Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

친환경재배 적응 벼멸구 저항성 고품질 벼 ‘친들’

A Brown Planthopper Resistance with Eco-Friendly Cultivation Adaptation and High Grain Quality Rice Variety ‘Chindeul’

Korean Journal of Breeding Science 2014;46(4):481-489.
Published online: November 30, 2014

1 국립식량과학원

1 National Institute of Crop Science, RDA Iksan 570-080, Korea

2 농촌진흥청 연구정책국

2 Research Policy Bureau, RDA, Jeonju 560-500, Korea

*Corresponding Author : suwonman@korea.kr, Tel: +82- 63-840-2169, Fax: +82-63-840-2117)
• Received: October 6, 2014   • Revised: October 6, 2014   • Accepted: November 7, 2014

© Tshe Korean Society of Breeding Science All rights reserved

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 222 Views
  • 0 Download
  • 1 Crossref
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Mechanical Quality Evaluation of Rice Cultivars That Could Potentially be Used to Produce Processed Cooked Rice
    Hye-Young Park, Dong-Sun Shin, Koan-Sik Woo, Eun-Yeong Sim, Hyun-Joo Kim, Seuk-ki Lee, Yong-Jae Won, Sang-Bok Lee, Sea-Kwan Oh
    The Korean Journal of Crop Science.2016; 61(3): 145.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

A Brown Planthopper Resistance with Eco-Friendly Cultivation Adaptation and High Grain Quality Rice Variety ‘Chindeul’
Korean. J. Breed. Sci.. 2014;46(4):481-489.   Published online December 31, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
A Brown Planthopper Resistance with Eco-Friendly Cultivation Adaptation and High Grain Quality Rice Variety ‘Chindeul’
Korean. J. Breed. Sci.. 2014;46(4):481-489.   Published online December 31, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
A Brown Planthopper Resistance with Eco-Friendly Cultivation Adaptation and High Grain Quality Rice Variety ‘Chindeul’
Image Image Image Image Image Image
Fig. 1. Genealogical diagram of ‘Chindeul’.
Fig. 2. Pedigree diagram of ‘Chindeul’.
Fig. 3. Detection of stv-bi gene using DNA marker Indel7 to ‘Chindeul’. P : Dacheong(resistance), N : Hopyeong(susceptible), 7 : Chindeul(resistance).
Fig. 4. Detection of bph2 gene using DNA marker kpm2 to ‘Chindeul’. PCR products were cleaved by HinfⅠ and gels were stained by RedSafe. P : Dacheong(resistance), N : Nampyeong(susceptible).
Fig. 5. BPH bioassay resistance reaction to brown planthopper for ‘Chindeul’ at seedling stage.
Fig. 6. Resistance reaction to bacterial blight, K1, K2, K3, and K3a races. Lesion length at 2 weeks after inoculation.
A Brown Planthopper Resistance with Eco-Friendly Cultivation Adaptation and High Grain Quality Rice Variety ‘Chindeul’

DNA markers and restriction enzymes used to detect of R-genes against the brown planthopper, bacterial blight, and rice stripe virus.

Marker Resistance gene tagged Restriction enzyme Forward primer(5’-3’) Reverse primer(5’-3’)

Kpm2 bph2 Hinf I TAAGATTGCCAAGAGAAATGTC AATTCCGGCTTGGGCTGAGAAATG
9643.T4 Xa3 Taqa I AGCCGAGCAATGATACCGACA ACAACTGGGATCGAACCGACA
Indel7 Stv-bi - AAATTCCAATGCCCAAAACC TCCTCATGGAGCTCATCCAA

Major agronomic traits and yield components. (Iksan : ’10~’12)

Variety N Heading date Culm length (cm) Panicle length (cm) No. of panicles per hill No. of grains per panicle Ratio of ripened grain (%) Brown rice 1000 grain weight (g)

Chindeul 9 Aug. 15 83 22 13 116 88.8 21.7
Nampyeong 9 Aug. 14 80 21 13 104 87.1 21.1
T-value 16z 0.53nsy 1.18ns 2.12ns -0.31ns 1.50ns 0.32ns 10ns

zDegree of freedom of t-test with same variance (pooled variance)

yns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Reaction to environmental and physiological stress. (LAT : ’10~sss’12)

Variety Appearance of wilting Adult leaf senescence Cold tolerancez Viviparous germinationy (%) Field lodging resistancex (1-9)

Seeding stage (0-9) Heading delay (days) Grain fertility (%)

Chindeul Strong Late 3 13 46 10.4 1
Nampyeong Strong Late 4 11 32 2.7 1

zCold tolerance was evaluated at Chuncheon cold-water irrigated nursery

yGermination rate at 7th day after incubation (25°C)

xMean lodging degree under wet direct seeding of local adaptability test for 2010 to 2012

Reaction to leaf blast and neck blast. (LAT : ’10~’12)

Variety No. of nursery based on reaction to leaf blast Field test of neck blast

Rz (0~3) M (4~6) S (7~9) Ave. Rate of disease panicle(%)

Icheon Jecheon Iksan Milyang

Chindeul 7 6 1 3.8 0.0 0.1 0.4 0.0
Nampyeong 5 9 0 3.6 0.7 0.0 1.0 0.0

zR : Resistant, M : Moderate, S : Susceptible

Reaction to major disease and insect pest. (LAT : ’10~’12)

Variety Bacterial blight Virus disease (%) Planthopper



K1z K2 K3 K3a RSVy RDV RBSDV BPHx SBPH

Chindeul Rw R R S R(8.3) S(80.0) S(91.1) R S
Nampyeong S S S S S(7.6) R(8.4) S(89.0) S S

zK1 : HB1013, K2 : HB1014, K3 : HB1015, K3a : HB1009

yRSV : Rice stripe virus, RDV : Rice dwarf virus, RBSDV : Rice black-streaked dwarf

xBPH : Brown planthopper, SBPH : Small brown planthopper

w)R : Resistant, M: Moderate, S: Susceptible

Grain quality and palatability properties of ‘Chindeul’. (LAT : ’10~’12)

Variety N Translucency (1-9) White core/belly (0-9) Amylose content (%) Protein content (%) Palatability of cooked rice (-3~+3)

Chindeul 9 1 0/1 19.7 5.9 0.39
Nampyeong 9 1 0/0 19.7 6.9 0.18
T-value 16z - - 0.00nsy -3.52* 15.3**

zDegree of freedom of t-test with same variance (pooled variance)

yns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Milling properties of ‘Chindeul’. (LAT : ’12)

Variety N Brown rice recovery (%) Milled/brown rice ratio (%) Milling ratio (%) Immature rice ratio (%) Head rice recovery (%) Milled rice recovery (%)

Chindeul 3 83.6 89.4 74.8 0.0 88.3 66.0
Nampyeong 3 82.7 89.8 74.2 0.0 91.3 67.7
T-value 7 z 2.53nsy -2.18ns 0.88ns - -0.08ns 0.04ns

zDegree of freedom of t-test with same variance (pooled variance)

yns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Yield summary of local adaptability test. (LAT : ’10~’12)

Culture season Region No. of test sites Milled rice(MT/ha) Index

Chindeul (A) Nampyeong (B) A/B

Ordinary planting West-southern coast 3 5.44 4.96 110
Honam plain 5 5.58 5.23 107
Youngnam plain 4 5.87 5.44 108
Middle plain 1 5.22 4.75y 110

Mean 13 5.61a 5.20az 108

Late planting Honam plain 1 4.78 4.98 96

Double cropping Youngnam plain 1 5.13 4.89 105

zThe Means with the same letter are not significantly different at P < 0.05 in the least significant difference test (LSD0.05)

yMiddle plain standard variety was Hwaseongbyeo

Table 1. DNA markers and restriction enzymes used to detect of R-genes against the brown planthopper, bacterial blight, and rice stripe virus.
Table 2. Major agronomic traits and yield components. (Iksan : ’10~’12)

Degree of freedom of t-test with same variance (pooled variance)

ns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Table 3. Reaction to environmental and physiological stress. (LAT : ’10~sss’12)

Cold tolerance was evaluated at Chuncheon cold-water irrigated nursery

Germination rate at 7th day after incubation (25°C)

Mean lodging degree under wet direct seeding of local adaptability test for 2010 to 2012

Table 4. Reaction to leaf blast and neck blast. (LAT : ’10~’12)

R : Resistant, M : Moderate, S : Susceptible

Table 5. Reaction to major disease and insect pest. (LAT : ’10~’12)

K1 : HB1013, K2 : HB1014, K3 : HB1015, K3a : HB1009

RSV : Rice stripe virus, RDV : Rice dwarf virus, RBSDV : Rice black-streaked dwarf

BPH : Brown planthopper, SBPH : Small brown planthopper

)R : Resistant, M: Moderate, S: Susceptible

Table 6. Grain quality and palatability properties of ‘Chindeul’. (LAT : ’10~’12)

Degree of freedom of t-test with same variance (pooled variance)

ns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Table 7. Milling properties of ‘Chindeul’. (LAT : ’12)

Degree of freedom of t-test with same variance (pooled variance)

ns, *, and ** indicate no significant, significant at P<0.05, and P<0.01, respectively

Table 8. Yield summary of local adaptability test. (LAT : ’10~’12)

The Means with the same letter are not significantly different at P < 0.05 in the least significant difference test (LSD0.05)

Middle plain standard variety was Hwaseongbyeo