Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

동아시아 재래종 밀( L.) 유전자원의 고분자 글루테닌 조성과 숙기 특성 평가

Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period

Korean Journal of Breeding Science 2015;47(3):264-275.
Published online: August 31, 2015

National Agrobiodiversity Center, National Academy of Agricultural Science, RDA, Jeonju 560-500, Rep. of Korea

*Corresponding author (reset00@korea.kr, Tel: +82-63-238-4901, Fax: +82-63-238-4909)
• Received: August 10, 2015   • Revised: August 28, 2015   • Accepted: August 31, 2015

© Korean Society of Breeding Science All rights reserved

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 93 Views
  • 0 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Geographical comparison of genetic diversity in Asian landrace wheat (Triticum aestivum L.) germplasm based on high-molecular-weight glutenin subunits
    Sukyeung Lee, Yu-Mi Choi, Myung-Chul Lee, Do Yoon Hyun, Sejong Oh, Yeonju Jung
    Genetic Resources and Crop Evolution.2018; 65(6): 1591.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Korean. J. Breed. Sci.. 2015;47(3):264-275.   Published online September 30, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Korean. J. Breed. Sci.. 2015;47(3):264-275.   Published online September 30, 2015
Close

Figure

  • 0
  • 1
  • 2
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period
Image Image Image
Fig. 1. Evaluation of HMW-GS with standard line by using SDS-PAGE and DNAmarker. 1: Chinese spring, 2: Hope, 3: Bezostaya-1, 4: Gabo, 5: Danchi, 6: Halberd 7: Reeves 8: Yuunnanense.
Fig. 2. Unweighted pair group method using arithmetic algorithm (UPGMA) tree of accessions based on the HMW glutenin subunit composition of each accession. Blue colored accessions are originated from Korea, red ones are china, and green ones are Japan. Major two groups are GroupI and GroupⅡ are separated from the beginning.
Fig. 3. Distribution of maturity period of accessions which got full mark of Glu-1 score (A) and Glu-D1d allele (B) Red bars means preferable maturity period considering double cropping with rice.
Evaluation of East Asian Landrace Wheat Revealed by High Molecular Weight Glutenin and Maturity Period

Sequence of primers for Glu-1 allele and expected PCR fragment size.

Allele Forward & Reverse Primer Reference Fragment size (bp) Annealing Temp. (°C)

Axnull F: ACGTTCCCCTACAGGTACTA Moczulski (2003) 920 65
R: TATCACTGGCTAGCCGACAA
Ax2*/Ax1 orAxnull F: CGAGACAATATGAGCAGCAAG Liu (2008) 344/362 60
R: CTGCCATGGAGAAGAAGTTGGA

Bx7/17 F: CGCAACAGCCAGGACAATT Ma (2003) 630+766/699 58
R: AGAGTTCTATCACTGCCTGGT
By8/9 F: TTCTCTGCATCAGTCAGGA Lei (2006) 662/707 59
R: AGAGAAGCTGTGTAATGCC

Dx2/Dx5 F: GGGACAATACGAGCAGCAAA Liu (2008) 281/299 60
R: CTTGTTCCGGTTGTTGCCA
Dy10/Dy12 F: CGCAAGACAATATGAGCAAACT Liu (2008) 397/415 60
R: TTGCCTTTGTCCTGTGTGC

Conditions of PCR for Glu-1 alleles.

Glu-A1xz Glu-B1xy Glu-B1yx Glu-D1xyw

PCR components
Taq DNA polymerase (U) 1 2x premix
dNTP (mmol/l) 0.8
each primer for a gene (umole/l) 0.26/0.14 0.4 0.4 0.26/0.14
concentration of DNA (ng) 40 40 40 40

PCR amplification condition
Denature 94°C 30s 98°C 5s 94°C 30s 98°C 5s
Annealing 60°C 30s 58°C 5s 60°C 30s 60°C 5s
Extension 72°C 1m 72°C 10s 72°C 30s 72°C 10s
No. of cycles 35 35 35 35

Gel electorphoresis
Agarose (%) 1.5 2 2 3
Voltage (V) 150 100 100 150
Time (min) 15 30 30 20

zGlu-Ax1, 2*, Null genes were analyzed

yGlu-Bx6,7,17 were analyzed

xGlu-By8,9,15,16 were analyzed

WGlu-Dx2,5, Glu-Dy10,12 were analyzed

Scores assigned to individual High Molecular Weight Glutenin Subunitsz. (Khan and Shewry 2009)

Score Glu-A1 Glu-B1 Glu-D1

4 - - 5+10(d)
3 1(a), 2*(b) 17+18(i), 7+8(b), 7*+9y(c), 13+16(f), 14+15y(h) -
2 - - 2+12(a), 3+12(b)
1 Null(c) 7(a), 6+8(d), 20y(e) 4+12(c), 2.2+12x(f)

zSubunit scores were deduced by genetic analysis and quoted by Payne et al. (1987). And the basic scoring system was adapted from Cornish et al. (2006). Allele symbol in brackets was designated by McIntosh et al. (1998)

yThese subunits are upgraded or newly allocated after analyzing varieties from original Glu-1 scoring system

xfrom Takata (2003)

Distribution of Heading date and Maturity date of germplasm used in this study focusing on origin.

Heading date No. of accessions Maturity date No. of accessions


Koreax Chinay Total Korea China Total

Middle Apr 1 1
Late Apr 100 100 Late Mayw 15 15
Early May 49 49 Early Junx 43 111 154
Middle May 266 3 269 Middle Jun 235 28 263
Late May 32 2 34 Late Jun 21 1 22
Early Jun 1 1


Total 299 155 454 Total 299 155 454

zThe seeding date of accessions from Korea was 2012/10/25

yThe seeding date of accessions from China was 2013/10/14

xaverage maturity period of standard cultivars in 2013

waverage maturity period of standard cultivars in 2014

Allelic composition at loci Glu-A1, Glu-B1, Glu-D1 of 8 standard cultivars.

No. Standards’ name Glu-A1 Glu-B1 Glu-D1

1 Chinese Spring N 7+8 2+12
2 Hope 1 6+8 5+10
3 Bezostaya-1 2* 7*+9 5+10
4 Gabo 2* 17+18 2+12
5 Danchi 2* 7+8 2.2+12
6 Halberd 1 20 5+10
7 Loros 2* 13+16 4+12
8 Novosadska-100 N 7+8 2+12*

Allelic variation of Glu-1 loci of 381 accessions from Korea, China, and Japan.

Locus allele subunit Korea China Japan Total

nz py n p n p n p

Glu-A1 a 1 14 5.6 53 52.5 4 13.8 71 18.7
b 2* 16 6.4 22 21.8 2 6.9 40 10.5
c Null 221 88.0 26 25.7 23 79.3 270 71.1

Glu-B1 b 7+8 165 65.7 27 26.7 18 62.1 210 55.3
c 7*+9 9 3.6 40 39.6 1 3.4 50 13.2
d 6+8 2 0.8 - - - - 2 0.5
e 20 1 0.4 - - - - 1 0.3
f 13+16 - - 1 1.0 - - 1 0.3
h 7+15 10 4.0 5 5.0 - - 15 3.9
i 17+18 2 0.8 12 11.9 - - 14 3.7
u 7*+8 62 24.7 16 15.8 10 34.5 88 23.2

Glu-D1 a 2+12 160 63.7 63 62.4 21 72.4 244 64.2
b 3+12 3 1.2 - - - - 3 0.8
c 4+12 1 0.4 - - - - 1 0.3
d 5+10 4 1.6 37 36.6 1 3.4 42 11.1
e 2+10 - - 1 1.0 - - 1 0.3
f 2.2+12 83 33.1 - - 7 24.1 90 23.7

zNumber of accessions

yFrequency shown as percentage

Origin specific variation of Glu-1 score.

Origin Glu-1 score

4 5 6 7 8 9 10

Korea 51 122 6 6 3
China 13 48 23
Japan 3 12 4

Total - 54 147 6 58 - 26

Origin specific variation of PIC value.

Origin No. of accession No. of compostion PICz

Korea 251 27 0.35
China 101 26 0.53
Japan 29 9 0.35

zPIC = 1eq

Accessions having perfect 10 glu-1 score or Glu-D1d allele with early maturityz.

Accession No. Origin Heading time Maturity date

10 out of 10 for Glu-1 score IT215901 CHN 4/30 6/5
IT229787 CHN 4/29 6/10
IT246662 CHN 5/2 6/5
K151836 CHN 4/26 6/5
K151837 CHN 4/28 6/5
K151838 CHN 4/28 6/5
K151839 CHN 4/28 6/9
K151843 CHN 4/26 6/5
K151847y CHN 4/28 5/30
K151865y CHN 4/29 5/30
K151870 CHN 4/28 6/2
K151893 CHN 5/1 6/10
K151917 CHN 4/29 6/5
K151928 CHN 4/30 6/5
K151929 CHN 4/30 6/5
K151962y CHN 4/24 5/30

Glu-D1d allele K151835 CHN 4/28 6/10
K151844 CHN 4/28 6/5
K151858y CHN 4/26 5/30
K151875 CHN 4/29 6/5
K151876 CHN 4/30 6/5
K151896 CHN 4/28 6/10
K151898 CHN 4/29 6/5
K151918 CHN 4/29 6/5
K151919 CHN 4/29 6/5
K151921 CHN 4/30 6/5
K151922 CHN 4/30 6/5
K151924 CHN 4/29 6/5
K151925 CHN 4/30 6/5
K151933 CHN 5/3 6/10

zBefore 10th June considering double cropping with rice

yAccession with especially early maturity

Table 1. Sequence of primers for Glu-1 allele and expected PCR fragment size.
Table 2. Conditions of PCR for Glu-1 alleles.

Glu-Ax1, 2*, Null genes were analyzed

Glu-Bx6,7,17 were analyzed

Glu-By8,9,15,16 were analyzed

Glu-Dx2,5, Glu-Dy10,12 were analyzed

Table 3. Scores assigned to individual High Molecular Weight Glutenin Subunitsz. (Khan and Shewry 2009)

Subunit scores were deduced by genetic analysis and quoted by Payne et al. (1987). And the basic scoring system was adapted from Cornish et al. (2006). Allele symbol in brackets was designated by McIntosh et al. (1998)

These subunits are upgraded or newly allocated after analyzing varieties from original Glu-1 scoring system

from Takata (2003)

Table 4. Distribution of Heading date and Maturity date of germplasm used in this study focusing on origin.

The seeding date of accessions from Korea was 2012/10/25

The seeding date of accessions from China was 2013/10/14

average maturity period of standard cultivars in 2013

average maturity period of standard cultivars in 2014

Table 5. Allelic composition at loci Glu-A1, Glu-B1, Glu-D1 of 8 standard cultivars.
Table 6. Allelic variation of Glu-1 loci of 381 accessions from Korea, China, and Japan.

Number of accessions

Frequency shown as percentage

Table 7. Origin specific variation of Glu-1 score.
Table 8. Origin specific variation of PIC value.

PIC = 1eq

Table 9. Accessions having perfect 10 glu-1 score or Glu-D1d allele with early maturityz.

Before 10th June considering double cropping with rice

Accession with especially early maturity