight native citrus cultivars including ‘Dongjeongkyool’. It is also closely related to C. ichangensis cultivars and six common citrus cultivars. In other words, the ‘Inchangkyool’ cultivar was inherited from the same maternal line as the Chinese C. ichangensis. The divergence values of the nuclear ribosomal DNA region between ‘Inchangkyool’ and ‘Dongjeongkyool’ and C. ichangensis were 0.008 and 0.026, respectively. These results indicated that ‘Inchangkyool’ was most closely related to ‘Dongjeongkyool’, and was farther from the C. ichangensis cultivar. In addition, phylogenetic relationships found ‘Inchangkyool’ to belong to the same group as the ‘Dongjeongkyool’ cultivar of jeju native citrus cultivars and a different group from C. ichangensis. From the above results, it is suggested that ‘Inchangkyool’ cultivar has been classified from the same maternal cultivar as the C. ichangensis in China, but has been obtained through long-term crossing with the same species as ‘Dongjeongkyool’. Moreover, based on the above results, it is believed that a distinct cultivar name for ‘Inchangkyool’ can be presented.
  • Keywords: ichangensis; inchangkyool; sequence divergency; phylogenetic analysis; dongjeongkyool
감귤은 운향과(Rutaceae) 감귤아과(Aurantioideae)에 속하는 과수 작물로(Huh et al. 2011, Jung et. al. 2005), 열대 및 아열대 지역의 아시아 등지에 전파되어 재배되어 온 것으로 추정하고 있으며(Dugo & Giacomo 2002, Nicolosi et al. 2000), 전세계적으로 광범위하게 재배되고 있다(Ollitrault et al. 2012, Pang et al. 2007). 감귤의 분류 방법은 재배종 감귤아속(10종)과 야생종 6종(Citrophorum, Cephalocitrus, Aurantium, Sinocitrus, Papeda, Papedocitrus)을 포함하는 파페다아속(Papeda)으로 분류한 Swingle & Reece (1967)과 화서(inflorescence)의 유무에 따라서 162종으로 분류한 Tanaka (1977)의 방법을 광범위 하게 적용하고 있다(Barkley et al. 2006, Nicolosi et al. 2000). 우리나라의 감귤 재배 기원은 선사시대부터 제주도에 자생하여 재배되어 온 것으로 추정하고 있으며, 현존하고 있는 재래감귤 품종으로는 ‘병귤’을 포함한 12종이 고 문헌에 보고되고 있다(Jung et al. 2005, Jin et al. 2016, Kim et al. 2001). 또한 문헌에는 보고되어 있지 않지만 오랜 기간 동안 제주도에서 재배되어온 것으로 추정되는 ‘인창귤’(‘Inchangkyool’)은 김인창이라는 사람이 돌연변이 선발한 품종이라는 이야기가 구전되고 있으나 정확한 문헌 자료가 없는 상태이다.
이전 연구자(Lee et al. 2005)에 의하면 ‘인창귤’은 파페다아속에 속하면서 레몬향기를 갖는 잎과 꽃을 가지고 있으며 중국의 남서부 및 중서부가 원산지로 알려진 중국 의창지(Citrus ichangensis) (Nicolsi 2007)와 동일한 학명을 사용하였으나 최근 연구 보고에 의하면 ‘인창귤’에 대한 학명 기재는 단지 품종명(‘Inchangkyool’) (Oh et al. 2012, Yang et al. 2019)만 제시하거나 Citrus spp, ‘Inchangkyool’(Jeong et al. 2018, Woo et al. 2019)로 명명하여 제시하고 있다. 그러나, 이 또한 명확한 학명이 아니며 이와 관련된 연구들은 보고되어 있지 않은 상태이기 때문에 ‘인창귤’ 에 대한 정확한 정보가 절실하게 필요한 실정이다.
식물들 품종 간에 유전적 유연관계 및 기원을 규명하기 위한 방법으로써 많은 분자마커 기법이 사용되었는데(Tingey & Tufo 1993), 감귤품종의 계통분류에 광범위하게 사용되고 있는 마커로는 AFLP (amplified fragment length polymorphism)(Pang et al. 2007), RFLP (restriction fragment length polymorphism) (Federici et al. 1998), RAPD (random amplified polymorphic DNA)(Federici et al. 1998, Nicolosi et al. 2000, Nicolosi et al. 2005), ISSR (inter simple sequence repeat)(Gulsen & Roose 2001), SSR (simple sequence repeat)(Barkley et al. 2006, Luro et al. 2008)이 있으며, 그리고 세포질 내에 존재하는 엽록체 유전자 간 부위(Intergenic region)인 trnL-trnF 영역(Huh et al. 2011, Jung et al. 2005, Penjor et al. 2013)과 핵 리보솜 DNA내 ITS (Internal transcribed spacer) 영역을 이용한 연구들이 보고되고 있다(Jin et al. 2016, Sun et al. 2015). 특히, 이들 마커 중 trnL-trnF와 ITS 영역은 진화 속도가 빠르고 유전자 간 높은 변이율을 갖고 있으면서 종 속간 유전적 유연관계 및 진화에 대한 기원을 파악하는데 있어서 주로 사용하고 있다(Baldwin 1995, Moon et al. 2015).
따라서, 본 연구는 중국이 원산지인 중국 의창지와 오랜 기간 동안 제주도에서 재배되어온 ‘인창귤’ 간의 유연관계 및 기원 규명을 위하여 cpDNA (trnL-trnF intergenic spacers)와 ITS 영역을 이용하여 최초로 실험을 수행하였다.
식물 재료 및 전체 게놈 DNA 추출
본 연구에 사용된 감귤류는 감귤 연구소내 보존 재배되고 있는 중국 의창지(Citrus ichangensis ‘Ichangensis’), ‘인창귤’ (‘Inchangkyool’), 재래감귤 11종 그리고 감귤류 15종, 탱자속, 금감속을 포함한 총 30종을(Table 1) 수집하여 사용하였으며 이들 품종들에 대한 게놈 DNA는 자동 핵산 추출기[Automatic Nuclear extraction (MX 16, Promega, Madison, WI, USA)]를 이용하여 추출하였다. 추출한 식물 전체 게놈 DNA는 -70℃에 보관하여 실험에 사용하였다.
엽록체 trnL-trnF intergenic spacers (IGS) 및 ITS 영역의 PCR 증폭 및 산물 정제
엽록체 trnL-trnF 영역과 핵 Ribosomal DNA의 ITS1, ITS2 그리고 전체 ITS (ITS1+5.8S rDNA+ITS2) 영역에 대한 PCR은 이전 연구자(Sang et al. 1997, Jung et al. 2005, Jin et al. 2016, 2018)의 방법에 따라서 제작한 프라이머 조합(Table 2)을 이용하여 수행하였다.
PCR 반응액은 AccuPower Multiplex PCR PreMix (Bioneer, Corp., Daejeon, Korea) [250 μM dNTP, 1.5 mM MgCl2, 1.0 unit TaqDNA polymerase, 10 mM Tris-HCl (pH 9.0), 40 mM KCl]에 주형 DNA 25-50 ng그리고 0.5 pmol의 프라이머를 첨가하여 20 ul로 조정하여 사용하였다. ITS영역의 PCR 반응은 Applied Biosystmes Veriti 96-well Thermal cycle (ABI, Korea)에서 35 cycle를 실시하였으며, 변성(denaturation)은 94℃에서 30초, 결합(annealing)은 58℃에서 30초, 그리고 신장(extension)은 72℃에서 40초간 수행하였다(Jin et al. 2016). 증폭된 PCR 생성물은 QiAxcel Advanced System (Qiagen, Hilden, Germany)을 이용하여 확인하였다. 또한, 1.2% agarose gel 상에서 100 V로 30분 동안 전기영동 하여 확인된 PCR 증폭 산물은 Jin et al. (2018)의 방법에 따라서 GeneAll® Gel 정제 kit (GeneAll Biotechnology, Co., Seoul, Korea)를 사용하여 정제하였으며, pLUG-Prime® TA-Cloning Vector kit (iNtRON, Korea)를 이용하여 클로닝 하였다. 클로닝 된 PCR 산물들은 ㈜ 솔젠트(Solgent, Co., Daejeon, Korea)에 의뢰하여 염기서열에 대한 정보들을 결정하였다.
염기서열 상동성 조사와 계통분석
중국 의창지와 ‘인창귤’간 유전적 유연관계 및 ‘인창귤’의 기원을 조사하기 위하여, 유연관계 및 계통분석은 엽록체 trnL-trnF 영역과 핵 Ribosomal DNA ITS의 염기서열을 이용하여 수행하였다. 감귤류 총 30종의 염기서열 정보는 미국 국립생물정보센터(www.ncbi.nlm.nih.gov)의 NCBI blast 프로그램을 이용한 상동성 조사를 통하여 등록된 trnL-trnF 영역과 ITS 영역의 서열 정보(Table 1 and Supplementary Table 1)를 사용하였고, 모든 감귤의 염기서열은 Fasta format으로 전환한 후 Bioedit (Hall 1999)로 편집하였으며 no gap으로 정렬한 후 multi Clustal W로 정렬한 후 저장하였다. 계통학적 분석은 Jin et al. (2016)에 따라서 MEGA 5.0 프로그램을 사용하였고, 유전적 거리 계산은 Maximum composite Likelihood를 이용하였으며. Maximum Likelihood (ML)기법으로 분계도를 작성하였다. 그리고, Bootstrap 값은 1,000회 반복하여 수행하였다.
형태학적 특징
오랜 기간 동안 제주에서 재배되고 있는 ‘인창귤’은 현재까지 학명이 불명확하며 중국의 의창지(Citrus ichangenesis ‘Ichangensis’)로 오인하여 동일한 학명으로 불려지고 있다(Lee et al. 2005, Sun et al. 2015). 따라서 형태학적 특성은 중국이 원산지인 의창지와 제주에서 재배되어 온 ‘인창귤’간 비교 분석하였다. 그 결과 중국 의창지 품종은 엽병에 날개가 있고 넓게 퍼져 있는 모양을 갖고 있는 papeda 그룹에 속하며(Hong et al. 2016, Nicolsi 2007, Yang et al. 2017) 탱자나무처럼 가지에 가시가(spines) 형성된 특징을 갖고 있다(Yang et al. 2017)(Fig. 1A). 반면, ‘인창귤’은 엽병의 날개가 없거나 좁은 특성을 갖고 있으며 가지에 가시가 없는 형태학적 특징(Fig. 1B)을 갖고 있다. 따라서, ‘인창귤’은 형태학적 특성에 있어서 중국 의창지 품종과는 달리 일반 감귤류의 형태적 특성을 갖고 있음을 알 수 있었다. 즉, 이 두 품종은 동일한 품종으로 보기는 힘들 것으로 판단된다.
엽록체 trnL-trnF intergenic spacers와 ITS 영역의 염기서열분석
중국 의창지 품종과 ‘인창귤’간 유연관계 및 기원 그리고 재래감귤 및 일반 감귤 품종들간의 계통학적 유연관계 분석을 위한 염기서열 분석은 엽록체 trnL-trnF 영역 그리고 ITS1, ITS2와 ITS (ITS1+5.8S rDNA+ITS2) 전체 영역의 프라이머 조합을 이용하여 PCR를 수행하였다. 그 결과 Fig. 2에서 보는 것처럼 중국 의창지와 ‘인창귤’의 엽록체 trnL-trnF 영역의 PCR 증폭산물은 약 400-500 bp (Fig. 2A: C6 and C7 line)로 나타났으며 ITS1 (Fig. 2B: C6 and C7 line)과 ITS2 (Fig. 2C: C6 and C7 line) 영역은 각각 약 225-300 bp, 전체 영역(Fig. 2D: C6 and C7 line)은 약 600-700 bp로 얻어졌다. 위 결과는 이전 연구 결과들(Jin et al. 2016, 2018)과 유사하였다.
이 두 품종의 증폭산물에 대한 염기서열 정보를 분석한 결과엽록체 trnL-trnF intergenic spacers 영역을 포함한 염기서열은 466 bp (trnL-trnF intergenic spacers 영역은 373 bp)로 이 두 품종들의 염기서열 길이는 모두 동일하였다(Figs. 3C, 3D, Table 3). 이전 연구자들(Jin et al. 2018, Jung et al. 2005)에 의하면 감귤류 28종 혹은 21종의 trnL-trnF intergenic spacers 영역의 염기서열 길이는 371 혹은 372 bp라고 하였으나 본 연구 결과 중국 의창지품종과 ‘인창귤’의 염기서열 길이는 373 bp로 이전 연구 결과들이 보고한 감귤 품종들의 염기서열 길이와는 다른 결과를 얻을 수 있었다.
또한, 전체 ITS 영역 내 5.8S rDNA의 염기서열 길이는 163 bp로 동일하였지만 ITS1과 2 영역의 염기서열 길이는 두 품종 간 차이를 나타내었다(Table 3). 즉, ITS1 영역의 염기서열 길이는 각각 247, 248 bp, ITS2는 228, 226 bp, 전체 영역의 염기서열 길이는 638, 637 bp로 이 두 품종 간 염기서열 길이의 차이를 보였다(Fig. 3, Tables 1, 2). 또한, 염기서열에 대한 G (구아닌) 그리고 C (시토신)의 함량을 분석한 결과 엽록체 trnL-trnF intergenic spacers와 5.8S rDNA의 영역은 두 품종 모두 각각 36.73%와 54.6%로 동일하였지만 ITS1와 2 그리고 전체 ITS (ITS1+5.8S rDNA+ITS2) 영역은 각각 71.26, 70.16와 5.85, 54.60%, 그리고 70.93, 67.08%로 서로 약간의 차이를 나타내었다(Table 3).
게다가, 감귤류 30종의 염기서열에 대한 변이 및 유효성을 검증한 결과 Table 3에서 보는 바와 같이 염기의 변이가 없이 보존되는 site는 각각 359, 214, 205 그리고 566개로 나타났으며, 염기의 변이를 보이는 site는 13, 34, 24, 72개 였으며 그 중 2, 8, 13, 그리고 25개의 염기가 각각 유전학적으로 유효한 것으로 확인되었다(Table 4).
반면, 5.8S rDNA는 유효한 염기가 없는 것으로 나타났는데(Table 4). 일반적으로 rDNA 중 5.8S coding region은 염기수의 길이가 짧고, 매우 보전적인 부위이기 때문에 진화 속도가 느린 과(family) 이상의 상위 분류균의 계통학적 친화관계를 연구하는데 활용된다(Han et al. 2006). 따라서, 본 연구와 같이 염기의 변이가 거의 없는 품종간 유효도 조사에서 유효 염기의 수가 없는 결과를 얻은 것으로 판단된다(Chung et al. 1999).
현재까지 중국 의창지 품종과 ‘인창귤’을 포함한 연구 결과가 없다 보니 비교 분석할 기초 자료가 없으며 위 결과는 최초의 연구 결과라고 판단할 수 있다. 비록 이전 연구에서(Jin et al. 2018) 이 두 품종을 제외한 연구 결과는 있으나 중국 의창지 품종과 ‘인창귤’을 포함한 감귤류에 대한 유전학적 연구 결과가 없다 보니 본 연구 결과와 비교 분석하는 것은 불가능하다고 판단된다.
엽록체 trnL-trnF intergenic spacers (IGS) 영역의 유전적 유연관계 및 계통학적 분석
재래감귤과 같이 오랜 기간 동안 재배되어온 ‘인창귤’의 정확한 기원 규명을 위하여, 중국 의창지 품종을 포함한 전체 30종의 감귤류에 대한 모계유전 여부는 엽록체 trnL-trnF intergenic spacers 영역의 염기서열(Table 1 and Supplementary Table 1)을 기초로 하여 분기값(Sequence divergency)을 계산하였다. 그 결과 감귤류의 엽록체 상 trnL-trnF intergenic spacers 영역에 대한 분기값은 Table 5에서 보는 것처럼 0-0.014로 다양하게 나타났으며, ‘인창귤’ 과의 분기값은 ‘편귤’(‘Pyunkyool’)를 비롯한 재래감귤 5품종[‘감자’(‘Kamja’), ‘당유자’(‘Dangyooja’), ‘지각’(‘Jikak’), ‘유자’(‘Yuzu’), ‘병귤’(‘Byungkyool’)], 중국 의창지(‘Ichangensis’) 품종 그리고 일반 감귤류 5품종[문단(‘Shatianyou’), ‘자몽’(‘Marsh’), ‘유레카’레몬(‘Cook Eureka’ lemon), ‘워싱톤 네블’ 오렌지(‘Washington navel’)]들 총 11품종이 0으로 유전적 유연관계가 가장 가깝게 나타났으며, 다음으로 감귤류 8품종[‘윌킹’ 만다린(‘Wilking’), ‘부지화’(‘Shiranuhi’), ‘신예감’(‘Shinyegam’), ‘궁천조생’(‘Myagawa wase’), ‘탐나는봉’(‘Tamnanuenbong’), ‘노바’ 만다린(‘Nova’), ‘청견’(‘Kiyomi’), ‘햄린’ 오렌지(‘Hamlin’)], 탱자속(‘Trifoliate orange’) 1품종 그리고 재래감귤 5품종[‘청귤’ (‘Cheongkyool’), ‘진귤’(‘Jinkyool’), ‘동정귤’(‘Dongjeongkyool’), ‘빈귤’(‘Binkyool’), ‘홍귤’(‘Hongkyool’)] 총 14품종 들과는 0.003로 염기서열 다양성 정도가 낮았다. 반면 감귤류 2품종[‘하례조생’(‘Haryejosaeng’), ‘암기조생’(‘Iwasaki wase’)]은 0.005, ‘라임’(‘Taveres’)과 ‘장수금감’(‘Ovale Kumquat’)과는 0.008로 염기서열 다양성 정도가 가장 높았다. 즉, 이 4품종들은 ‘인창귤’ 품종과 유전적으로 상이한 품종이라는 것을 알 수 있으며 근연 관계가 멀다는 것을 알 수 있었다.
엽록체 trnL-trnF intergenic spacers 영역에 대한 염기서열 자료를 기초로 한 감귤류들의 품종 간 분자계통학적 분석은 Maxium Likelihood기법으로 조사하였다. 그 결과 Fig. 4에서 보는 바와 같이 GroupI과 GroupII의 2개 분류군으로 나눌 수 있으며, 7개의 하위그룹으로 나눌 수 있다. 특히, 중국 위창지 품종과 ‘인창귤’은 GroupI내 Gp6에 속하며 엽록체 상 유전적으로 동일한 근연관계를 나타내었다(Fig. 4). 즉, 이 두 품종은 동일한 모계로부터 유전된 품종 임을 확인 할 수 있었다. 일반적으로 감귤에서 모계 기원을 판별을 함에 있어 세포질 내 엽록체 영역인 trnL-F 유전자 영역이 주로 사용되고 있는데(Jung et al. 2005, Jin et al. 2018), 현재 엽록체 영역의 염기서열을 이용한 감귤류 품종 간 유전적 분석 자료 중 중국 의창지 품종과 ‘인창귤’ 을 포함한 연구 결과는 없는 상태이다.
따라서, 본 연구결과와 비교 분석할 수 없었다. 단지, Nicolosi et al. (2000)의 보고에 의하면 중국 의창지 품종은 만다린과 ‘홍귤’ 등 ‘동정귤’의 조상이라고 하였는데 본 연구 결과에서도 이와 비슷한 결과를 얻을 수 있었다.
ITS (ITS1, 5.8S rDNA, ITS2, total ITS) 영역의 유전학적 유연관계 분석
중국 의창지 품종을 포함한 전체 30종의 감귤류에 대한 교잡에 따른 핵 염색체상에서 유전적 유연관계 분석은 ITS1, 5.8S rDNA, ITS2 그리고 전체 ITS (ITS1+5.8S rDNA+ ITS2) 영역에 대한 염기서열(Table 1, Supplementary Table 1)을 기초로 하여 분기값(Sequence divergency)을 계산하였다. 먼저 핵 염색체 상 감귤류의 ITS1영역 분기값은 Table 5에서 보는 것처럼 0-0.04로 다양하게 나타났으며, ‘인창귤’과의 분기값은 감귤류 3 품종[‘부지화’, ‘암기조생’, ‘궁천조생’]과 0으로 유전적으로 가장 근연 관계가 가깝게 나타났으며, 라임 품종과는 0.03으로 가장 높게 나타났다(Table 6). 반면 중국 의창지 품종과는 0.026으로 라임 품종 다음으로 염기서열 다양성 정도가 높았다(Table 6). 즉, 이들 품종들은 ‘인창귤’과 유전적 근연 관계가 멀다는 것을 확인 할 수 있었다.
다음으로, 5.8S rDNA 영역의 분기값은 Table 7에서 보는 것처럼 0-0.012로 다양하게 나타났으나 ‘인창귤’과의 분기값은 0-0.006으로써 감귤 품종 간 염기서열적 근연 관계 변화가 거의 없음을 확인 할 수 있었다. 즉, 위 결과는 이전 연구자들(Chung et al. 1999, Han et al. 2006)이 제시한 것처럼 본 연구와 같이 염기의 변이가 거의 없는 품종 간 유전적 근연관계을 비교 분석하는 데에는 적합하지 않다고 사료된다.
세번째로, 핵 염색체 상 감귤 품종들 간 ITS2영역 분기값은 Table 8에서 보는 것처럼 0-0.051로 다양하게 나타났으며, 특히 ‘인창귤’과의 분기값은 0-0.037로써 감귤류 30종 중 ‘하례조생’, ‘신예감’, ‘동정귤’들과 0으로써 유전적으로 가장 근연관계가 있었으며 ‘신예감’과는 0.037로써 가장 멀게 나타났으며 중국 의창지 품종 과는 0.027로써 유전적 근연관계가 멀게 나타났다.
마지막으로, 전체 ITS 영역(ITS1+5.8S rDNA+ ITS2)을 포함하는 ITS영역의 염기서열의 분기값은 Table 9에서 보는 것처럼 0-0.03까지 나타났으며, ‘인창귤’과의 분기값은 ‘동정귤’이 0.008로써 다른 품종들에 비교하여 유전적으로 가장 근연관계가 있음이 확인되었다. 반면, 중국 의창지 품종과는 0.019로 멀게 나타났으며 금귤 품종과는 0.023으로써 가장 멀게 나타났다. 일반적으로 식물의 계통분류 및 발생 연구에 있어 ITS1, 5.8S rDNA 그리고 ITS2 영역들이 주로 많이 사용되고 있는데(Bae 2010) 이 중 ITS1 부위보다는 ITS2 부위 변이율이 높은 것으로 보고되고 있어(Jin et al. 2016, Raveendar et al. 2015a, Raveendar et al. 2015b, Yao et al. 2010) 주로 ITS2 영역의 염기서열을 이용한 연구들이 보고되고 있다. 하지만 본 연구 결과 이전 연구자(Sun et al. 2005)가 감귤류 종 분류에 있어서 ITS1과 ITS2 부위 모두 높은 변이를 보였다고 한 결과와 비슷한 결과를 얻을 수 있었다.
위 모든 결과로 종합해 보았을 때 ‘인창귤’은 중국 의창지 품종과 같은 학명을 사용하는 것은 잘못된 판단인 것 같다. 이는 ‘인창귤’에 대한 정확한 기원이 없다 보니 재래감귤류와 같이 포함하여 취급하고 있으며 따라서 중국 의창지와 같은 학명을 사용한 것이 아닌가 추론해 볼 수 있다. 하지만 본 연구 결과 ‘인창귤’은 재래감귤 중 ‘동정귤’과의 교배를 통하여 얻어진 품종일 가능성이 있다고 판단된다.
전체 ITS (ITS1+5.8S rDNA+ ITS2)영역의 분자계통학적 분석
GenBank에 등록된 중국 의창지 품종을 포함한 전체 30종의 감귤류들과 Sun et al. (2015)이 제시한 추정 인창귤(Accession No. JQ990182)들에 대한 ITS (ITS1, 5.8S rDNA, ITS2, ITS1+5.8S rDNA+ ITS2) 영역 염기서열 자료를 기초로 한 계통수 분석은 Maxium Likelihood기법으로 조사하였다. 먼저 TS1 영역에 대한 염기서열 자료를 기초로 한 분자계통학적 분석 결과는 Fig. 5A에서 보는 봐와 같이 GroupI과 GroupII의 2개 분류군으로 나눌 수 있으며, 12개의 하위그룹으로 나눌 수 있는데, 위 결과에서 보듯이 중국 의창지 품종과 ‘인창귤’ 간 ITS1 영역은 유전적 차이가 많이 나타나는 것을 관찰 할 수 있었다. 중국 의창지 품종과 ‘인창귤’은 동일한 분류군 GroupI에 속하지만 하위 그룹에 있어서 차이를 나타내었다. 즉, 중국 의창지 품종은 금귤 그리고 ‘병귤’과 같은 Gp7의 하위 그룹에 속하는 반면 ‘인창귤’은 온주밀감(‘궁천조생’) 품종과 같은 Gp11의 하위 그룹에 속하는 결과를 얻었다(Fig. 5A). 반면에 Sun et al. (2015)이 제시한 인창귤 추정 품종은 중국 의창지 품종과 같은 하위 그룹에 속한다는 것을 알 수 있었다.
또한, 5.8S rDNA 영역에 대한 염기서열 자료를 기초로 한 계통수를 조사한 결과는 Fig. 5B에서 보는 바와 같이 GroupI과 GroupII의 2개 분류군으로 나눌 수 있으며, 8개의 하위그룹으로 나눌 수 있었다. 게다가, 중국 의창지 품종과 ‘인창귤’ 그리고 이전 연구자(Sun et al. 2015)가 제시한 추정 인창귤 간에 유전적으로 동일한 근연관계를 나타내었다(Fig. 5B). 즉, 5.8S rDNA 영역의 염기서열을 이용한 계통 분석은 과(family)가 아닌 품종 간 구별에는 한계가 있어(Chung et al. 1999) 본 연구에는 적합하지 않다고 판단되었다.
다음으로, ITS2 영역에 대한 염기서열 자료를 기초로 하여 분자계통학적 분석을 수행한 결과 Fig. 5C에서 보는 바와 같이 GroupI과 GroupII의 2개 분류군으로 나눌 수 있으며, 12개의 하위그룹으로 나눌 수 있었다(Fig. 5C). 게다가, 중국 의창지 품종과 ‘인창귤’간 ITS2 영역에 있어서 유전적 차이가 많이 나타나는 것을 관찰 할 수 있으며, 중국 의창지 품종과 ‘인창귤’은 동일한 분류군 GroupI에 속하지만 하위 그룹에 있어서 차이를 나타내었다. 중국 의창지 품종은 ‘유자’들과 같은 Gp1의 하위 그룹에 속하는 반면 ‘인창귤’은 ‘동정귤’과 같은 G8의 하위 그룹에 속하는 결과를 얻었다(Fig. 5C). 반면 Sun et al. (2015)가 제시한 추정 인창귤은 독립된 Gp 2의 하위 그룹에 속한다는 것을 알 수 있었다.
마지막으로, 전체 ITS (ITS1+5.8S rDNA+ ITS2) 영역에 대한 염기서열 자료를 기초로 하여 분자계통학적 분석을 수행한 결과 Fig. 5D에서 보는 바와 같이 GroupI과 GroupII의 2개 분류군으로 나눌 수 있으며, 14개의 하위그룹으로 나눌 수 있었다(Fig. 5D). 위 결과에서 보듯이 중국 의창지 품종과 Sun et al. (2015)이 제시한 추정 인창귤과 ‘인창귤’ 간 전체 ITS 영역 유전적 차이가 많이 나타나는 것을 관찰 할 수 있었다. 중국 의창지 품종과 Sun et al. (2015)이 제시한 추정 인창귤은 GroupI에 속하면서 단독으로 Gp3 혹은 Gp6의 하위 그룹에 속하는 반면 ‘인창귤’은 GroupII에 속하면서 역시 단독으로 Gp12의 하위 그룹에 속하는 결과를 얻었다(Fig. 5D). 위 결과에서 보듯이 중국 의창지 품종은 파페다 품종인 ‘유자’(Hong et al. 2016)과 같은 그룹에 속하는 품종인 반면 ‘인창귤’은 재래 감귤 중 ‘동정귤’과 연관이 있다는 것을 알 수 있었다. Sun et al. (2015)의 보고에 따르면 ITS 영역을 이용한 계통학적 분석 결과 추정 ‘인창귤’ 감귤은 ‘동정귤’ 과 유전적으로 근연 관계에 있음을 알 수 있었는데, 본 연구에서도 동일한 결과를 얻을 수 있었다. 또한 이전 연구자들(Jeong et al. 2018, Yang et al. 2019, Woo et al. 2019)에 의하면 ‘동정귤’ 과 ‘인창귤’은 동일한 만다린 그룹에 속한다고 하였는데 본 연구에서도 동일한 결과를 얻을 수 있었다.
따라서, 본 연구 결과로 우리는 현재까지 ‘인창귤’을 중국 의창지로 오인하여 잘못된 학명을 쓰고 있음이 판단되며 본 결과를 기초로 하여 ‘인창귤’에 대한 명확한 학명을 제시할 수 있는 기초자료로 사용할 수 있을 것으로 사료된다.
오랜 기간 동안 제주도 내에서 재배되어온 것으로 추정되는 ‘인창귤’은 레몬향기를 갖는 잎과 꽃을 가지고 있으며, 중국의 남서부 및 중서부가 원산지로 알려진 중국 의창지(Citrus inchangenesis ‘Ichangensis’) 품종과 동일한 학명으로 불려지고 있다. 하지만 이와 관련된 자세한 연구자료들은 보고되어 있지 않은 실정이다. 따라서 본 연구는 중국 의창지 품종과 ‘인창귤’ 간의 유연관계 및 기원 규명을 위하여 전체 30종의 감귤류의 엽록체 cpDNA (trnL-trnF) 영역과 핵 ribosomal DNA ITS 영역을 이용한 실험을 수행하였다. 그 결과 중국 의창지 품종과 ‘인창귤’의 엽록체 DNA내 trnL-trnF intergenic spacers (IGS) 영역 총 염기서열 길이는 373 bp, G+C 함량은 36.73%로 동일한 결과를 나타내었다. 반면, ITS1 영역은 각각 247, 248 bp였고, ITS2 영역은 각각 228, 226 bp였으며 전체 ITS (ITS1+5.8S rDNA+ ITS2) 영역은 각각 638, 637 bp로 염기상 차이점을 나타내었다. 게다가 G+C 함량 또한 각각 70.16, 71.26, 69.03, 70.61, 64.6, 65.49%로 핵 Ribosomal DNA 영역 상에서 차이점이 확인되었다. 반면 5.8S rDNA 영역의 염기서열 길이는 163 bp로 두 품종 모두 동일하였으며 G+C 함량 또한 54.6%로 동일 하였다. 또한, 엽록체 DNA내 trnL-trnF 영역과 ITS 영역의 염기서열을 이용하여 분기값과 계통관계를 분석한 결과 엽록체 상 trnL-trnF 영역의 분기값은 0-0.008로 나타났으며 동정귤를 비롯한 재래감귤 8품종, 중국 의창지 품종 그리고 일반 감귤류 6 품종들과 0으로 유전적 유연관계가 가장 가깝게 나타났다. 즉, ‘인창귤’은 중국의 의창지 품종과 동일 모계로부터 유전되었음을 알 수 있었다. 반면, 핵 Ribosomal DNA 영역의 분기값은 ‘동정귤’과 0.008로 가장 근연관계가 있었으며 중국 의창지 품종과는 0.026으로 멀게 나타났다. 또한, 계통학적 유연관계는 재래감귤 중 ‘동정귤’ 과 동일 그룹에 속하며 중국 의창지 품종과는 다른 분류군으로 나타났다. 따라서 본 연구 결과에서 ‘인창귤’은 중국의 의창지 품종과는 동일 모계 품종으로부터 유전되었으며, ‘동정귤’과 같은 계통들과의 오랜 기간 교배를 통하여 얻어진 품종이라는 것을 알 수 있었다. 또한, 본 연구결과를 기초로 하여 ‘인창귤’에 대한 명확한 품종명을 제시할 수 있을 것으로 사료된다.
키워드: 의창지, 인창귤, 분기값, 계통 분석, 동정귤
본문의 Supplementary Table 1은 육종학회지 홈페이지에서 확인할 수 있습니다.
kjbs-53-1-16-supple.pdf
본 연구는 농촌진흥청 연구사업(PJ01446603)과 박사 후 연구원 지원 프로그램에 의해 수행되었음.
Fig. 1
Morphological feature of and Citrus ichangenesis ‘Ichangensis’ in China (A) and ‘Inchangkyul’ in Jeju island (B).
kjbs-53-1-16-f1.jpg
Fig. 2
PCR amplification using the chloroplast trnL-trnF spacer region and nuclear internal transcribed spacer regions of 30 Citrus cultivars (A and D). Polyacrylamide gel electrophoresis using the QiAxcel Advanced System (Qiagen); A: PCR fragment using chloroplast trnL-trnF primer set, B: PCR fragment using ITS1 primer set, C: PCR fragment using ITS2 primer set, D: PCR fragment using total ITS (ITS1 + 5.8S rDNA + ITS2) region primer set; A1: molecular marker (20 bp and 100 bp DNA ladder, Qiagen); A2: ‘Sativa you’; A3: ‘Tavares’; A4: ‘Wilking’; A5: ‘Haryejosaeng’; A6: ‘Shiranuhi’; A7: ‘Ovale Kumquat’; A8: ‘Marsh’; A9: ‘Shinyegam’; A10; ‘Trifoliate orange’ A11: ‘Iwasaki wase’; A12: ‘Myagawa wase’; B1: ‘Tamnanuenbong’; B2: ‘Cook Eureka’; B3: ‘Cheongkyool’; B4: ‘Dangyooja’; B5: ‘Jinkyool’; B6: ‘Pyunkyool’; B7: ‘Dongjeongkyool’; B8: ‘Kamja’; B9: ‘Jikak’; B10: ‘Yuzu’; B11: ‘Binkyool’; B12: ‘Hongkyool’; C1: ‘Byungkyool’; C2: ‘Nova’; C3: ‘Washington navel’; C4: ‘Hamlin’; C5: ‘Kiyomi’; C6: ‘Inchangkyul’; C7: ‘Ichangensis’.
kjbs-53-1-16-f2.jpg
Fig. 3
Nucleotide sequences of the ITS and chloroplast trnL-trnF regions. Citrus inchangenesis ‘Ichangensis’ ITS rDNA region A); ‘Inchangkyul’ ITS rDNA region B); Citrus inchangenesis ‘Ichangensis’ chloroplast including trnL-trnF intergenic spacers regions C); ‘Inchangkyul’ chloroplast including trnL-trnF intergenic spacers regions D). Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ was harvested in Jeju Native Citrus Research. Box indicates the primer sites used for sequence analysis.
kjbs-53-1-16-f3.jpg
Fig. 4
Phylogenic tree about total 30 genotypes including 11 of Jeju native cultivars, Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’ and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast trnL-trnF intergenic spacers (IGS) region sequence data by Maxium Likelihood (ML.). The red dotted line indicates ‘Inchankgyul’,the red box indicates Citrus ichangenesis ‘Ichangensis’.
kjbs-53-1-16-f4.jpg
Fig. 5
Phylogenic tree about total 31 genotypes including 11 of Jeju native cultivars,.Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’, putative ‘Inchankgyul’ (Accession No. JQ990182), and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast ITS (ITS1, 5.8S rDNA, ITS2, ITS1+5.8S rDNA+ ITS2) region sequence data by Maxium Likelihood (ML.): Phylogenic tree constructed using sequences of the ITS1 region (A); Phylogenic tree constructed using sequences of the 5.8S rDNA region (B); Phylogenic tree constructed using sequences of the ITS2 region (C); Phylogenic tree constructed using sequences of the total ITS (ITS1+5.8S rDNA+ ITS2) region (D). The blue box indicates putative ‘Inchankgyul’ (Accession No. JQ990182), The red box indicates ‘Inchankgyul’, The red dotted line indicates Citrus ichangenesis ‘Ichangensis’.
kjbs-53-1-16-f5.jpg
Table 1
List of 30 Citrus cultivars used in this study and their numbers.
Table 1
No. Cultivar trnL-F region ITS region
Common name Scientific name accession number accession number
1 ‘Sativa you’ pomelo Citrus grandis (L.) Osbeck grp 7848271z MG702205
2 ‘Tavares’ lime Citrus aurantifolia × Fortunella margarita grp 7848271 MG702227
3 ‘Wilking’ mandarin Citrus reticulata grp 7848271 MG702212
4 ‘Haryejosaeng’ Citrus unshiu Marc. grp 7848271 MG702222
5 ‘Shiranuhi’ (Citrus unshiu × Citrus sinensis) × Citrus reticulata grp 7848271 MG702207
6 ‘Ovale Kumquat’ Citrus japonica var. margarita grp 7848271 MG702225
7 ‘Marsh’ grapefruit Citrus paradisi grp 7848271 MG702214
8 ‘Shinyegam’ (Citrus unshiu × Citrus sinensis) × Citrus Citrus reticulata grp 7848271 MG702209
9 ‘Trifoliate orange’ Citrus trifoliata grp 7848271 MG702226
10 ‘Iwasaki wase’ Citrus unshiu Marc. grp 7848271 MG702210
11 ‘Myagawa wase’ Citrus unshiu Marc. grp 7848271 MG702201
12 ‘Tamnanuenbong’ Citrus reticulata grp 7848271 MG702220
13 ‘Cook Eureka’ lemon Citrus limon L. Burm.f. grp 7848271 MG702204
14 ‘Cheongkyool’ Citrus nippokoreana grp 7848271 MG702219
15 ‘Dangyooja’ Citrus grandis Osbeck grp 7848271 MG702202
16 ‘Jinkyool’ Citrus sunki Hort. ex Tanaka grp 7848271 MG702217
17 ‘Pyunkyool’ Citrus tangerina Hort. ex Tanaka grp 7848271 MG702221
18 ‘Dongjeongkyool’ Citrus erythrosa Hort. et Tanaka grp 7848271 MG702203
19 ‘Kamja’ Citrus benikoji Hort. ex. Tanaka grp 7848271 MG702199
20 ‘Jikak’ Citrus aurantium L. grp 7848271 MG702216
21 ‘Yuzu’ Citrus junos Sieb. ex Tanaka grp 7848271 MG702198
22 ‘Binkyool’ Citrus leiocarpa grp 7848271 MG702208
23 ‘Hongkyool’ Citrus tachibana Tanaka grp 7848271 MG702224
24 ‘Byungkyool’ Citrus platymamma Hort. et Tanaka grp 7848271 MG702206
25 ‘Nova’ mandarin Citrus reticulata grp 7848271 MG702200
26 ‘Washington navel’ orange Citrus sinensis grp 7848271 MG702211
27 ‘Hamlin’ sweet orange Citrus sinensis grp 7848271 MG702253
28 ‘Kiyomi’ tangor Citrus reticulata grp 7848271 MG702218
29 ‘ Inchangkyul’ - grp 7848271 MG702215
30 ‘Ichangensis’ Citrus ichangenesis grp 7848271 MG702213

zNumber submitted to Genbank

Table 2
Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.
Table 2
No. Amplification region Primer name Primer sequence (5'->3') Length Tmz (℃) GC (%)
1 trnL-trnF trnL-F AAAATCGTGAGGGTTCAAGTC 21 53 42.9
trnF-R GATTTGAACTGGTGACACGAG 21 53.7 47.6
2 ITS1 ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS1R GAGAGTCGTTTTGGATACATGTGAAAGAAG 30 57.5 40.0
3 ITS2 ITS2F CTGCCTGGGTGTCACGCATCGTTGCCCCAC 30 70.6 66.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0
4 ITS (ITS1+5.8S rDNA +ITS2) ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0

zTM value: https://sg.idtdna.com/calc/analyzer

Table 3
Sequence length and G+C content (%) of the trnL-trnF intergenic spacers and ITS region genes and comparison between Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ cultivars.
Table 3
Cutivar Sequence length (bp) G+C content (%)
trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2) trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2)
Citrus ichangenesis ‘Ichangensis’z 373 247 163 228 638 36.73 71.26 54.6 70.61 65.49
‘Inchangkyul’y 373 248 163 226 637 36.73 70.16 54.6 69.03 64.6

zIt is Citrus ichangensis harvested in Citrus Research Institute.

y‘Inchangkyul’ cultivar using in this study was harvested in Citrus Research Institute.

Table 4
Genetic diversity of the trnL-trnF intergenic spacers and ITS region genes between 30 Citrus varieties.
Table 4
Cutivar Sequence (bp)
C V PI
trnL-trnF intergeinc spacers 359/372 13 2
ITS1 214/250 34 8
5.8 S rDNA 155/163 8 none
ITS2 205/235 24 13
ITS (ITSI+5.8S rDNA+ITS2) 574/648 66 21
Table 5
Sequence divergences in the Chloroplast trnL-trnF intergenic spacers (IGS) gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.
Table 5
No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou
2 Tavares 0.008
3 Wilking 0.003 0.011
4 Haryejosaeng 0.005 0.014 0.003
52 Shiranuhi 0.003 0.011 0.000 0.003
6 Ovale_Kumquat 0.008 0.011 0.011 0.014 0.011
7 Marsh 0.000 0.008 0.003 0.005 0.003 0.008
8 Shinyegam 0.003 0.011 0.000 0.003 0.000 0.011 0.003
9 Trifoliate_orange 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005
10 Iwasaki_wase 0.005 0.014 0.003 0.005 0.003 0.014 0.005 0.003 0.008
11 Myagawa_wase 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003
12 Tamnanuenbong 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000
13 Cook_Eureka 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003
14 Cheongkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003
15 Dangyooja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003
16 Jinkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003
17 Pyunkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003
18 Dongjeongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003
19 Kamja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003
20 Jikak 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000
21 Yuzu 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000
22 Binkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003
23 Hongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005
24 Byungkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003
25 Nova 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003
26 Washington_navel 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003
27 Hamlin 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.005 0.003
28 Kiyomi 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.000 0.003 0.005
29 Inchangkyul 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003
30 Ichangensis 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 372 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 6
Sequence divergences in the ITS1 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.
Table 6
No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.039
3 Wilking(MG702212) 0.008 0.040
4 Haryejosaeng(MG702222) 0.030 0.035 0.030
52 Shiranuhi(MG702207) 0.025 0.030 0.026 0.021
6 Ovale_Kumquat(MG702225) 0.035 0.040 0.036 0.022 0.026
7 Marsh(MG702214) 0.026 0.030 0.026 0.004 0.017 0.017
8 Shinyegam(MG702209) 0.008 0.039 0.008 0.021 0.025 0.035 0.017
9 Trifoliate_orange(MG702226) 0.030 0.035 0.030 0.026 0.021 0.031 0.021 0.030
10 Iwasaki_wase(MG702210) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021
11 Myagawa_wase(MG702201) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000
12 Tamnanuenbong(MG702220) 0.035 0.040 0.035 0.030 0.008 0.036 0.026 0.035 0.030 0.008 0.008
13 Cook_Eureka(MG702204) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030
14 Cheongkyool(MG702219) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004
15 Dangyooja(MG702202) 0.008 0.039 0.008 0.030 0.025 0.035 0.026 0.008 0.030 0.025 0.025 0.035 0.030 0.026
16 Jinkyool(MG702217) 0.030 0.035 0.031 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.031 0.008 0.004 0.030
17 Pyunkyool(MG702221) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008
18 Dongjeongkyool(MG702203) 0.004 0.035 0.004 0.026 0.021 0.031 0.021 0.004 0.026 0.021 0.021 0.030 0.026 0.021 0.004 0.026 0.026
19 Kamja(MG702199) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026
20 Jikak(MG702216) 0.013 0.035 0.013 0.026 0.021 0.031 0.021 0.013 0.026 0.021 0.021 0.030 0.026 0.021 0.013 0.026 0.026 0.008 0.026
21 Yuzu(MG702198) 0.030 0.035 0.030 0.008 0.013 0.022 0.004 0.021 0.026 0.013 0.013 0.021 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026
22 Binkyool(MG702208) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004
23 Hongkyool(MG702224) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000
24 Byungkyool(MG702206) 0.021 0.026 0.021 0.008 0.013 0.013 0.004 0.021 0.017 0.013 0.013 0.021 0.008 0.004 0.021 0.008 0.008 0.017 0.008 0.017 0.008 0.004 0.004
25 Nova(MG702200) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004
26 Washington_navel(MG702211) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004 0.000
27 Hamlin(MG702223) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026 0.008 0.004 0.004 0.008 0.004 0.004
28 Kiyomi(MG702218) 0.030 0.026 0.030 0.026 0.004 0.031 0.021 0.030 0.026 0.004 0.004 0.013 0.026 0.021 0.030 0.026 0.026 0.025 0.026 0.025 0.017 0.021 0.021 0.017 0.021 0.021 0.026
29 Inchangkyul(MG702215) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000 0.000 0.008 0.021 0.017 0.025 0.021 0.021 0.021 0.021 0.021 0.013 0.017 0.017 0.013 0.017 0.017 0.021 0.004
30 Ichangensis(MG702213) 0.035 0.040 0.035 0.021 0.026 0.026 0.017 0.035 0.031 0.026 0.026 0.035 0.021 0.017 0.035 0.021 0.021 0.030 0.021 0.030 0.021 0.017 0.017 0.013 0.017 0.017 0.021 0.030 0.026

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total o f 2 43 p ositions i n t he f inal d ataset. E volutionary a nalyses w ere c onducted i n M EGA5.

Table 7
Sequence divergences in the 5.8S rDNA gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.
Table 7
No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Satianyou(MG702205)
2 Tavares(MG702227) 0.012
3 Wilking(MG702212) 0.006 0.006
4 Haryejosaeng(MG702222) 0.012 0.012 0.006
52 Shiranuhi(MG702207) 0.006 0.006 0.000 0.006
6 Ovale_Kumquat(MG702225) 0.006 0.006 0.000 0.006 0.000
7 Marsh(MG702214) 0.006 0.006 0.000 0.006 0.000 0.000
8 Shinyegam(MG702209) 0.006 0.006 0.000 0.006 0.000 0.000 0.000
9 Trifoliate_orange(MG702226) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000
10 Iwasaki_wase(MG702210) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000
11 Myagawa_wase(MG702201) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
12 Tamnanuenbong(MG702220) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
13 Cook_Eureka(MG702204) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006
14 Cheongkyool(MG702219) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006
15 Dangyooja(MG702202) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.013 0.006
16 Jinkyool(MG702217) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006
17 Pyunkyool(MG702221) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000
18 Dongjeongkyool(MG702203) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000
19 Kamja(MG702199) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000
20 Jikak(MG702216) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000
21 Yuzu(MG702198) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006
22 Binkyool(MG702208) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006
23 Hongkyool(MG702224) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000
24 Byungkyool(MG702206) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000
25 Nova(MG702200) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000
26 Washington_navel(MG702211) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000
27 Hamlin(MG702223) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000
28 Kiyomi(MG702218) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
29 Inchangkyul(MG702215) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
30 Ichangensis(MG702213) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 163 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 8
Sequence divergences in the ITS2 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.
Table 8
No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.009
3 Wilking(MG702212) 0.004 0.014
4 Haryejosaeng(MG702222) 0.023 0.023 0.027
52 Shiranuhi(MG702207) 0.023 0.023 0.027 0.037
6 Ovale_Kumquat(MG702225) 0.032 0.023 0.037 0.027 0.046
7 Marsh(MG702214) 0.018 0.018 0.023 0.004 0.032 0.023
8 Shinyegam(MG702209) 0.004 0.014 0.000 0.027 0.027 0.037 0.023
9 Trifoliate_orange(MG702226) 0.032 0.032 0.037 0.018 0.046 0.027 0.013 0.037
10 Iwasaki_wase(MG702210) 0.027 0.027 0.032 0.042 0.004 0.051 0.037 0.032 0.051
11 Myagawa_wase(MG702201) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004
12 Tamnanuenbong(MG702220) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004 0.000
13 Cook_Eureka(MG702204) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032
14 Cheongkyool(MG702219) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000
15 Dangyooja(MG702202) 0.023 0.023 0.027 0.037 0.009 0.046 0.032 0.027 0.046 0.013 0.009 0.009 0.032 0.032
16 Jinkyool(MG702217) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032
17 Pyunkyool(MG702221) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014
18 Dongjeongkyool(MG702203) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027
19 Kamja(MG702199) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023
20 Jikak(MG702216) 0.018 0.027 0.023 0.013 0.042 0.032 0.009 0.023 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.023 0.009
21 Yuzu(MG702198) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.047 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.032 0.009 0.018
22 Binkyool(MG702208) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014 0.000 0.027 0.014 0.023 0.023
23 Hongkyool(MG702224) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014
24 Byungkyool(MG702206) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.004 0.032 0.009 0.018 0.018 0.004 0.009
25 Nova(MG702200) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009
26 Washington_navel(MG702211) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000
27 Hamlin(MG702223) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000 0.000
28 Kiyomi(MG702218) 0.018 0.018 0.023 0.032 0.009 0.042 0.028 0.023 0.042 0.014 0.009 0.009 0.028 0.028 0.014 0.028 0.032 0.023 0.028 0.037 0.037 0.032 0.028 0.037 0.028 0.028 0.028
29 Inchangkyul(MG702215) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027 0.000 0.023 0.023 0.032 0.027 0.023 0.032 0.023 0.023 0.023 0.023
30 Ichangensis(MG702213) 0.023 0.023 0.027 0.009 0.037 0.027 0.004 0.027 0.018 0.042 0.037 0.037 0.004 0.004 0.037 0.004 0.018 0.027 0.004 0.013 0.014 0.018 0.004 0.014 0.004 0.004 0.004 0.032 0.027

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 224 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 9
Sequence divergences in the total ITS gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.
Table 9
No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.021
3 Wilking(MG702212) 0.006 0.021
4 Haryejosaeng(MG702222) 0.023 0.024 0.023
52 Shiranuhi(MG702207) 0.019 0.021 0.019 0.023
6 Ovale_Kumquat(MG702225) 0.026 0.024 0.026 0.019 0.026
7 Marsh(MG702214) 0.018 0.019 0.018 0.005 0.018 0.015
8 Shinyegam(MG702209) 0.006 0.021 0.003 0.019 0.019 0.026 0.015
9 Trifoliate_orange(MG702226) 0.024 0.026 0.024 0.018 0.024 0.021 0.013 0.024
10 Iwasaki_wase(MG702210) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026
11 Myagawa_wase(MG702201) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026 0.003
12 Tamnanuenbong(MG702220) 0.023 0.024 0.023 0.026 0.003 0.030 0.021 0.023 0.028 0.005 0.005
13 Cook_Eureka(MG702204) 0.021 0.023 0.021 0.008 0.021 0.018 0.003 0.018 0.016 0.023 0.023 0.024
14 Cheongkyool(MG702219) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003
15 Dangyooja(MG702202) 0.015 0.026 0.015 0.028 0.014 0.031 0.023 0.015 0.029 0.016 0.016 0.018 0.026 0.023
16 Jinkyool(MG702217) 0.019 0.021 0.019 0.006 0.020 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.025
17 Pyunkyool(MG702221) 0.021 0.023 0.021 0.011 0.021 0.018 0.006 0.018 0.019 0.023 0.023 0.024 0.010 0.006 0.026 0.008
18 Dongjeongkyool(MG702203) 0.005 0.019 0.002 0.021 0.018 0.024 0.016 0.002 0.023 0.019 0.019 0.021 0.019 0.016 0.013 0.018 0.019
19 Kamja(MG702199) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018
20 Jikak(MG702216) 0.013 0.024 0.013 0.016 0.023 0.023 0.011 0.013 0.018 0.024 0.024 0.026 0.014 0.011 0.021 0.013 0.018 0.011 0.013
21 Yuzu(MG702198) 0.024 0.026 0.024 0.011 0.021 0.021 0.006 0.021 0.019 0.023 0.023 0.025 0.010 0.006 0.030 0.008 0.013 0.023 0.008 0.018
22 Binkyool(MG702208) 0.019 0.021 0.019 0.010 0.019 0.016 0.005 0.016 0.018 0.021 0.021 0.023 0.008 0.005 0.024 0.006 0.002 0.018 0.006 0.016 0.011
23 Hongkyool(MG702224) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005
24 Byungkyool(MG702206) 0.019 0.021 0.019 0.010 0.020 0.016 0.005 0.019 0.014 0.021 0.021 0.023 0.008 0.005 0.025 0.006 0.005 0.018 0.006 0.013 0.011 0.003 0.005
25 Nova(MG702200) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005
26 Washington_navel(MG702211) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005 0.000
27 Hamlin(MG702223) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018 0.003 0.013 0.008 0.006 0.002 0.006 0.002 0.002
28 Kiyomi(MG702218) 0.021 0.019 0.021 0.024 0.006 0.028 0.019 0.021 0.026 0.008 0.008 0.010 0.023 0.019 0.019 0.021 0.023 0.019 0.021 0.024 0.023 0.021 0.019 0.021 0.019 0.019 0.021
29 Inchangkyul(MG702215) 0.013 0.018 0.010 0.019 0.010 0.023 0.015 0.010 0.021 0.011 0.011 0.013 0.018 0.015 0.021 0.016 0.018 0.008 0.016 0.016 0.018 0.016 0.015 0.016 0.015 0.015 0.016 0.011
30 Ichangensis(MG702213) 0.023 0.024 0.023 0.013 0.023 0.019 0.008 0.023 0.018 0.024 0.024 0.026 0.011 0.008 0.028 0.010 0.014 0.021 0.010 0.016 0.014 0.013 0.008 0.010 0.008 0.008 0.010 0.025 0.019

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 630 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

  • Bae YM. 2010. Identification of a Carddus spp. showing anti-mycobacterial activity by DNA sequence analysis of its ITS1, 5.8S rRNA and ITS2. J Life Science 20: 578-583.
  • Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell CS, Donoghue MJ. 1995. The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Ann Mo Bot Gard 82: 247-277.
  • Barkley NA, Roose ML, Krueger RR, Federici CT. 2006. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Theor Appl Genet 112: 1519-1531.
  • Chung JW, Kim GY, Ha MG, Lee TH, Lee JD. 1999. Phylogenetic analysis of the genus phellinus by comparing the sequences of interal transcribed spacers and 5.8S ribosomal DNA. Kor J Mycol 27: 124-131.
  • Dugo G, Giacomo ADi. 2002. Citrus: the genus Citrus. medicinal and aromatic plants industrial profiles series. Taylor & Francis group, CRC Press. London, England:
  • Federici CT, Fang DQ, Scora RW, Roose ML. 1998. Phylogenetic relationships within the genus Citrus (Rutaceae) and related genera as revealed by RFLP and RAPD analysis. Theor Appl Genet 96: 812-822.
  • Gulsen O, Roose ML. 2001. Lemons: diversity and relationships with selected Citrus cultivars and species and comparison with related genera. Theor Appl Genet 72: 170-177.
  • Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95-98.
  • Han HS, Kim DY, Lee KY, Park WG, Cho IK, Jung JS. 2006. Comparative analysis of Acanthopanax senticosus Harms from Korea, China and Russia Based on the ITS sequences of nuclear ribosomal DNA. Korean J Plant Res 19: 54-58.
  • Hong JH, Chae CW, Choi KJ, Kwon YS. 2016. A database of simple sequence repeat (SSR) marker-based DNA rrofiles of Citrus and related cultivars and germplasm. Hortic Sci Technol 34: 142-153.
  • Huh MK, Yoon HJ, Choi JS. 2011. Phylogenic Study of Genus Citrus and Two Relative Genera in Korea by trnL-trnF Sequence. J Life Science 21: 1452-1459.
  • Jeong JY, Woo JK, Park YC, Park SM, Yun SH, Lee Y, Cho GH, Song KJ, Kim HB. 2018. Determination of R gene composition in a Ctv locus conferring citrus tristeza virus resistance from the genetic resources of citrus and its relatives. Plant Breed Biotech 6: 245-256.
  • Jin SB, Park JH, Park SM, Lee DH, Yun SH. 2016. Genetic phylogenetic relationship of the Jeju native Citrus 'Byungkyool' (Citrus platymamma Hort. ex Tanaka) using ITS (internal transcribed spacer) region of nuclear ribosomal DNA. Korean J Breed Sci 48: 241-253.
  • Jin SB, Park JH, Park SM, Lee DH, Yun SH. 2018. A phylogenic analysis of Citrus cultivars native to Jeju using chloroplast DNA trnL-trnF and internal transcribed spacer region sequences. Hortic Sci Technol 36: 585-597.
  • Jung YH, Kwon HM, Kang SH, Kang JH, Kim SC. 2005. Investigation of the phylogenetic relationships within the genus Citrus (Rutaceae) and related species in Korea using plastid trnL-trnF sequences. Sci Hortic 104: 179-188.
  • Kim YC, Koh KS, Koh JS. 2001. Changes of flavonoids in the peel of jeju native citrus fruits during maturation. Food Sci Biotechnol 10: 483-487.
  • Lee SY, Kim SM, Hwang EJ. 2005. Multidrug-resistance reversing activity of the local citrus fruits in jeju island, korea. Korean J Plant Res 18: 41-51.
  • Luro F, Costantino G, Terol J, Argout X, Allario T, Wincker P, Talon M, Ollitrault P, Morillon R. 2008. Transferability of the EST-SSRs developed on Nules Clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping. BMC Genom 9: 1-13.
  • Moon AR, Park JM, Jang CG. 2015. A phylogenetic analysis of the genus Pilea (Urticaceae) using nrDNA and cpDNA sequences. Korean J Pl Taxon 45: 158-168.
  • Nicolsi E. Khan IA, 2007. Origin and Taxonomy. editor. Citrus genetics, breeding and biotechnology. CAB International. Oxfordshare, UK: pp. 19-44.
  • Nicolosi E, Deng ZN, Gentile A, Malfa SL, Continella G, Tribulato E. 2000. Citrus phylogeny and genetic origin of important species as investigated by molecular markers. Theor Appl Genet 100: 1155-1166.
  • Nicolosi ELM, SI M, EL-Otmani M, Negbi M, Goldschmidt EE. 2005. The search for the authentic citron (Citrus medica L.): Historic and genetic analysis. HortScience 40: 1963-1968.
  • Oh DM, Park YJ, Heo BG. 2012. Physiological activity of extract from self-sown young citrus fruits in jeju island. J People Plants Environ 15: 413-419.
  • Ollitrault P, Terol J, Garcia-Lor A, Berard A, Chauveau A, Froelicher Y, Belzile C, Morillon R, Navarro L, Brunel D, Talon M. 2012. SNP mining in C. clementina BAC end sequences; transferability in the Citrus genus (Rutaceae), phylogenetic inferences and perspectives for genetic mapping. BMC Genom 13: 1-19.
  • Pang XM, Hu CG, Deng XX. 2007. Phylogenetic relationships within Citrus and its related genera as inferred from AFLP markers. Genet Resour Crop Evol 54: 429-436.
  • Penjor T, Yamamoto M, Uehara M, Ide M, Matsumoto N, Matsumoto R, Nagano Y. 2013. Phylogenetic relationships of Citrus and its relatives based on matK gene sequences. PLoS One 8: e62574
  • Raveendar S, Lee JR, Park JW, Lee GA, Jeon YA, Lee YJ, Cho GT, Ma KH, Lee SY, Chung JW. 2015a. Potential use of ITS2 and matK as a two-locus DNA barcode for identification of Vicia species. Plant Breed Biotech 3: 58-66.
  • Raveendar S, Lee JR, Park JW, Lee GA, Jeon YA, Lee WH, Cho GT, Ma KH, Lee SY, Chung JW. 2015b. Identification of genus Vigna using ITS2 and matK as a two-locus DNA barcode. Plant Breed Biotech 3: 153-159.
  • Sang T, Crawford DJ, Stuessy TF. 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am J Bot 84: 1120-1136.
  • Sun YL, Kang HM, Han SH, Park YC, Hong SK. 2015. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal DNA its region sequence. Pak J Bot 47: 95-101.
  • Swingle WT, Reece PC. Reuther W, Webber HJ, Batchelor LD, 1967. The botany of Citrus and its wild relatives. editors. The Citrus Industry. University of California Press. Berkeley, USA: pp. 190-430.
  • Tanaka T. 1977. Fundamental discussion of citrus classification. Stud Citral 14: 1-6.
  • Tingey SV, Tufo JP. 1993. Genetic analysis with random amplified polymorphic DNA markers. Plant Physiol 101: 349-352.
  • Yang YT, Kim HB, Lee SH, Park YC. 2019. Composition characteristics of flavonoids in citrus juice. Hortic Sci Technol 37: 651-662.
  • Yang X, Li H, Yu H, Chai L, Xu Q, Deng X. 2017. Molecular phylogeography and population evolution analysis of Citrus ichangensis (Rutaceae). Tree Genet Genomes 13: 29
  • Yao H, Song JY, Liu C, Luo K, Han JP, Li Y, Pang XH, Xu HX, Zhu YJ, Xiao PG, Chen SL. 2010. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS One 5: e13102

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Korean. J. Breed. Sci.. 2021;53(1):16-31.   Published online March 1, 2021
DOI: https://doi.org/10.9787/KJBS.2021.53.1.16
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.
Format:
Include:
Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Korean. J. Breed. Sci.. 2021;53(1):16-31.   Published online March 1, 2021
DOI: https://doi.org/10.9787/KJBS.2021.53.1.16
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions
Image Image Image Image Image
Fig. 1 Morphological feature of and Citrus ichangenesis ‘Ichangensis’ in China (A) and ‘Inchangkyul’ in Jeju island (B).
Fig. 2 PCR amplification using the chloroplast trnL-trnF spacer region and nuclear internal transcribed spacer regions of 30 Citrus cultivars (A and D). Polyacrylamide gel electrophoresis using the QiAxcel Advanced System (Qiagen); A: PCR fragment using chloroplast trnL-trnF primer set, B: PCR fragment using ITS1 primer set, C: PCR fragment using ITS2 primer set, D: PCR fragment using total ITS (ITS1 + 5.8S rDNA + ITS2) region primer set; A1: molecular marker (20 bp and 100 bp DNA ladder, Qiagen); A2: ‘Sativa you’; A3: ‘Tavares’; A4: ‘Wilking’; A5: ‘Haryejosaeng’; A6: ‘Shiranuhi’; A7: ‘Ovale Kumquat’; A8: ‘Marsh’; A9: ‘Shinyegam’; A10; ‘Trifoliate orange’ A11: ‘Iwasaki wase’; A12: ‘Myagawa wase’; B1: ‘Tamnanuenbong’; B2: ‘Cook Eureka’; B3: ‘Cheongkyool’; B4: ‘Dangyooja’; B5: ‘Jinkyool’; B6: ‘Pyunkyool’; B7: ‘Dongjeongkyool’; B8: ‘Kamja’; B9: ‘Jikak’; B10: ‘Yuzu’; B11: ‘Binkyool’; B12: ‘Hongkyool’; C1: ‘Byungkyool’; C2: ‘Nova’; C3: ‘Washington navel’; C4: ‘Hamlin’; C5: ‘Kiyomi’; C6: ‘Inchangkyul’; C7: ‘Ichangensis’.
Fig. 3 Nucleotide sequences of the ITS and chloroplast trnL-trnF regions. Citrus inchangenesis ‘Ichangensis’ ITS rDNA region A); ‘Inchangkyul’ ITS rDNA region B); Citrus inchangenesis ‘Ichangensis’ chloroplast including trnL-trnF intergenic spacers regions C); ‘Inchangkyul’ chloroplast including trnL-trnF intergenic spacers regions D). Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ was harvested in Jeju Native Citrus Research. Box indicates the primer sites used for sequence analysis.
Fig. 4 Phylogenic tree about total 30 genotypes including 11 of Jeju native cultivars, Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’ and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast trnL-trnF intergenic spacers (IGS) region sequence data by Maxium Likelihood (ML.). The red dotted line indicates ‘Inchankgyul’,the red box indicates Citrus ichangenesis ‘Ichangensis’.
Fig. 5 Phylogenic tree about total 31 genotypes including 11 of Jeju native cultivars,.Citrus inchangenesis ‘Ichangensis’ and ‘Inchankgyul’, putative ‘Inchankgyul’ (Accession No. JQ990182), and 17 genotypes of Citrus containing Poncirus and Fortunellar obtained from chloroplast ITS (ITS1, 5.8S rDNA, ITS2, ITS1+5.8S rDNA+ ITS2) region sequence data by Maxium Likelihood (ML.): Phylogenic tree constructed using sequences of the ITS1 region (A); Phylogenic tree constructed using sequences of the 5.8S rDNA region (B); Phylogenic tree constructed using sequences of the ITS2 region (C); Phylogenic tree constructed using sequences of the total ITS (ITS1+5.8S rDNA+ ITS2) region (D). The blue box indicates putative ‘Inchankgyul’ (Accession No. JQ990182), The red box indicates ‘Inchankgyul’, The red dotted line indicates Citrus ichangenesis ‘Ichangensis’.

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Comparative Genetic Analysis between the Jeju ‘Inchangkyool’ and Chinese ‘Ichangensis’ (Citrus ichangensis) using Internal Chloroplast trnL-trnF Intergenic Spacers and Transcribed Spacer Sequence Regions

List of 30 Citrus cultivars used in this study and their numbers.

No. Cultivar trnL-F region ITS region
Common name Scientific name accession number accession number
1 ‘Sativa you’ pomelo Citrus grandis (L.) Osbeck grp 7848271z MG702205
2 ‘Tavares’ lime Citrus aurantifolia × Fortunella margarita grp 7848271 MG702227
3 ‘Wilking’ mandarin Citrus reticulata grp 7848271 MG702212
4 ‘Haryejosaeng’ Citrus unshiu Marc. grp 7848271 MG702222
5 ‘Shiranuhi’ (Citrus unshiu × Citrus sinensis) × Citrus reticulata grp 7848271 MG702207
6 ‘Ovale Kumquat’ Citrus japonica var. margarita grp 7848271 MG702225
7 ‘Marsh’ grapefruit Citrus paradisi grp 7848271 MG702214
8 ‘Shinyegam’ (Citrus unshiu × Citrus sinensis) × Citrus Citrus reticulata grp 7848271 MG702209
9 ‘Trifoliate orange’ Citrus trifoliata grp 7848271 MG702226
10 ‘Iwasaki wase’ Citrus unshiu Marc. grp 7848271 MG702210
11 ‘Myagawa wase’ Citrus unshiu Marc. grp 7848271 MG702201
12 ‘Tamnanuenbong’ Citrus reticulata grp 7848271 MG702220
13 ‘Cook Eureka’ lemon Citrus limon L. Burm.f. grp 7848271 MG702204
14 ‘Cheongkyool’ Citrus nippokoreana grp 7848271 MG702219
15 ‘Dangyooja’ Citrus grandis Osbeck grp 7848271 MG702202
16 ‘Jinkyool’ Citrus sunki Hort. ex Tanaka grp 7848271 MG702217
17 ‘Pyunkyool’ Citrus tangerina Hort. ex Tanaka grp 7848271 MG702221
18 ‘Dongjeongkyool’ Citrus erythrosa Hort. et Tanaka grp 7848271 MG702203
19 ‘Kamja’ Citrus benikoji Hort. ex. Tanaka grp 7848271 MG702199
20 ‘Jikak’ Citrus aurantium L. grp 7848271 MG702216
21 ‘Yuzu’ Citrus junos Sieb. ex Tanaka grp 7848271 MG702198
22 ‘Binkyool’ Citrus leiocarpa grp 7848271 MG702208
23 ‘Hongkyool’ Citrus tachibana Tanaka grp 7848271 MG702224
24 ‘Byungkyool’ Citrus platymamma Hort. et Tanaka grp 7848271 MG702206
25 ‘Nova’ mandarin Citrus reticulata grp 7848271 MG702200
26 ‘Washington navel’ orange Citrus sinensis grp 7848271 MG702211
27 ‘Hamlin’ sweet orange Citrus sinensis grp 7848271 MG702253
28 ‘Kiyomi’ tangor Citrus reticulata grp 7848271 MG702218
29 ‘ Inchangkyul’ - grp 7848271 MG702215
30 ‘Ichangensis’ Citrus ichangenesis grp 7848271 MG702213

zNumber submitted to Genbank

Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.

No. Amplification region Primer name Primer sequence (5'->3') Length Tmz (℃) GC (%)
1 trnL-trnF trnL-F AAAATCGTGAGGGTTCAAGTC 21 53 42.9
trnF-R GATTTGAACTGGTGACACGAG 21 53.7 47.6
2 ITS1 ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS1R GAGAGTCGTTTTGGATACATGTGAAAGAAG 30 57.5 40.0
3 ITS2 ITS2F CTGCCTGGGTGTCACGCATCGTTGCCCCAC 30 70.6 66.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0
4 ITS (ITS1+5.8S rDNA +ITS2) ITS1F GAAGGATCATTGTCGACCTGCCAGCAGACG 30 65.2 56.7
ITS2R GACCTGGGGTCGCAATGCGAGCGCCGCTT 29 72.4 69.0

zTM value: https://sg.idtdna.com/calc/analyzer

Sequence length and G+C content (%) of the trnL-trnF intergenic spacers and ITS region genes and comparison between Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ cultivars.

Cutivar Sequence length (bp) G+C content (%)
trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2) trnL-trnF intergeinc spacers ITS1 5.8S ITS2 ITS (ITS1-5.8S-ITS2)
Citrus ichangenesis ‘Ichangensis’z 373 247 163 228 638 36.73 71.26 54.6 70.61 65.49
‘Inchangkyul’y 373 248 163 226 637 36.73 70.16 54.6 69.03 64.6

zIt is Citrus ichangensis harvested in Citrus Research Institute.

y‘Inchangkyul’ cultivar using in this study was harvested in Citrus Research Institute.

Genetic diversity of the trnL-trnF intergenic spacers and ITS region genes between 30 Citrus varieties.

Cutivar Sequence (bp)
C V PI
trnL-trnF intergeinc spacers 359/372 13 2
ITS1 214/250 34 8
5.8 S rDNA 155/163 8 none
ITS2 205/235 24 13
ITS (ITSI+5.8S rDNA+ITS2) 574/648 66 21

Sequence divergences in the Chloroplast trnL-trnF intergenic spacers (IGS) gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou
2 Tavares 0.008
3 Wilking 0.003 0.011
4 Haryejosaeng 0.005 0.014 0.003
52 Shiranuhi 0.003 0.011 0.000 0.003
6 Ovale_Kumquat 0.008 0.011 0.011 0.014 0.011
7 Marsh 0.000 0.008 0.003 0.005 0.003 0.008
8 Shinyegam 0.003 0.011 0.000 0.003 0.000 0.011 0.003
9 Trifoliate_orange 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005
10 Iwasaki_wase 0.005 0.014 0.003 0.005 0.003 0.014 0.005 0.003 0.008
11 Myagawa_wase 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003
12 Tamnanuenbong 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000
13 Cook_Eureka 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003
14 Cheongkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003
15 Dangyooja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003
16 Jinkyool 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003
17 Pyunkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003
18 Dongjeongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003
19 Kamja 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003
20 Jikak 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000
21 Yuzu 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000
22 Binkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003
23 Hongkyool 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005
24 Byungkyool 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003
25 Nova 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003
26 Washington_navel 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003
27 Hamlin 0.003 0.011 0.005 0.008 0.005 0.011 0.003 0.005 0.005 0.008 0.005 0.005 0.003 0.005 0.003 0.005 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.005 0.003
28 Kiyomi 0.003 0.011 0.000 0.003 0.000 0.011 0.003 0.000 0.005 0.003 0.000 0.000 0.003 0.000 0.003 0.000 0.003 0.005 0.003 0.003 0.003 0.005 0.005 0.003 0.000 0.003 0.005
29 Inchangkyul 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003
30 Ichangensis 0.000 0.008 0.003 0.005 0.003 0.008 0.000 0.003 0.003 0.005 0.003 0.003 0.000 0.003 0.000 0.003 0.000 0.003 0.000 0.000 0.000 0.003 0.003 0.000 0.003 0.000 0.003 0.003 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 372 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the ITS1 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.039
3 Wilking(MG702212) 0.008 0.040
4 Haryejosaeng(MG702222) 0.030 0.035 0.030
52 Shiranuhi(MG702207) 0.025 0.030 0.026 0.021
6 Ovale_Kumquat(MG702225) 0.035 0.040 0.036 0.022 0.026
7 Marsh(MG702214) 0.026 0.030 0.026 0.004 0.017 0.017
8 Shinyegam(MG702209) 0.008 0.039 0.008 0.021 0.025 0.035 0.017
9 Trifoliate_orange(MG702226) 0.030 0.035 0.030 0.026 0.021 0.031 0.021 0.030
10 Iwasaki_wase(MG702210) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021
11 Myagawa_wase(MG702201) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000
12 Tamnanuenbong(MG702220) 0.035 0.040 0.035 0.030 0.008 0.036 0.026 0.035 0.030 0.008 0.008
13 Cook_Eureka(MG702204) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030
14 Cheongkyool(MG702219) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004
15 Dangyooja(MG702202) 0.008 0.039 0.008 0.030 0.025 0.035 0.026 0.008 0.030 0.025 0.025 0.035 0.030 0.026
16 Jinkyool(MG702217) 0.030 0.035 0.031 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.031 0.008 0.004 0.030
17 Pyunkyool(MG702221) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008
18 Dongjeongkyool(MG702203) 0.004 0.035 0.004 0.026 0.021 0.031 0.021 0.004 0.026 0.021 0.021 0.030 0.026 0.021 0.004 0.026 0.026
19 Kamja(MG702199) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026
20 Jikak(MG702216) 0.013 0.035 0.013 0.026 0.021 0.031 0.021 0.013 0.026 0.021 0.021 0.030 0.026 0.021 0.013 0.026 0.026 0.008 0.026
21 Yuzu(MG702198) 0.030 0.035 0.030 0.008 0.013 0.022 0.004 0.021 0.026 0.013 0.013 0.021 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026
22 Binkyool(MG702208) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004
23 Hongkyool(MG702224) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000
24 Byungkyool(MG702206) 0.021 0.026 0.021 0.008 0.013 0.013 0.004 0.021 0.017 0.013 0.013 0.021 0.008 0.004 0.021 0.008 0.008 0.017 0.008 0.017 0.008 0.004 0.004
25 Nova(MG702200) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004
26 Washington_navel(MG702211) 0.026 0.030 0.026 0.004 0.017 0.017 0.000 0.017 0.021 0.017 0.017 0.026 0.004 0.000 0.026 0.004 0.004 0.021 0.004 0.021 0.004 0.000 0.000 0.004 0.000
27 Hamlin(MG702223) 0.030 0.035 0.030 0.008 0.021 0.022 0.004 0.021 0.026 0.021 0.021 0.030 0.008 0.004 0.030 0.008 0.008 0.026 0.008 0.026 0.008 0.004 0.004 0.008 0.004 0.004
28 Kiyomi(MG702218) 0.030 0.026 0.030 0.026 0.004 0.031 0.021 0.030 0.026 0.004 0.004 0.013 0.026 0.021 0.030 0.026 0.026 0.025 0.026 0.025 0.017 0.021 0.021 0.017 0.021 0.021 0.026
29 Inchangkyul(MG702215) 0.025 0.030 0.026 0.021 0.000 0.026 0.017 0.025 0.021 0.000 0.000 0.008 0.021 0.017 0.025 0.021 0.021 0.021 0.021 0.021 0.013 0.017 0.017 0.013 0.017 0.017 0.021 0.004
30 Ichangensis(MG702213) 0.035 0.040 0.035 0.021 0.026 0.026 0.017 0.035 0.031 0.026 0.026 0.035 0.021 0.017 0.035 0.021 0.021 0.030 0.021 0.030 0.021 0.017 0.017 0.013 0.017 0.017 0.021 0.030 0.026

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total o f 2 43 p ositions i n t he f inal d ataset. E volutionary a nalyses w ere c onducted i n M EGA5.

Sequence divergences in the 5.8S rDNA gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Satianyou(MG702205)
2 Tavares(MG702227) 0.012
3 Wilking(MG702212) 0.006 0.006
4 Haryejosaeng(MG702222) 0.012 0.012 0.006
52 Shiranuhi(MG702207) 0.006 0.006 0.000 0.006
6 Ovale_Kumquat(MG702225) 0.006 0.006 0.000 0.006 0.000
7 Marsh(MG702214) 0.006 0.006 0.000 0.006 0.000 0.000
8 Shinyegam(MG702209) 0.006 0.006 0.000 0.006 0.000 0.000 0.000
9 Trifoliate_orange(MG702226) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000
10 Iwasaki_wase(MG702210) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000
11 Myagawa_wase(MG702201) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
12 Tamnanuenbong(MG702220) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
13 Cook_Eureka(MG702204) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006
14 Cheongkyool(MG702219) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006
15 Dangyooja(MG702202) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.013 0.006
16 Jinkyool(MG702217) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006
17 Pyunkyool(MG702221) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000
18 Dongjeongkyool(MG702203) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000
19 Kamja(MG702199) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000
20 Jikak(MG702216) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000
21 Yuzu(MG702198) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006
22 Binkyool(MG702208) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006
23 Hongkyool(MG702224) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000
24 Byungkyool(MG702206) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000
25 Nova(MG702200) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000
26 Washington_navel(MG702211) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000
27 Hamlin(MG702223) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000
28 Kiyomi(MG702218) 0.012 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.012 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.012 0.006 0.006 0.006 0.006 0.006 0.006
29 Inchangkyul(MG702215) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006
30 Ichangensis(MG702213) 0.006 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.006 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.006 0.000 0.000 0.000 0.000 0.000 0.000 0.006 0.000

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 163 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the ITS2 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No. Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.009
3 Wilking(MG702212) 0.004 0.014
4 Haryejosaeng(MG702222) 0.023 0.023 0.027
52 Shiranuhi(MG702207) 0.023 0.023 0.027 0.037
6 Ovale_Kumquat(MG702225) 0.032 0.023 0.037 0.027 0.046
7 Marsh(MG702214) 0.018 0.018 0.023 0.004 0.032 0.023
8 Shinyegam(MG702209) 0.004 0.014 0.000 0.027 0.027 0.037 0.023
9 Trifoliate_orange(MG702226) 0.032 0.032 0.037 0.018 0.046 0.027 0.013 0.037
10 Iwasaki_wase(MG702210) 0.027 0.027 0.032 0.042 0.004 0.051 0.037 0.032 0.051
11 Myagawa_wase(MG702201) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004
12 Tamnanuenbong(MG702220) 0.023 0.023 0.027 0.037 0.000 0.046 0.032 0.027 0.046 0.004 0.000
13 Cook_Eureka(MG702204) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032
14 Cheongkyool(MG702219) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000
15 Dangyooja(MG702202) 0.023 0.023 0.027 0.037 0.009 0.046 0.032 0.027 0.046 0.013 0.009 0.009 0.032 0.032
16 Jinkyool(MG702217) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032
17 Pyunkyool(MG702221) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014
18 Dongjeongkyool(MG702203) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027
19 Kamja(MG702199) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023
20 Jikak(MG702216) 0.018 0.027 0.023 0.013 0.042 0.032 0.009 0.023 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.023 0.009
21 Yuzu(MG702198) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.047 0.042 0.042 0.009 0.009 0.042 0.009 0.023 0.032 0.009 0.018
22 Binkyool(MG702208) 0.023 0.023 0.027 0.018 0.037 0.027 0.014 0.027 0.027 0.042 0.037 0.037 0.014 0.014 0.037 0.014 0.000 0.027 0.014 0.023 0.023
23 Hongkyool(MG702224) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014
24 Byungkyool(MG702206) 0.027 0.027 0.032 0.014 0.042 0.032 0.009 0.032 0.023 0.046 0.042 0.042 0.009 0.009 0.042 0.009 0.004 0.032 0.009 0.018 0.018 0.004 0.009
25 Nova(MG702200) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009
26 Washington_navel(MG702211) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000
27 Hamlin(MG702223) 0.018 0.018 0.023 0.004 0.032 0.023 0.000 0.023 0.013 0.037 0.032 0.032 0.000 0.000 0.032 0.000 0.014 0.023 0.000 0.009 0.009 0.014 0.000 0.009 0.000 0.000
28 Kiyomi(MG702218) 0.018 0.018 0.023 0.032 0.009 0.042 0.028 0.023 0.042 0.014 0.009 0.009 0.028 0.028 0.014 0.028 0.032 0.023 0.028 0.037 0.037 0.032 0.028 0.037 0.028 0.028 0.028
29 Inchangkyul(MG702215) 0.004 0.014 0.000 0.027 0.027 0.037 0.023 0.000 0.037 0.032 0.027 0.027 0.023 0.023 0.027 0.023 0.027 0.000 0.023 0.023 0.032 0.027 0.023 0.032 0.023 0.023 0.023 0.023
30 Ichangensis(MG702213) 0.023 0.023 0.027 0.009 0.037 0.027 0.004 0.027 0.018 0.042 0.037 0.037 0.004 0.004 0.037 0.004 0.018 0.027 0.004 0.013 0.014 0.018 0.004 0.014 0.004 0.004 0.004 0.032 0.027

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 224 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Sequence divergences in the total ITS gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

No Cultivars 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
1 Shatianyou(MG702205)
2 Tavares(MG702227) 0.021
3 Wilking(MG702212) 0.006 0.021
4 Haryejosaeng(MG702222) 0.023 0.024 0.023
52 Shiranuhi(MG702207) 0.019 0.021 0.019 0.023
6 Ovale_Kumquat(MG702225) 0.026 0.024 0.026 0.019 0.026
7 Marsh(MG702214) 0.018 0.019 0.018 0.005 0.018 0.015
8 Shinyegam(MG702209) 0.006 0.021 0.003 0.019 0.019 0.026 0.015
9 Trifoliate_orange(MG702226) 0.024 0.026 0.024 0.018 0.024 0.021 0.013 0.024
10 Iwasaki_wase(MG702210) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026
11 Myagawa_wase(MG702201) 0.021 0.023 0.021 0.024 0.002 0.028 0.019 0.021 0.026 0.003
12 Tamnanuenbong(MG702220) 0.023 0.024 0.023 0.026 0.003 0.030 0.021 0.023 0.028 0.005 0.005
13 Cook_Eureka(MG702204) 0.021 0.023 0.021 0.008 0.021 0.018 0.003 0.018 0.016 0.023 0.023 0.024
14 Cheongkyool(MG702219) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003
15 Dangyooja(MG702202) 0.015 0.026 0.015 0.028 0.014 0.031 0.023 0.015 0.029 0.016 0.016 0.018 0.026 0.023
16 Jinkyool(MG702217) 0.019 0.021 0.019 0.006 0.020 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.025
17 Pyunkyool(MG702221) 0.021 0.023 0.021 0.011 0.021 0.018 0.006 0.018 0.019 0.023 0.023 0.024 0.010 0.006 0.026 0.008
18 Dongjeongkyool(MG702203) 0.005 0.019 0.002 0.021 0.018 0.024 0.016 0.002 0.023 0.019 0.019 0.021 0.019 0.016 0.013 0.018 0.019
19 Kamja(MG702199) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018
20 Jikak(MG702216) 0.013 0.024 0.013 0.016 0.023 0.023 0.011 0.013 0.018 0.024 0.024 0.026 0.014 0.011 0.021 0.013 0.018 0.011 0.013
21 Yuzu(MG702198) 0.024 0.026 0.024 0.011 0.021 0.021 0.006 0.021 0.019 0.023 0.023 0.025 0.010 0.006 0.030 0.008 0.013 0.023 0.008 0.018
22 Binkyool(MG702208) 0.019 0.021 0.019 0.010 0.019 0.016 0.005 0.016 0.018 0.021 0.021 0.023 0.008 0.005 0.024 0.006 0.002 0.018 0.006 0.016 0.011
23 Hongkyool(MG702224) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005
24 Byungkyool(MG702206) 0.019 0.021 0.019 0.010 0.020 0.016 0.005 0.019 0.014 0.021 0.021 0.023 0.008 0.005 0.025 0.006 0.005 0.018 0.006 0.013 0.011 0.003 0.005
25 Nova(MG702200) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005
26 Washington_navel(MG702211) 0.018 0.019 0.018 0.005 0.018 0.015 0.000 0.015 0.013 0.019 0.019 0.021 0.003 0.000 0.023 0.002 0.006 0.016 0.002 0.011 0.006 0.005 0.000 0.005 0.000
27 Hamlin(MG702223) 0.019 0.021 0.019 0.006 0.019 0.016 0.002 0.016 0.014 0.021 0.021 0.023 0.005 0.002 0.024 0.003 0.008 0.018 0.003 0.013 0.008 0.006 0.002 0.006 0.002 0.002
28 Kiyomi(MG702218) 0.021 0.019 0.021 0.024 0.006 0.028 0.019 0.021 0.026 0.008 0.008 0.010 0.023 0.019 0.019 0.021 0.023 0.019 0.021 0.024 0.023 0.021 0.019 0.021 0.019 0.019 0.021
29 Inchangkyul(MG702215) 0.013 0.018 0.010 0.019 0.010 0.023 0.015 0.010 0.021 0.011 0.011 0.013 0.018 0.015 0.021 0.016 0.018 0.008 0.016 0.016 0.018 0.016 0.015 0.016 0.015 0.015 0.016 0.011
30 Ichangensis(MG702213) 0.023 0.024 0.023 0.013 0.023 0.019 0.008 0.023 0.018 0.024 0.024 0.026 0.011 0.008 0.028 0.010 0.014 0.021 0.010 0.016 0.014 0.013 0.008 0.010 0.008 0.008 0.010 0.025 0.019

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 630 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 1 List of 30 Citrus cultivars used in this study and their numbers.

zNumber submitted to Genbank

Table 2 Primer sets used for the amplification of chloroplast trnL-trnF and nuclear ribosomal DNA ITS regions.

zTM value: https://sg.idtdna.com/calc/analyzer

Table 3 Sequence length and G+C content (%) of the trnL-trnF intergenic spacers and ITS region genes and comparison between Citrus inchangenesis ‘Ichangensis’ and ‘Inchangkyul’ cultivars.

zIt is Citrus ichangensis harvested in Citrus Research Institute.

y‘Inchangkyul’ cultivar using in this study was harvested in Citrus Research Institute.

Table 4 Genetic diversity of the trnL-trnF intergenic spacers and ITS region genes between 30 Citrus varieties.
Table 5 Sequence divergences in the Chloroplast trnL-trnF intergenic spacers (IGS) gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 372 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 6 Sequence divergences in the ITS1 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total o f 2 43 p ositions i n t he f inal d ataset. E volutionary a nalyses w ere c onducted i n M EGA5.

Table 7 Sequence divergences in the 5.8S rDNA gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 163 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 8 Sequence divergences in the ITS2 gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 224 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 9 Sequence divergences in the total ITS gene regions of between Jeju ‘Inchangkyul’ cultivar and other 29 Citrus varieties.

The analysis involved 30 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 630 positions in the final dataset. Evolutionary analyses were conducted in MEGA5.

Table 1

Table 2

Table 3

Table 4

Table 5

Table 6

Table 7

Table 8

Table 9

ABOUT

BROWSE ARTICLES

FOR CONTRIBUTORS

EDITORIAL POLICIES

© The Korean Society of Breeding Science.