Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

PCR 마커를 이용한 국내 밀 품종의 고분자 글루테닌 과 대립유전자 조성 평가

이명희1, 최창현1, 김민주1, 강천식1, 이정희1, 김경민2,*

High-Molecular-Weight-Glutenin Subunit Allelic Composition at the GLU-A1 and GLU-D1 Loci in Domestic Wheat Cultivars: Insights from PCR-Based Markers

Korean Journal of Breeding Science 2025;57(4):433-444.
Published online: December 1, 2025

1농촌진흥청 국립식량과학원 맥류작물과

2농촌진흥청 국립식량과학원 기획조정과

1Winter Crop Research Division, National Institute of Crop and Food Science, Rural Development Administration, Wanju, 55365, Republic of Korea

2Planning and Coordination Division, National Institute of Crop and Food Science, Rural Development Administration, Wanju, 55365, Republic of Korea

*Corresponding to Kyeong-Min KimTEL. +82-63-238-5113E-mail. raiders87@korea.kr
• Received: October 6, 2025   • Revised: October 31, 2025   • Accepted: November 10, 2025

Copyright © 2025 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 847 Views
  • 3 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Evaluation of Wheat’s (Triticum aestivum L.) Agronomic and Grain Traits and Protein and Starch Characteristics Under Cultivation Environments in Korea
    Hyeon-Seong Yoo, Hyun-Jin Jung, Na-Yun Lee, Eun-Chae Bae, Eun-Bin Hwang, Eun-Seong Baek, Se-Jin Oh, Yu-Mi Lee, Sang-Cheol Gwak, Moon-Sub Lee, Seong-Woo Cho, Tae-Young Hwang
    Agriculture.2026; 16(11): 1131.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

High-Molecular-Weight-Glutenin Subunit Allelic Composition at the GLU-A1 and GLU-D1 Loci in Domestic Wheat Cultivars: Insights from PCR-Based Markers
Korean. J. Breed. Sci.. 2025;57(4):433-444.   Published online December 1, 2025
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
High-Molecular-Weight-Glutenin Subunit Allelic Composition at the GLU-A1 and GLU-D1 Loci in Domestic Wheat Cultivars: Insights from PCR-Based Markers
Korean. J. Breed. Sci.. 2025;57(4):433-444.   Published online December 1, 2025
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
High-Molecular-Weight-Glutenin Subunit Allelic Composition at the GLU-A1 and GLU-D1 Loci in Domestic Wheat Cultivars: Insights from PCR-Based Markers
Image Image Image Image Image
Fig. 1 PCR analysis of Glu-A1x alleles in 44 domestic wheat cultivars. DM, DNA size marker; PS, primer set. Arrows represent indels.
Fig. 2 PCR analysis of Glu-D1x alleles in 44 domestic wheat cultivars. DM, DNA size marker; PS, primer set. Arrows represent indels, and the asterisk (*) denotes Glu-D1x2.
Fig. 3 PCR analysis of Glu-D1y alleles in 44 domestic wheat cultivars. DM, DNA size marker; PS, primer set. Arrows represent indels.
Fig. 4 Expression of HMW-GSs in five domestic wheat cultivars were compared using Ultra Performance Liquid Chromatography. Retention times (RTs) were determined for each peak in the HMW-GS region. AU, arbitrary units. The numbers correspond to HMW-GS subunits as follows: 2* represent A1x2*; 7 and 7* represent B1x7 and B1x7*; 8 and 9 represent B1y8 and Bly9; 2,2, 2, and 5 represent D1x2.2, D1x2, and D1x5; 10 and 12 represent D1y10 and D1y12, respectively.
Fig. 5 Protein composition of the HMW-GSs in two domestic wheat cultivars (Jonong and Sinmichal1) compared with Keumkang. PM, protein marker; HMW-GS, high-molecular-weight glutenin; LMW-GS, low-molecular-weight glutenin. The numbers correspond to HMW-GS subunits as follows: 2* represent A1x2*; 7 and 7* represent B1x7 and B1x7*; 8 and 9 represent B1y8 and Bly9; 2 and 5 represent D1x2 and D1x5; 10 and 12 represent D1y10 and D1y12, respectively.
High-Molecular-Weight-Glutenin Subunit Allelic Composition at the GLU-A1 and GLU-D1 Loci in Domestic Wheat Cultivars: Insights from PCR-Based Markers

The information of HMW-GS GLU-A1, GLU-B1, and GLU-D1 alleles in 44 domestic wheat cultivars.

No. Name Pedigree Reported Corrected


GLU-A1 GLU-B1 GLU-D1 GLU-A1 GLU-D1





x x+y x+y x x+y
1 Ol Norin72/Norin12 N 7*+8 2.2+12 N 2.2+12
2 Geuru Strampelli/69D-3607//Chokwang N 7+8 2.2+12 N 2.2+12
3 Dahong Norin72/Wonkwang N 7+8 2.2+12 N 2.2+12
4 Chungkye Norin4/Sharbatisonora N 7*+8 2.2+12 N 2.2+12
5 Tapdong Chugoku81//Suwon158/Toropi 2* 7*+8 5+10 2* 5+10
6 Namhae Ol/Calidad N 7*+8 2.2+12 N 2.2+12
7 Uri Geuru/Ol N 7+8 2.2+12 N 2.2+12
8 Olgeuru Geuru/Chokwang//Saikai143 2* 7+8 2.2+12 2* 2.2+12
9 Alchan Suwon210/Tapdong 2* 7+8 5+10 2* 5+10
10 Keumkang Geuru/Kanto75//Eunpa 2* 7+8 5+10 2* 5+10
11 Seodun Geuru/Genaro81 N 7*+8 2.2+12 N 2.2+12
12 Saeol Shirogane//Norin43/Sonalika N 7+8 2.2+12 N 2.2+12
13 Jinpoom Geuru/Genaro81 N 7*+8 2.2+12 N 2.2+12
14 Milsung Shirogane//Norin43/Sonalika N 7+8 2.2+12 N 2.2+12
15 Sinmichal Olgeuru//Kanto107/BaiHuo 2* 7*+8* 2.2+12 2* 2.2+12
16 Jokyung Seri82/Keumkang 1 7+8 5+10 1 5+10
17 Dabun Suwon234//sw76039/Suwon22 2* 7+8 2.2+12 2* 2.2+12
18 Hanbaek Shann7859/Keumkang//Guamuehill 2* 7+8 5+10 2* 5+10
19 Suan Keumkang/Eunpa//Keumkang 2* 7*+8 2.2+12 2* 2.2+12
20 Goso Gobun/Ol 2* 7+8 2.2+12 2* 2.2+12
21 Joa SW86054-MB-27-3-2-1-1-1/Sumai#3 2* 7*+8 2.2+12 2* 2.2+12
22 Hojoong Alchan2/3/Chunm18//JUP/BJY/4/Keumkang 2* 7*+8 2.2+12 2* 2.2+12
23 Baekkang Topdong/Klasic 1 7+8 5+10 1 5+10
24 Saekeumkang Keumkang/Olgeuru 2* 7+8 2.2+12 2* 2.2+12
25 Ariheuk K253305/Sinmichal 2* 7*+8* 2.2+12 2* 2.2+12
26 Baekchal Sinmichal/Keumkang 2* 7*+8* 5+10 2* 5+10
27 Eunpa Chugoku81/3/Tob-CNO/Yuksung3/Suwon185 N 7*+9 2.2+12 N 2.2+12
28 Gobun Eunpa/Tapdong//Eunpa/Shannung6521 N 7*+9 2+12 N 2+12
29 Anbaek Sae/Geuru N 7*+9 2+12 N 2+12
30 Jonong Suwon234/SW80199 1zyx/Nwvu 7*+9 (5+10)zyxw/(2+12)v 2* 2+12
31 Sinmichal1 Alchan//Kanto107/BaiHuo 2*x/Nywvu 7*+9 (2+12)xwv/(2.2+12)y 2* 2+12
32 Hwanggeumal Jokyung/Kauz/Rayo//Jopoom N 7*+9 5+10 N 5+10
33 Taejoong Xian83(104).11/Keumkang N 7*+9 2+12 N 2+12
34 Joeun Eunpa/Suwon242 N 13+16 2.2+12 N 2.2+12
35 Jopoom Kanto75//OR8500494P/Bezostaya N 13+16 2.2+12 N 2.2+12
36 Younbaek Keumkang/Tapdong 2* 13+16 2.2+12 2* 2.2+12
37 Baekjoong Keumkang/Olgeuru 2* 13+16 2.2+12 2* 2.2+12
38 Jeokjoong Keumkang/Tapdong 2* 13+16 2.2+12 2* 2.2+12
39 Sukang Suwon266/Asakaze 2*zywv/Nu 13+16 2+12 2* 2+12
40 Dajoong SW992114-NM-131-7/Gobun 2* 13+16 2.2+12 2* 2.2+12
41 Jojoong Suwon272/Olgeuru//Keumkang/Suwon252 N 13+16 2.2+12 N 2.2+12
42 Johan Suwon262/Joeun 2* 13+16 2.2+12 2* 2.2+12
43 Joongmo2008 Eunpa*2//SH3/CBRD/3/Keumkang N 17+18 5+10 N 5+10
44 Wooju Jokyung/K253306 1 20+20 5+10 1 5+10

Primer information used for detection of GLU-A1 and GLU-D1 in present study. PS, primer set; A1x, Glu-A1x; D1x, Glu-D1x; D1y, Glu-D1y.

PS Gene Primer name 5'→3' AT (℃) Size (bp) Reference
1 A1x/non-A1x c CCATCGAAATGGCTAAGCGG 68 1500 Lafiandra et al. (1997)
d GTCCAGAAGTTGGGAAGTGC
2 A1x2*/non-A1x2* UMN19-F CGAGACAATATGAGCAGCAAG 66 344/362 Liu et al. (2008)
UMN19-R CTGCCATGGAGAAGTTGGA
3 A1x2* Ax2*-F ATGACTAAGCGGTTGGTTCTT 68 1302 Ma et al. (2003)
Ax2*-R ACCTTGCTCCCCTTGTCTTT
4 A1x1 MHAX1-F TCCAACTTCTCCATGGCAG 68 443 Lee et al. (2025)
MHAX1-R3 GCTGCTGCGCAGAAGTTGGA
5 D1x5/non-D1x5 UMN25-F GGGACAATACGAGCAGCAAA 68 281/299 Liu et al. (2008)
UMN25-R CTTGTTCCGGTTGTTGCCA
6 D1x5 Dx-5-1-F CGTCCCTATAAAAGCCTAGC 60 478 Liu et al. (2008)
Dx-5-1-R AGTATGAAACCTGCTGCGGAC
7 Non-D1x5 MHDx-F GTCGCGGGACAATACGAGCG 68 248 Lee et al. (2025)
MHDx-R2 CCTTGTTGTCCTTGTCCTGAT
8 D1x5, D1x2.1/D1x MHDX-F2 CCAACTTCTCCGCAGGAGTC 68 262/280 Lee et al. (2025)
D1x2, D1x2.2 MHDX-R4 TTGCAGCCATTGTCCTGGCC
9 D1x2.2 MHDX2.2-F3 TACTACCCAACTTCTCCGCT 68 464 Lee et al. (2025)
MHDX2.2-R4 CTGCTGCGGAGAAGTTAGGT
10 D1y10/D1y12 UMN26-F CGCAAGACAATATGAGCAAACT 60 397/415 Liu et al. (2008)
UMN26-R TTGCCTTTGTCCTGTGTGC
11 D1y10/D1y12 MHDy-F GCCCAAGGGCGGATCCTTCT 68 439/403 Lee et al. (2025)
MHDy-/R TTGCCCTTGTTCTGGTTGTT
Table 1 The information of HMW-GS GLU-A1, GLU-B1, and GLU-D1 alleles in 44 domestic wheat cultivars.

Differently identified alleles are shown in bold.

zPark et al. (2011); yLee et al. (2013); xShin et al. (2012); wJang et al. (2017); vJang et al. (2020); uChoi et al. (2022). GLU-B1 alleles were reanalyzed by Lee et al. (2024b).

Table 2 Primer information used for detection of GLU-A1 and GLU-D1 in present study. PS, primer set; A1x, Glu-A1x; D1x, Glu-D1x; D1y, Glu-D1y.