Warning: DOMDocument::load(): Entity 'emsp' not defined in /home/virtual/kjbs/xmls/KJBS-48-3-206.xml, line: 248 in /home/virtual/kjbs/journal/journal/view.php on line 63

Warning: DOMDocument::load(): Entity 'emsp' not defined in /home/virtual/kjbs/xmls/KJBS-48-3-206.xml, line: 248 in /home/virtual/kjbs/journal/journal/view.php on line 63

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Node XML_ENTITY_REF_NODE is invalid here : processing node in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing childrens list in /home/virtual/kjbs/journal/journal/view.php on line 110

Warning: DOMNode::C14N(): Internal error : processing docs children list in /home/virtual/kjbs/journal/journal/view.php on line 110
Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars
Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

ARTICLE

Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars


Published online: August 31, 2016

1 전북대학교 농업생명과학대학 작물생명과학과,

1 Department of Crop Science and Biotechnology, Chonbuk National University, Jeonju 54896, Korea

2 국립식량과학원,

2 National Institute of Crop Science, RDA, Wanju, 55365, Korea

3 국립농업과학원

3 National Institute of Agricultural Sciences, RDA, Wanju, 55365, Korea

*Corresponding author (pcs89@jbnu.ac.kr, +82-63-270-2533, +82-63-270-2640)
• Received: June 1, 2016   • Accepted: August 9, 2016

© The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 96 Views
  • 0 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Influence of protein characteristics and the proportion of gluten on end-use quality in Korean wheat cultivars
    Seong-Woo Cho, Chon-Sik Kang, Hyeon Seok Ko, Byung-Kee Baik, Kwang-Min Cho, Chul Soo Park
    Journal of Integrative Agriculture.2018; 17(8): 1706.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars
Korean. J. Breed. Sci.. ;48(3):206-216.   Published online September 30, 2016
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars
Korean. J. Breed. Sci.. ;48(3):206-216.   Published online September 30, 2016
Close

Figure

  • 0
  • 1
  • 2
  • 3
Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars
Image Image Image Image
Fig. 1. A-PAGE patterns (A) and diagram (B) of gliadin in Korean wheat cultivars. CS, Chinese spring; 1, Dahong; 2, Tapdong; 3, Olgeuru; 4, Keumkang; 5, Jinpoom; 6, Younbaek; 7, Shinmichal1; 8, Shinmichal; 9, Chunggye; 10, Gobun; 11, Sukang; 12, Jopoom; 13, Joeun.
Fig. 3. Agarose gel electrophoresis of PCR amplified ω5-gliadin (A) and γ-gliadin (B), and electrophoretic patterns of γ-gliadin (C) in Korean wheat cultivars. M, molecular size marker; 1, Ol; 2, Geuru; 3, Dahong; 4, Olgeuru; 5, Saeol; 6, Jinpoom; 7, Milsung; 8, Jopoom; 9, Shnmichal; 10, Goso; 11, Jojoong; 12, Baekchhal.
Fig. 2. Agarose gel electrophoresis of PCR amplified Gli-A1.1/2 (A), Gli-B1.1/2 (B) and Gli-D1.1/2 (C) in Korean wheat cultivars. M, molecular size marker; 1, Jopoom; 2, Jojoong; 3, Sudun; 4, Joa; 5, Uri; 6, Saeol.
Fig. 4. Agarose gel electrophoresis of PCR amplified Spa-A1 (A), Spa-B1 (B) and Spa-D1 (C) in Korean wheat cultivars. M, molecular size marker; 1, Ol; 2, Geuru; 3, Dahong; 4, Olgeuru; 5, Saeol; 6, Jinpoom; 7, Milsung; 8, Jopoom; 9, Shnmichal; 10, Goso; 11, Jojoong; 12, Baekchhal.

Warning: simplexml_load_file(): /home/virtual/kjbs/journal/../xmls/KJBS-48-3-206.xml:248: parser error : Entity 'emsp' not defined in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75

Warning: simplexml_load_file(): <td rowspan="2">&emsp;&emsp;GAG0506</td> in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75

Warning: simplexml_load_file(): ^ in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75

Warning: simplexml_load_file(): /home/virtual/kjbs/journal/../xmls/KJBS-48-3-206.xml:248: parser error : Entity 'emsp' not defined in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75

Warning: simplexml_load_file(): <td rowspan="2">&emsp;&emsp;GAG0506</td> in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75

Warning: simplexml_load_file(): ^ in /home/virtual/kjbs/journal/journal/include.viewer.php on line 75
Evaluation of Gliadin and Storage Protein Activator (Spa) in Korean Wheat Cultivars

Oligonucleotides and PCR conditions used for genotyping ω5-gliadin, γ-gliadin and Spa genes.

Gene & marker name Forward and reverse primers (5’→3’) Fragment size (bp)

ω5- gliadin
F: AAGTGAGCAATAGTAAACACAAATCAAAC ω-5a (1,400bp)
R: CGTTACATTATGCTCCATTGACTAACAACGA ω-5b (1,200bp)
γ- gliadin
  GAG0506 F: ACAATGGCCACAACAACAAC 650bp/800bp
R:TGCCCTGGCCTGGGC
GliA1.1 F: CATAGCGTCGTGCATTCCAACG 168
R: GCACATGTTTGGAAGGGATC
GliA1.2 F: CATAGCGTCGTGCATTCCAACA 168
R: GCACATGTTTGGAAGGGATC
GliB1.1 F: TGATCTGGCCACAAAGGGA 369
R: CATTGGCCACCAATTCCTGT
GliB1.2 F: TGATCTGGCCACAAAGGGC 397
R: CATTGGCCACCAATTCCTGT
GliD1.1 F: AAGCGATTGCCAAGTGATGCG 264
R: GTTTGCAACACCAATGACGTA
GliD1.2 F: AAGCGATTGCCAAGTGATGCG 270
R: GCAAGAGTTTGCAACAGCG
Spa
Spa-A1 F: AATAAAGAGAACATGGACGAAC 362/402
R: TGCGATCCTCTCATGTTTATA
Spa-B1 F: ATGGAGCCCGTGTTCTTCTG 311
R: CACCTCTCATGGACGTCGTA
Spa-D1 F: GCTGAATTTGTATCTATCTCG 208/229
R: GCGAGGAATGGTATGGA

Allelic compositions of gliadin using A-PAGE and γ-gliaidn in 40 Korean wheat cultivars.

Allelic compositions of ω5-gliadin, γ- gliadin and Spa in 40 Korean wheat cultivars.

Cultivar ω5-gliadin γ-gliadin Spa§
A1 B1 D1

Alchan + b b Type 1 311bp 208bp
Anbaek a + b a Type 1 311bp 208bp
Baekchal a + b a Type 3 311bp 208bp
Baekjoong a + b a Type 1 311bp 208bp
Chunggye a + b b Type 1 311bp 208bp
Dabun a + b a Type 3 311bp 208bp
Dahong a + b a Type 3 311bp 208bp
Dajoong a + b a Type 1 311bp 208bp
Eunpa a + b b Type 1 311bp 208bp
Geuru a + b a Type 1 311bp 208bp
Gobun a + b b Type 1 311bp 208bp
Goso a + b b Type 2 311bp 208bp
Hanbaek a + b a Type 1 311bp 208bp
Hojoong a + b a Type 1 311bp 208bp
Jeokjoong a + b a Type 1 311bp 208bp
Jinpoom a + b b Type 1 311bp 208bp
Joa a + b a Type 2 311bp 208bp
Joeun a + b h Type 1 311bp 208bp
Jojoong a + b a Type 1 311bp 208bp
Jokyung a + b a Type 1 311bp 208bp
Jonong a + b b Type 1 311bp 208bp
Joongmo2003 a + b h Type 1 311bp 208bp
Joongmo2004 a + b a Type 1 311bp 208bp
Joongmo2008 a + b a Type 1 311bp 208bp
Joongmo2012 a + b a Type 3 311bp 208bp
Jopoom a + b b Type 2 311bp 208bp
Keumkang a + b a Type 1 311bp 208bp
Milsung a + b a Type 3 311bp 208bp
Namhae a + b b Type 1 311bp 208bp
Ol a + b h Type 1 311bp 208bp
Olgeuru a + b b Type 2 311bp 208bp
Saeol a + b b Type 3 311bp 208bp
Shimichal a + b a Type 3 311bp 208bp
Shinmichal1 a + b a Type 1 311bp 208bp
Suan a + b a Type 1 311bp 208bp
Sudun a + b b Type 1 311bp 208bp
Sukang a + b b Type 3 311bp 208bp
Tapdong a + b b Type 1 311bp 208bp
Uri a + b b Type 1 311bp 208bp
Younbaek a + b a Type 1 311bp 208bp

Nomenclature according to Mastuo et al. (2005).

Type a and b indicate γ-45 and γ-42, respectively, in the same nomenclature according to Yildirm et al.(2013). Type h contains both a and b type of γ-gliadin.

Nomenclature according to Ravel et al. (2009). Type 1 in Spa-A1 indicates 362bp which is same to haplotype 1 of Spa-A1 according to Ravel et al. (2009). Type II and III indicate one or two additional PCR products above 362bp.

Table 1. Oligonucleotides and PCR conditions used for genotyping ω5-gliadin, γ-gliadin and Spa genes.
Table 2. Allelic compositions of gliadin using A-PAGE and γ-gliaidn in 40 Korean wheat cultivars.
Table 3. Allelic compositions of ω5-gliadin, γ- gliadin and Spa in 40 Korean wheat cultivars.