Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

고추약한모틀바이러스 병원형 P 및 P 생물검정을 통한 저항성 고추유전자원 선발

허온숙1,*, 곽해련2, 노나영1, 최유미1, 이수경1, 황애진1, 김빛샘1, 김성훈1, 한범수1

Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3

Korean Journal of Breeding Science 2022;54(1):1-7.
Published online: March 1, 2022

1농촌진흥청 국립농업과학원 농업유전자원센터

2농촌진흥청 국립농업과학원 농산물안정성부 작물보호과

1National Agrobiodiversity Center, National Institute of Agricultural Sciences, RDA, Jeonju 54874, Republic of Korea

2Crop Protection Division, Dept. of Agro-Food Safety and Crop Protection, National Institute of Agricultural Sciences, RDA, Wanju 55365, Republic of Korea

*Corresponding Author (E-mail: oshur09@korea.kr, Tel: +82-63-238-4942, Fax: +82-63-238-4859)
• Received: October 19, 2021   • Revised: November 17, 2021   • Accepted: November 29, 2021

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 262 Views
  • 6 Download
  • 1 Crossref
next

Citations

Citations to this article as recorded by  Crossref logo
  • Pepper Mild Mottle Virus: An Infectious Pathogen in Pepper Production and a Potential Indicator of Domestic Water Quality
    Kingsley Ochar, Ho-Cheol Ko, Hee-Jong Woo, Bum-Soo Hahn, Onsook Hur
    Viruses.2023; 15(2): 282.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Korean. J. Breed. Sci.. 2022;54(1):1-7.   Published online March 1, 2022
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Korean. J. Breed. Sci.. 2022;54(1):1-7.   Published online March 1, 2022
Close

Figure

  • 0
  • 1
  • 2
  • 3
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3
Image Image Image Image
Fig. 1 Reverse transcription polymerase chain reaction (RT-PCR) for PMMoV in reference pepper germplasm. First lane, size marker; L0, Early California Wonder (Capsicum annuum); L1, Tisana (C. annuum); L2, CM334 (C. annuum); L3, PI159236 (C. chinense); L4, PI260429 (C. chacoense); P, positive control Inoculum N. occidentalis; N, negative control DW.
Fig. 2 Frequency distribution of disease incidence of 200 C. chinense to PMMoV-P1,2. Disease incidence (%)=No. of plant infected / No. of plant inoculated *100.
Fig. 3 Various symptoms of pepper plants with PMMoV pathotype P1,2. (A) Mosaic on the upper leaf, (B) Mottle on the upper leaf, (C) Whole necrosis, (D) Necrotic lesion in the inoculated leaf.
Fig. 4 Morphological characteristics of four C. chinense accessions resistant to PMMoV-P1,2,3. (A) IT261426, (B) IT261442, (C) IT284050, (D) IT261431.
Resistance Screening of Capsicum Germplasm to Pepper Mild Mottle Virus (PMMoV) Pathotypes P1,2 and P1,2,3

Reference plant materials used in this study

IT no. Acc. name Species Genotype Reference Biological reaction P1,2z
IT158331 Early Califonia Wonder (ECW) C. annuum L0/L0 Boukema 1980 -/m, mo
IT158337 Tisana C. annuum L1/L1 Han et al. 2001 -/m, mo
IT250209 CM334 C. annuum L2/L2 Lee et al. 2012 -/m, mo
IT236726 PI159236 C. chinense L3/L3 Boukema 1980 nl/-
IT158713 PI260429 C. chacoense L4/L4 Boukema 1984 nl/-

Primer set used for confirmation of the PMMoV existence in samples

Primer name Sequence (5'-3') Loci Size (bp) Gene
PMMoV-5F AGGTTAGAATTGGGCAGAAC 5627-5646 684 CP (5685-6158)
PMMoV-5R ATTACGTCGTTCGCAAATAC 6310 -6291

Reactions of different Capsicum genotypes to infection with pepper mild mottle virus P1,2

IT no.. Acc. name Origin Resistance to PMMoV_NS-RP13
Symptomz Incidencey RT-PCR Response
IT261209 PI315014 PER nl/nl,- 3/3 - R
IT261210 PI315012 PER nl/- 3/3 - R
IT261211 PI315017 PER nl/- 3/3 - R
IT261221 Peru-5363 CRI nl/- 3/3 + R
IT261414 BISBAS YEM -/mo 3/3 +++ S
IT261426 VC112a UNK nl/- 3/3 - R
IT261431 TC 07589 ECU nl/- 3/3 - R
IT261442 C 04710 BRA nl/- 3/3 - R
IT284050 Peru-5438 CRI nl/- 3/3 - R
IT158662 K1 MYS -/mo 3/3 +++ S
IT158680 L.P.1 THA -/mo 3/3 +++ S

Resistant Capsicum chinense accessions to Pepper mild mottle virus-P1,2,3

IT no. PMMoV-P1,2,3
symptomz Incidencey RT-PCR Response
IT261210 nl/- 3/3 - R
IT261211 nl/- 3/3 - R
IT261426 nl/- 3/3 - R
IT261431 nl/- 3/3 - R
IT261442 nl/- 3/3 - R
IT284050 nl/- 3/3 - R
Table 1 Reference plant materials used in this study

znl: necrotic lesion, m: mosaic, mo: mottle

Table 2 Primer set used for confirmation of the PMMoV existence in samples
Table 3 Reactions of different Capsicum genotypes to infection with pepper mild mottle virus P1,2

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.

Table 4 Resistant Capsicum chinense accessions to Pepper mild mottle virus-P1,2,3

zInoculated leaf/upper leaf, mo, mottle; nl, necrotic local lesions.

yNo. of plant infected / No. of plant inoculated.