Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

밀 고분자 글루테닌 조성 분석을 위한유전자 특이 분자표지 선발

신동진*, 차진경, 이소명, 고종민, 이종희

Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat

Korean Journal of Breeding Science 2020;52(3):235-243.
Published online: September 1, 2020

국립식량과학원 남부작물부

Department of Southern Area Crop Science, National Institute of Crop Science, RDA, Miryang, 50424, Republic of Korea

*Corresponding Author (E-mail: jacob1223@korea.kr, Tel: 82-55-350-1185, Fax: 82-55-352-3059)
• Received: March 26, 2020   • Revised: May 18, 2020   • Accepted: June 5, 2020

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 114 Views
  • 0 Download
  • 7 Crossref
prev next
  • AbstractThe high-molecular-weight glutenin subunit (HMW-GS) composition of wheat is the main factor controlling gluten strength related to bread baking quality. Reported molecular markers for HMW-GS were validated and selected for improved breeding efficiency in South Korean wheat breeding programs. Sodium dodecyl sulfate polyacrylamide gel electrophoresis, lab-on-a-chip electrophoresis, sequence-tagged site (STS) markers, and Kompetitive Allele-Specific PCR were performed to re-evaluate the known HMW-GS of 14 wheat cultivars. Glu-A1b and Glu-A1c alleles were separated by the STS marker, UMN19, and KASP marker, namely Glu-Ax1/2*_SNP, at Glu-1 loci. At the Glu-B1 locus, Glu1-By8 and Glu1-By9 could be distinguished from Glu-B1b and Glu-B1c alleles by two STS markers, namely ZSBy8 and ZSBy9a, respectively. Glu1-Bx17 and Glu1-7OE could respectively be separated from non-Glu-B1i and non-Glu-B1al alleles by cauBx642 and BX7OE_866_SNP. The Glu-D1d allele, used to determine bread baking quality, could easily be distinguished from other alleles by Glu-D1d_SNP at Glu-D1 loci. Validated molecular markers in this study could therefore be used to select wheat lines for good bread baking quality in South Korean wheat breeding programs.
밀은 세계적으로 매년 약 7억톤이 생산되는 육배체(2n=6x=42, AABBDD) 작물로 빵이나 국수를 포함한 다양한 가공 제품으로 인간에게 영양분을 제공한다(Shewry & Hey 2015). 밀의 가공적성은 종자 저장단백질인 글루테닌과 글리아딘의 이황화결합(disulfide bond)과 비공유성 수소결합으로 이루어진 글루텐의 양과 질에 의해 결정된다(Gilbert et al. 2000). 글루테닌은 단백질 분자량에 따라 고분자 글루테닌(high-molecular-weight glutenin subunits, HMW-GS)과 저분자 글루테닌(low-molecular-weight glutenin subunits, LMW-GS)으로 분류되며 밀가루 반죽의 탄성(elasticity)과 강도(strength)를 결정한다(Ortolan & Steel 2017).
HMW-GS 유전자좌는 A, B, D 각 1번 염색체 장완에 있으며, 분자량이 큰 x-type과 분자량이 작은 y-type의 유전자로 나뉘며, 대부분의 품종에서 Glu-A1 유전자좌의 y-type 유전자는 비활성화되어 단백질이 합성되지 않는다(Payne & Lawrence 1983). Payne 그룹의 초기 보고에서는 Glu-A1 유전자좌에는 3개의 대립유전자가 보고되었고, Glu-B1 유전자좌에는 11개, Glu-D1 유전자좌에 7개의 대립유전자가 알려 졌다. 최근 단백질 동정 기술과 유전체 정보 분석 기술의 발달로 현재까지 Grain Genes 2.2 Database에는 Glu-A1Glu-B1, Glu-D1 유전자좌에 각각 22개, 52개, 36개의 대립유전자가 보고되었다(Peng et al. 2015, Roy et al. 2018). 그러나 세계적으로 대부분 육성 품종에는 특정 Glu-1 대립유전자의 빈도가 높았는데, Glu-A1 유전자좌에서는 Glu-A1b 대립유전자가 55%로 가장 높았고, Glu-B1 유전자좌에서는 Glu-B1b, Glu-B1cGlu-B1i의 대립유전자 빈도가 높았으며, Glu-D1 유전자좌에서는 Glu-D1aGlu-D1d 대립유전자의 빈도가 높았다(Table 1, Yasmeen et al. 2015). 또한, 빵에 적합한 글루텐 특성을 지닌 품종은 대부분 Glu-A1Glu-D1 유전자좌에서 각각 Glu-A1aGlu-A1b 대립유전자와 Glu-D1d 대립유전자를 지녔으며, Glu-B1 유전자좌에서는 Glu-B1iGlu-B1al 대립유전자를 지닌 품종의 제빵 적성이 우수하였다(Anjum et al. 2007, Gao et al. 2020).
HMW-GS 조성 분석을 위하여 SDS-PAGE 분석 방법이 최근까지 활용되고 있지만, 분석 시간이 길고 대량 검정에 한계가 있어 DNA 분자 표지를 활용한 방법이 많이 이용되고 있다(Ravel et al. 2020). 최근에는 형광물질 이용하여 전기영동없이 유전형 분석을 쉽고 빠르게 할 수 있는 TaqMan과 Kompetitive allele- specific PCR (KASP) 등을 활용한 분자표지가 개발되어 육종 프로그램에서 대량 유전형 검정이 이루어지고 있다(Tan et al. 2017, Kang et al. 2020). 밀에서도 목표 형질을 도입하고 유전체 배경을 분석할 수 있는 방법으로 신뢰도가 높고 가격이 저렴한 rhAMP 방법이 제안되었으며, 국내에서도 밀 종실 경도에 연관된 Pinb-D1 유전형 분석에 활용되었다(Ayalew et al. 2019, Choi et al. 2020). HMW-GS 조성 분석을 위한 STS, SNP, KASP 등의 분자표지가 다양하게 개발되었지만, 국내 밀 육종 프로그램에서 빵용 품종 개발을 위한 HMW-GS의 분자 표지 활용은 미흡한 실정이다(Yuan et al. 2014, Rasheed et al. 2016, Ravel et al. 2020). 본 연구에서는 기존에 보고된 HMW-GS 분자표지를 검토하여 국내 육종 프로그램에 활용하기 위한 기초자료를 얻기 위하여 수행 하였다.
SDS-PAGE와 Lab-on-a-chip을 이용한 고분자 글루테닌 단백질 조성 분석
고분자 글루테닌의 조성이 알려져 있는 조경과 조품 등 국내 육성 품종 5종과 Petrel, Brimstone 등 국외 육성 품종 11종을 사용하였다. 종자 1립에서 배를 제거하고 배유를 막자사발로 분쇄하고 Singh et al. (1991)의 방법을 변형하여 밀 고분자 글루테닌의 단백질을 추출하였다. 분쇄된 종자에 1,000 ml의 extraction buffer (50% 1-propanol, 80 mM TrisHCl pH 8.0)을 첨가하고, 원심분리(12,000rpm, 5분) 후 글리아딘과 알부민 등이 포함되어 있는 상등액을 제거하였다. 침전물에 500 ml의 denaturation buffer (50% 1-propanol, 1% (w/v) dithiothreitol, 80 mM TrisHCl pH 8.0)을 첨가하고 60°C에서 30분간 방치하고 원심분리(12,000 rpm, 10분)하여 고분자 글루테닌이 포함된 상등액을 새 튜브에 옮겨 사용 전까지 초저온냉동고에 보관하였다. 고분자 글루테닌의 단백질 조성 분석을 위하여 3-8% Criterion XT Tris-acetate protein gel (Bio-Rad, 미국)을 사용하여 Criterion vertical electrophoresis cell (BioRad, 미국)에서 SDS-PAGE 전기영동을 매뉴얼에 따라 수행하였다(Geisslitz et al. 2020). 추출한 10 ml 고분자 글루테닌 단백질에 동량의 Laemmli sample buffer를 넣고 150V에서 4시간 동안 전기영동 하였다. Coomassie brilliant blue staining solution으로 염색 후 젤 사진을 확보하였다.
Lab-on-a-chip을 이용한 고분자 글루테닌의 조성 분석은 추출한 1 ml 고분자 글루테닌 단백질을 제조사 매뉴얼에 따라 Protein 230(Agilent Technologies, 미국) 칩에 넣고 2100 bioanalyzer (Agilent Technologies, 미국) 기기를 이용하여 전기영동 하였다. 고분자 글루테닌의 조성은 Mondal et al. (2008)의 방법에 따라 판독하였다. 고분자 글루테닌의 단백질 정량은 2100 bioanalyzer (Agilent Technologies, 미국) 프로그램을 이용하였다.
분자표지를 이용한 고분자 글루테닌 대립유전자 유전형 분석
DNA 추출은 파종 후 21일된 유묘의 잎을 채취하여 CTAB (cetyltrimethyl ammonium bromide) 방법으로 추출하였다(Murray & Thompson 1980). 문헌조사를 통하여 기존 개발된 젤 기반 HMW-GS 분자표지 중 다수의 문헌에서 검토된 분자표지 12종과 KASP 분자표지 5종 선발하였다(Tables 2, 3). 젤 기반 분자표지의 PCR은 분리된 gDNA 50 ng와 유전자 특이 프라이머 0.5 nmole, 0.3 ml Taq polymerase, 200 mM dNTP, 1×PCR buffer을 첨가하여 수행하였다. PCR 기기는 Veriti Thermal Cycler (Applied biosystem, Carlsbad, 미국)를 사용하였다. KASP 분자표지는 기존 보고된 염기서열을 사용하였으며, PCR 반응은 50 ng의 gDNA와 1×KASP Master mixture, 0.056 ml의 프라이머를 첨가하여 수행하였다. 젤 기반 분자표지와 KASP 분자표지의 PCR은 Touch down 방법으로 65°C에서 시작하여 각 횟수 마다 0.6°C씩 온도를 낮추어서 PCR을 10회 수행한 후 56°C에서 30초, 72°C에서 45초 총 30회 반복하고 72°C에서 5분간 처리한 후 반응을 종료하였다. 젤 기반 분자표지의 PCR 산물은 3% agarose gel에서 전기영동하고 Gel documentary system을 통하여 사진을 확보하였다. KASP 분자표지는 7500 fast Real-Time PCR system (Applied biosystems, 미국)을 통하여 FAM과 HEX 필터를 이용하여 유전형을 분석하였다(Allen et al. 2013).
분자표지 선발을 위한 표준 품종의 고분자 글루테닌 단백질 조성 검정
밀 육성 품종과 재래종에서 다양한 HMW-GS가 보고되어 있으나 육성 품종에는 품질에 영향력이 큰 몇몇 HMW-GS가 이용되고 있다(Yasmeen et al. 2015). 품종 육성에 활용되고 있는 HMW-GS의 주요 대립유전자를 판독할 수 있는 분자표지를 검정하기 위하여 본 연구에서는 Table 1과 같이 주요 대립유전자를 대표할 수 있는 고분자 글루테닌 조성이 보고된 국내외 품종 14종을 표준품종으로 수집하고 활용하였다(Jang et al. 2017). 본 연구에 이용된 품종의 Glu-A1 대립유전자는 Glu-A1a, Glu-A1bGlu-A1c 3종류였고, Glu-B1 유전자좌에는 Glu-B1cGlu-B1i 등 6 종류였으며, Glu-D1 유전자좌에는 Glu-D1aGlu-D1d 등 4 종류를 포함하고 있었다.
SDS-PAGE 방법과 Lab-on-a-chip 전기영동 방법을 이용하여 HMW-GS 조성을 확인하였다(Fig. 1). SDS-PAGE 방법은 주로 15×15 cm 이상의 사이즈가 큰 젤이 많이 이용되는데, 크기가 크면 HMW-GS 조성을 명확하게 판독할 수 있는 장점이 있지만, 전기영동 시간이 오래 걸리는 단점이 있다. 이를 극복하고자 젤 크기를 13×8.7 cm로 줄이고 농도 구배(3-8%)를 포함하여 젤 농도를 다양하게 처리하여 분석하였다(7.5%, 10%, 12%, 15%). 7.5%, 10%와 12%는 전기영동의 시간이 3-5시간으로 줄어들었지만, Glu-D1 유전자좌의 Glu-D1y10과 Glu-D1y12의 구별이 불가능하였다. 15% 농도는 전기영동 시간이 8 시간 이상으로 길었다. 농도구배 젤의 경우 전기영동 시간은 4시간 이내였으며, Glu-D1y10과 Glu-D1y12의 구별이 가능하였다(Fig. 1). 농도구배 SDS-PAGE를 이용한 결과, 본 연구에 이용된 14개 품종의 HMW-GS 조성은 기본에 보고된 결과와 일치하였다(Fig. 1, Table 4).
SDS-PAGE에서는 HMW-GS 분자량이 약 70ka 이상이지만, Lab-on-a-chip을 이용하였을 때는 95 kDa 이상으로 나타나며, SDS-PAGE 결과와 달리 Glu-D1x5이 Glu-A1a나 Glu-A1b보다 분자량이 크게 나타나는 역전현상이 Lab-on-a-chip에는 발생한다(Mondal et al. 2008). 그러나 Lab-on-a-chip은 분석 시간이 짧고, 단백질 정량을 쉽게 할 수 있는 장점이 있다. Lab-on- a-chip으로 14 품종의 HMW-GS를 분석한 결과 SDS-PAGE 분석과 동일하였다.
Glu-A1 유전자좌 유전형 판별 분자표지 검정
Glu-A1 유전자좌의 y-type 유전자는 유전자 침묵(gene silencing)으로 발현이 되지않고 x-type 대립유전자인 Glu1-A1a, Glu1-A1bGlu1-A1c만이 발현된다(De Bustos et al. 2000). 3개의 Glu-A1 대립유전자 분자표지 탐색을 위하여 아가로스 젤 기반의 STS 분자표지 2종(UMN19, Ax2*)과 형광 기반의 KASP 분자표지 2종(Glu-Ax1/Ax2*_SNP와 GLu-Ax2*_IND)을 검정하였다(Ma et al. 2003, Liu et al. 2008, Rasheed et al. 2016). 공우성(co-dominant) STS 분자표지인 UMN19는 Glu1-A1b (344 bp)를 Glu1-A1aGlu1-A1c (362 bp)로부터 구별할 수 있으며, 우성(dominant) STS 분자표지인 Ax2*도 Glu1-A1b를 특이적으로 구별할 수 있다(Ma et al. 2003, Liu et al. 2008). 이들 분자표지는 UMN19는 국내 품종 중에서 Glu1-A1b를 지닌 금강과 Glu1-A1a를 지닌 조경과 Glu1-A1c인 중모2008의 구분은 가능하였지만, 조경과 중모2008을 구분할 수 는 없었다(Fig. 2A). 이러한 문제를 해결하기 위해 KASP 분자표지인 Glu-Ax1/x2*_SNP와 Glu-Ax2*_IND를 적용한 결과, Glu1-A1c를 지닌 품종은 SNP “A” allele로 나타났으며, Glu1-A1aGlu1-A1b를 지닌 품종은 SNP “G” allele로 나타났다(Table 3). Glu-A1b를 구분하는 것으로 알려진 Glu-Ax2*_IND 분자표지는 본 연구에서 사용한 실험 방법에서 FAM과 HEX의 형광 반응이 X축과 Y축으로 명확히 구분되지 않았다. 위의 연구 결과를 종합하면, 국내 밀 육종에서 Glu-A1 유전자형을 구분하기 위해서는 STS 분자표지인 UMN19와 KASP 분자표지인 Glu-Ax1/x2*_SNP를 병행 사용이 효율적인 것으로 보인다.
Glu-B1 유전자좌 유전형 판별 분자표지 검정
Glu-B1 유전자좌에는 50종류 이상 대립유전자가 보고되었지만, 빵용에 적합한 재배 품종은 대부분 Glu-B1b, Glu-B1iGlu-B1al 등을 지닌 것으로 알려져 있다(Lei et al. 2006). 국내 품종에서는 조경과 금강은 Glu-B1b를, 중모2008이 Glu-B1i 대립유전자를 지니고 있으며, 연백과 조품은 Glu-B1f를 가지고 있다. 조경의 Glu-B1b 대립유전자 판별하기 위하여 STS 분자표지인 ZSBy8와 ZSBy9a를 적용하였으며, 기존의 Glu1-Bx7 대립유전자 판별 분자표지는 2,000 bp 이상으로 육종 프로그램에 활용 가능성이 낮아 배제하였다(Anderson & Greene 1989, Rai et al. 2018). 우성 분자표지인 ZSBy8을 이용하여 Glu-B1b을 보유한 Junggye5336, Kenya-5와 Norin 61 품종에서만 특이적으로 DNA가 증폭된 것을 확인하였으며, 공우성인 ZSBy9a 분자표지를 이용하여 Glu-B1c 대립유전자를 보유한 Chukoku122에서 662 bp 밴드를 확인하였고, 다른 대립유전자를 보유한 품종에서는 707 bp의 밴드를 확인하였다(Figs. 3A, 3B).
Glu-B1i 대립유전자의 확인은 2개의 STS 분자표지를 이용하였는데, cauBx642로 유전형을 분석한 결과 Glu-B1i를 지닌 중모2008과 Cajeme, Bl1102는 534 bp의 밴드가 나타났고, Glu1-Bx6을 지닌 Brimstone는 660 bp를, 다른 품종은 642 bp 밴드를 나타내었다(Fig. 3C). 제빵력이 우수한 품종이 Glu-B1al을 지닌 것으로 알려지면서 Glu-B1al 대립유전자에 대한 관심이 높아지고 있는데, 분자표지 검정을 위하여 본 연구에서 평가한 품종과 국내 육성 품종에는 Glu-B1al 대립유전자를 보유한 자원이 없었다. Glu-B1al 자원 선발을 위하여 Lab-on-a-chip 방법 통하여 국립식량과학원 남부작물부에서 보유하고 있는 유전자원의 HMW-GS 조성을 분석하였다. Lab-on-a-chip 분석 결과 Glu-B1b의 조경보다 단백질 발현이 2배 높은 Vesna와 Yecora f-70를 이용하여(Fig. 4), Glu-B1al 대립유전자의 x-type 유전자인 Glu1-Bx7OE 대립유전자를 판별할 수 있는 STS 분자표지 2종(Bx-7OE left, Bx-7OE right)과 KASP 분자표지 1종(BX7OE_866_SNP)을 검정하였다(Ragupathy et al. 2008). STS 분자표지인 Bx-7OE left와 Bx-7OE right는 우성 분자표지로서 Vesna와 Yecora f-70 품종에서 각각 특이적으로 DNA가 증폭되었다(Data not shown). KASP 분자표지인 BX7OE_866_SNP을 이용한 결과, Vesna와 Yecora f-70은 BX7OE_866_SNP 분자표지의 “C”의 SNP를 가지고 있었으며, 다른 대립유전자를 보유한 품종에서는 “G”의 SNP를 가지고 있었다(Fig. 3D). 이러한 결과를 통하여 BX7OE_866_SNP 분자표지와 STS 분자표지를 활용하여 Glu-B1al 대립유전자의 국내 품종으로 도입을 적극적으로 검토해야 할 것이다.
Glu-D1 유전자좌 유전형 판별 분자표지 검정
국내 품종의 Glu-D1 유전자좌에는 Glu-D1a, Glu-D1dGlu-D1f 대립유전자가 존재하는데, Glu-D1dGlu-D1x5Glu-D1y10을 지니고 제빵 적성에 적합한 품종이 반드시 지니고 있어야 하는 대립유전자로 알려져 있다(Zhang et al. 2014). 국내 품종 중에는 금강, 백강, 조경, 탑동, 황금과 중모2008이 Glu-D1d 대립유전자를 지니고 있으며, 대부분의 품종은 Glu-D1f 대립유전자를 가지고 있고 일부 품종이 Glu-D1a 대립유전자를 지니고 있다(Jang el al. 2017). Glu-D1d 대립유전자의 Glu1-Dx5Glu1-Dy10을 판별할 수 있는 4종과 2종을 각각 검정하였다. Glu1-Dx5 구별을 위해 STS 분자표지 3종(UMN25, Dx5-1과 Dx5-2)과 KASP 분자표지 1종(Glu-D1d_SNP)을 이용하였다. 아가로스 젤 기반 분자분자표지인 공우성 분자표지인 UMN25로 Glu1-Dx5를 지닌 중모2008과 Petrel 등은 281 bp가 증폭되었으며, 다른 유전형에서는 299 bp가 증폭되어 Glu1-Dx5를 판별 할 수 있었다(Fig. 5A). 우성 분자표지인 Dx5-1과 Dx5-2는 Glu1-Dx5를 지닌 품종은 각각 478 bp와 450 bp의 단편이 증폭되어 판별이 가능하였지만 공우성 분자표지에 비해서 적용의 한계가 있었다(Fig. 5B). Glu1-Dx5 판별을 위한 KASP 분자표지 Glu-D1d_SNP 검정 결과, Glu1-Dx5를 지닌 품종은 “G” (HEX) SNP를 나타내었고, Glu1-DaGlu1-D1f 대립유전자를 지닌 품종은 “C” (FAM) SNP를 나타내었다(Fig. 5C).
Glu-D1 대립유전자의 y-type 인 Glu1-Dy10Glu1-Dy12를 판별하기 위해, STS 분자표지 2종(UMN26, Dy-10)을 검정하였다. 공우성 분자표지 UMN26의 경우, Glu1-Dy10을 지닌 품종은 397 bp의 DNA 단편이 증폭되었으며, Glu1-Dy12를 지닌 품종은 415 bp의 DNA 단편을 보였다(Fig. 5D). Ahmad M (2000)이 보고한 Glu1-Dy10 판별 분자표지는 본 연구에서는 멀티 밴드 패턴으로 나타나 판별에 이용하기 어려웠다. UMN25와 UMN26을 이용하여 Glu-D1d 대립유전자를 판별이 가능하지만 증폭된 DNA 단편의 차이가 작아 육종 프로그램에서 대량 검정에 활용하였을 때 어려움이 예상되어 KASP 기반의 분자표지 Glu-D1d_SNP를 함께 이용하는 것을 제안한다. 국내 품종이 많이 보유하고 있는 Glu-D1f의 판별을 위한 추가적인 분석도 필요하다.
HMW-GS 조성은 밀의 품질을 결정하는 주요 요인으로 종자 단백질을 추출하여 SDS-PAGE를 이용한 분석이 주로 이루어졌으나, 분석 시간이 오래 걸리는 단점이 있다. 육종프로그램에서 대량 검정을 위하여 본 연구에서는 STS와 KASP 표지인자 적용을 검토하였다. Glu-A1 유전자좌의 Glu-A1b 대립유전자를 판독에는 STS 분자표지인 UMN19와 Glu-A1c 대립유전자를 판독할 수 있는 KASP 분자표지 Glu-Ax1/2*_SNP이 적합하였다. Glu-B1 유전자좌의 Glu-B1b, Glu-B1c와 Glu-B1i 대립유전자 판별을 위한 STS 분자표지로는 ZSBy8, ZSBy9a과 cauBx642가 각각 적합하였다. Glu-B1al 대립유전자 판별을 위해서는 KASP 분자표지 BX7OE_866_SNP가 가능하였다. Glu-D1 유전자좌의 Glu-D1d 대립유전자를 판별할 수 있는 KASP 분자표지로 Glu-D1d_SNP이 가능하였다.
본 논문은 농촌진흥청 연구사업(세부과제명: 밀 고분자 글루테닌의 유전적 조성과 품질 연관성 구명, PJ013564022020)의 지원에 의해 이루어진 것임.
Fig. 1
Analysis of high-molecular-weight glutenin subunit composition of standard varieties used in this study. A. HMW-GS was analyzed by SDS-PAGE with 3~8% Criterion XT tris-acetate protein gel. Each 10m of extracted protein from one seed loaded on the gel. Photograph was taken after coomassie brilliant blue staining and destaining. B. Analysis of HMW-GS by Lab-on-a-chip electrophoresis with Protein 230 kit using 2100 bioanalyzer. HMW-GS composition was analyzed according to its relative molecular weight.
KJBS-52-235-f1.gif
Fig. 2
Evaluation of molecular markers for genotype analysis of Glu-A1 locus. A. Evaluation of molecular marker UMN19 for Glu1-Ax2*. PCR with UMN19 was performed by touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. B and C. Scatter plots for Glu-Ax1/2*_SNP and Glu-Ax2*_IND assay showing clustering of varieties on the X-(FAM) and Y-(HEX) axes. B. Red color indicates Glu1-Ax1 and Glu1-Ax2* allele and blue color shows Glu1-AxNull allele of each varieties. C. Red color indicates Glu1-Ax2* allele and blue color shows Glu1-Ax1 and Glu1-AxNull allele of each varieties. All experiments were repeated three times independently.
KJBS-52-235-f2.gif
Fig. 3
Evaluation of molecular markers for genotype analysis of Glu-B1 locus. A-C. Molecular markers, cauBx642 (A), ZSBy8 (B), and ZSBy9a (C), were examined after agarose gel electrophoresis. All of markers were applied with touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. D and E. Scatter plots for Bx7OE_866_SNP and Bx13_SNP assay, respectively, showing clustering of varieties on the X-(FAM) and Y-(HEX) axes. D. Red color indicates Glu1-nonBx17OE allele and blue color shows Glu1-Bx17OE allele of each varieties. E. Red color indicates Glu1-Bx13 allele and blue color shows Glu1-nonBx13 allele of each varieties. All experiments were repeated three times independently.
KJBS-52-235-f3.gif
Fig. 4
Quantity of each HMW-GS composition. HMW-GS protein was separated on Protein 230 chip with 2100 bioanalyzer and quantity of HMW-GS was calculate with 2100 expert program (Agilent Technologies, CA, USA). Each content was measured as relative content.
KJBS-52-235-f4.gif
Fig. 5
Evaluation of molecular markers for genotype analysis of Glu-D1 locus. A-C. Molecular markers, UMN25 (A), Dx5-1 (B) and UMN26 (C), were examined after agarose gel electrophoresis. All of markers were applied with touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. D. Scatter plots for Glu-D1d_SNP. D. Red color indicates Glu1-Dx5 allele and blue color shows Glu1-nonDx5 allele of each varieties. All experiments were repeated three times independently.
KJBS-52-235-f5.gif
Table 1
Allelic information of HMW-GS at Glu-1 loci.
Table 1
Locus name Locus allele Gene allele (x-type + y-type) SDS-PAGE allele
Glu-A1 Glu-A1a Glu1-Ax1 1
Glu-A1b Glu1-Ax2* 2*
Glu-A1c Glu1-AxNull Null
Glu-B1 Glu-B1a Glu1-Bx7 7
Glu-B1b Glu1-Bx7 + Glu1-By8 7+8
Glu-B1c Glu1-Bx7 + Glu1-By9 7+9
Glu-B1d Glu1-Bx6 + Glu1-By8 6+8
Glu-B1f Glu1-Bx13 + Glu1-By16 13+16
Glu-B1i Glu1-Bx17 + Glu1-By18 17+18
Glu-B1al Glu1-Bx7OE + Glu1-By8 7OE+8
Glu-D1 Glu-D1a Glu1-Dx2 + Glu1-Dy12 2+12
Glu-D1c Glu1-Dx4 + Glu1-Dy12 4+12
Glu-D1d Glu1-Dx5 + Glu1-Dy10 5+10
Glu-D1f Glu1-Dx2.2 + Glu1-Dy12 2.2+12
Table 2
Primer information of high-molecular-weight glutenin subunits used in the study.
Table 2
Locus Gene type Primer name Marker type Target Allele PCR size (bp) Forward primer sequence (5'-3') Referencesz

Reverse primer sequence (5'-3')
Glu-A1 x-type UMN19 Co-dominant 2* 344 CGAGACAATATGAGCAGCAAG Liu et al. (2008)
non-2* 362 CTGCCATGGAGAAGTTGGA
Glu-Ax2* Dominant 2* 1200 ATGACTAAGCGGTTGGTTCTT Ma et al. (2003)
non-2* No band ACCTTGCTCCCCTTGTCTTT

Glu-B1 x-type Bx-17 Co-dominant Bx17 669 CGCAACAGCCAGGACAATT Ma et al. (2003)
nonBx17 630,766 AGAGTTCTATCACTGCCTGGT
cauBx642 Co-dominant Bx17 534 GGGCAATCGGGGTACTTCC Xu et al. (2008)
nonBx17 642 CCCTTGTCTTGGCTGTTGTC
Bx-7OE left Dominant Bx7oe 447 ACGTGTCCAAGCTTTGGTTC Ragupathy et al. (2008)
non-Bx7oe (x) GATTGGTGGGTGGATACAGG
Bx-7OE right Dominant Bx7oe 844 CCACTTCCAAGGTGGGACTA Ragupathy et al. (2008)
non-Bx7oe No band TGCCAACACAAAAGAAGCTG
y-type ZSBy8 Dominant By8 527 TTAGCGCTAAGTGCCGTCT Liu et al. (2008)
nonBy8 (x) TTGTCCTATTTGCTGCCCTT
ZSBy9a Co-dominant By9 662 TTCTCTGCATCAGTCAGGA Liu et al. (2008)
nonBy9 707 AGAGAAGCTGTGTAATGCC

Glu-D1 x-type UMN25 Co-dominant Dx2 299 GGGACAATACGAGCAGCAAA Liu et al. (2008)
Dx5 281 CTTGTTCCGGTTGTTGCCA
Dx-5-1 Dominant Dx5 478 CGTCCCTATAAAAGCCTAGC Liu et al. (2008)
non-Dx5 No band AGTATGAAACCTGCTGCGGAC
Dx-5-2 Dominant Dx5 450 GCCTAGCAACCTTCACAATC Liu et al. (2008)
non-Dx5 No band GAAACCTGCTGCGGACAAG
y-type UMN26 Co-dominant Dy10 397 CGCAAGACAATATGAGCAAACT Liu et al. (2008)
Dy12 415 TTGCCTTTGTCCTGTGTGC
Dy-10 Co-dominant Dy10 576 GTTGGCCGGTCGGCTGCCATG Ahmad (2000)
Dy12 612 TGGAGAAGTTGGATAGTACC

zEach primer information was obtained from published articles.

Table 3
Kompetitive allele-specific PCR (KASP) assay information used in the studyz.
Table 3
Locus Primer Name Target Allele SNP Primer sequence (5'-3')
Glu-A1 Glu-Ax1/2*_SNP Ax1, Ax2* G FAM AAGTGTAACTTCTCCGCAACG
Ax-null A HEX ACCTAAGTGTAACTTCTCCGCAACA
Common CGAAGAAGCTTGGCCTGGATAGTAT
Glu-Ax2*_IND Ax1, Ax-null Indel FAM ATTCTTGTTGTCCTTGTCCTGGCT
Ax2* HEX CTTGTTGTCCTTGTCCTGGCC
Common GGTTTCATACTATCCAGGCCAAGCTT

Glu-B1 BX7OE_866_SNP Bx7OE C FAM GTGGAATATTAGTGATGGCGTGAC
non-Bx7OE G HEX GTGGAATATTAGTGATGGCGTGAG
Common TTCTTCTCTCGTTGGCCTTATCGC
Bx13_SNP non-Bx13 - FAM CAACGACCGGGACAAGGGCAAC
Bx13 - HEX CAACGACCGGGACAAGGGCAAT
Common CTGTGGAGAGGTTGGGTAGTACCC

Glu-D1 Glu-D1d_SNP non-Dx5 C FAM ATAGTATGAAACCTGCTGCGGAG
Dx5 G HEX ATAGTATGAAACCTGCTGCGGAC
Common TACTAAAAAGGTATTACCCAAGTGTAACTT
Table 4
High-molecular-weight glutenin subunit of varieties used in the study.
Table 4
Cultivar Glu-A1 Locus Glu-B1 Locus Glu-D1 Locus



Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker
Petrel null null null 7 7 - 5+10 5+10 5+10
Brimstone null null null 6+8 6+8 6+8 2+12 2+12 -
Junggye5336 null null null 7+8 7+8 7+8 2.2+12 2.2+12 -
Chukoku122 null null null 7+9 7+9 7+9 2.2+12 2.2+12 -
Jopoom null null null 13+16 13+16 - 2.2+12 2.2+12 -
Joongmo2008 null null null 17+18 17+18 17+18 5+10 5+10 5+10
Jokyoung 1 1 1 7+8 7+8 7+8 5+10 5+10 5+10
Cajeme 1 1 1 17+18 17+18 17+18 5+10 5+10 5+10
Kenya-5 1 1 1 13+16 13+16 - 5+10 5+10 5+10
Joongmo2012 2* 2* 2* 7+8 7+8 7+8 5+10 5+10 5+10
Norin 61 2* 2* 2* 7+8 7+8 7+8 2.2+12 2.2+12 -
Sukwang 2* 2* 2* 13+16 13+16 - 2.2+12 2.2+12 -
Younbaek 2* 2* 2* 13+16 13+16 - 2.2+12 2.2+12 -
Bl1102 2* 2* 2* 17+18 17+18 17+18 5+10 5+10 5+10
  • 1. Ahmad M. 2002. Molecular marker-assisted selection of HMW glutenin alleles related to wheat bread quality by PCR-generated DNA markers. Theor Appl Genet 101: 892-896.
  • 2. Allen AM, Barker GL, Wilkinson P, Burridge A, Winfield M, Coghill J, Uauy C, Griffiths S, Jack P, Berry S. 2013. Discovery and development of exome-based, co-dominant single nucleotide polymorphism markers in hexaploid wheat (Triticum aestivum L.). Plant Biotechnol J 11: 279-295.
  • 3. Anderson O, Greene F. 1989. The characterization and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor Appl Genet 77: 689-700.
  • 4. Anjum FM, Khan MR, Din A, Saeed M, Pasha I, Arshad MU. 2007. Wheat gluten: high molecular weight glutenin subunits--structure, genetics, and relation to dough elasticity. J Food Sci 72: R56-63.
  • 5. Ayalew H, Tsang PW, Chu C, Wang J, Liu S, Chen C, Ma XF. 2019. Comparison of TaqMan, KASP and rhAmp SNP genotyping platforms in hexaploid wheat. PloS one 14: e0217222
  • 6. Choi CH, Park JH, Mo Y, Kim KM, Kim KH, Kang CS, Park TI, Cho SW, Park CS. 2020. Effect of heterozygous genotypes at the Pinb-D1 loci on physicochemical properties of flour and end-use quality. Korean J Breed Sci 52: 131-139.
  • 7. De Bustos A, Rubio P, Jouve N. 2000. Molecular characterisation of the inactive allele of the gene Glu-A1 and the development of a set of AS-PCR markers for HMW glutenins of wheat. Theor Appl Genet 100: 1085-1094.
  • 8. Gao S, Sun G, Liu W, Sun D, Peng Y, Ren X. 2020. High-molecular-weight glutenin subunit compositions in current Chinese commercial wheat cultivars and the implication on Chinese wheat breeding for quality. Cereal Chem 97: 762-771.
  • 9. Geisslitz S, America AH, Scherf KA. 2020. Mass spectrometry of in-gel digests reveals differences in amino acid sequences of high-molecular-weight glutenin subunits in spelt and emmer compared to common wheat. Anal Bioanal Chem 412: 1277-1289.
  • 10. Gilbert SM, Wellner N, Belton PS, Greenfield JA, Siligardi G, Shewry PR, Tatham AS. 2000. Expression and characterisation of a highly repetitive peptide derived from a wheat seed storage protein. Biochim Biophys Acta 1479: 135-146.
  • 11. Jang YR, Beom HR, Altenbach SB, Lee MK, Lim SH, Lee JY. 2017. Improved method for reliable HMW-GS identification by RP-HPLC and SDS-PAGE in common wheat cultivars. Molecules 22: 1055
  • 12. Kang J, Lee S, Lee J, Kwon Y, Lee S, Kabange N, Shin D, Cha J, Park D, Ko J. 2020. Development and validation of KASP markers for Stv-bi, a rice stripe virus resistance gene in rice (Oryza sativa L.). Plant Breed Biotech 8: 196-201.
  • 13. Lei Z, Gale K, He Z, Gianibelli C, Larroque O, Xia X, Butow B, Ma W. 2006. Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat. J Cereal Sci 43: 94-101.
  • 14. Liu S, Chao S, Anderson JA. 2008. New DNA markers for high molecular weight glutenin subunits in wheat. Theor Appl Genet 118: 177-183.
  • 15. Ma W, Zhang W, Gale K. 2003. Multiplex-PCR typing of high molecular weight glutenin alleles in wheat. Euphytica 134: 51-60.
  • 16. Mondal S, Tilley M, Alviola JN, Waniska RD, Bean SR, Glover KD, Hays DB. 2008. Use of near-isogenic wheat lines to determine the glutenin composition and functionality requirements for flour tortillas. J Agr Food Chem 56: 179-184.
  • 17. Murray M, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8: 4321-4326.
  • 18. Ortolan F, Steel CJ. 2017. Protein characteristics that affect the quality of vital wheat gluten to be used in baking: A review. Compr Rev Food Sci F 16: 369-81.
  • 19. Payne PI, Lawrence GJ. 1983. Catalogue of alleles for the complex gene loci, Glu-A1, Glu-B1, and Glu-D1 which code for high-molecular-weight subunits of glutenin in hexaploid wheat. Cereal Res Commun 11: 29-35.
  • 20. Peng Y, Yu K, Zhang Y, Islam S, Sun D, Ma W. 2015. Two novel y-type high molecular weight glutenin genes in Chinese wheat landraces of the yangtze-river region. PloS One 10: e0142348
  • 21. Ragupathy R, Naeem HA, Reimer E, Lukow OM, Sapirstein HD, Cloutier S. 2008. Evolutionary origin of the segmental duplication encompassing the wheat GLU-B1 locus encoding the overexpressed Bx7 (Bx7OE) high molecular weight glutenin subunit. Theor Appl Genet 116: 283-296.
  • 22. Rai R, Singh S, Das BK, Bhagwat SG. 2018. Application of allele-specific (AS-PCR) marker for identification of high-molecular-weight glutenin subunits (HMW-GS) at the GluB-1 locus in bread wheat (Triticum aestivum L.). Adv Crop Sci Tech 6: 387.
  • 23. Rasheed A, Wen W, Gao F, Zhai S, Jin H, Liu J, Guo Q, Zhang Y, Dreisigacker S, Xia X, He Z. 2016. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor Appl Genet 129: 1843-1860.
  • 24. Ravel C, Faye A, Ben-Sadoun S, Ranoux M, Dardevet M, Dupuits C, Exbrayat F, Poncet C, Sourdille P, Branlard G. 2020. SNP markers for early identification of high molecular weight glutenin subunits (HMW-GSs) in bread wheat. Theor Appl Genet 133: 751-770.
  • 25. Roy N, Islam S, Ma J, Lu M, Torok K, Tomoskozi S, Bekes F, Lafiandra D, Appels R, Ma W. 2018. Expressed Ay HMW glutenin subunit in Australian wheat cultivars indicates a positive effect on wheat quality. J Cereal Sci 79: 494-500.
  • 26. Shewry PR, Hey SJ. 2015. The contribution of wheat to human diet and health. Food Energy Secur 4: 178-202.
  • 27. Singh NK, Shepherd KW, Cornish GB. 1991. A simplified SDS-PAGE procedure for separating LMW subunits of glutenin. J Cereal Sci 14: 203-208.
  • 28. Tan CT, Yu H, Yang Y, Xu X, Chen M, Rudd JC, Xue Q, Ibrahim AM, Garza L, Wang S. 2017. Development and validation of KASP markers for the greenbug resistance gene Gb7 and the Hessian fly resistance gene H32 in wheat. Theor Appl Genet 130: 1867-1884.
  • 29. Xu Q, Xu J, Liu CL, Chang C, Wang CP, You MS, Li BY, Liu GT. 2008. PCR-based markers for identification of HMW-GS at Glu-B1x loci in common wheat. J Cereal Sci 47: 394-398.
  • 30. Yasmeen F, Khurshid H, Ghafoor A. 2015. Genetic divergence for high-molecular weight glutenin subunits (HMW-GS) in indigenous landraces and commercial cultivars of bread wheat of Pakistan. Genet Mol Res 14: 4829-4839.
  • 31. Yuan Z, Liu M, Ouyang Y, Zeng X, Hao M, Zhang L, Ning S, Yan Z, Liu D. 2014. The detection of a de novo allele of the Glu-1Dx gene in wheat-rye hybrid offspring. Theor Appl Genet 127: 2173-2182.
  • 32. Zhang P, Jondiko TO, Tilley M, Awika JM. 2014. Effect of high molecular weight glutenin subunit composition in common wheat on dough properties and steamed bread quality. J Sci Food Agr 94: 2801-2806.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat
Korean. J. Breed. Sci.. 2020;52(3):235-243.   Published online September 1, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat
Korean. J. Breed. Sci.. 2020;52(3):235-243.   Published online September 1, 2020
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat
Image Image Image Image Image
Fig. 1 Analysis of high-molecular-weight glutenin subunit composition of standard varieties used in this study. A. HMW-GS was analyzed by SDS-PAGE with 3~8% Criterion XT tris-acetate protein gel. Each 10m of extracted protein from one seed loaded on the gel. Photograph was taken after coomassie brilliant blue staining and destaining. B. Analysis of HMW-GS by Lab-on-a-chip electrophoresis with Protein 230 kit using 2100 bioanalyzer. HMW-GS composition was analyzed according to its relative molecular weight.
Fig. 2 Evaluation of molecular markers for genotype analysis of Glu-A1 locus. A. Evaluation of molecular marker UMN19 for Glu1-Ax2*. PCR with UMN19 was performed by touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. B and C. Scatter plots for Glu-Ax1/2*_SNP and Glu-Ax2*_IND assay showing clustering of varieties on the X-(FAM) and Y-(HEX) axes. B. Red color indicates Glu1-Ax1 and Glu1-Ax2* allele and blue color shows Glu1-AxNull allele of each varieties. C. Red color indicates Glu1-Ax2* allele and blue color shows Glu1-Ax1 and Glu1-AxNull allele of each varieties. All experiments were repeated three times independently.
Fig. 3 Evaluation of molecular markers for genotype analysis of Glu-B1 locus. A-C. Molecular markers, cauBx642 (A), ZSBy8 (B), and ZSBy9a (C), were examined after agarose gel electrophoresis. All of markers were applied with touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. D and E. Scatter plots for Bx7OE_866_SNP and Bx13_SNP assay, respectively, showing clustering of varieties on the X-(FAM) and Y-(HEX) axes. D. Red color indicates Glu1-nonBx17OE allele and blue color shows Glu1-Bx17OE allele of each varieties. E. Red color indicates Glu1-Bx13 allele and blue color shows Glu1-nonBx13 allele of each varieties. All experiments were repeated three times independently.
Fig. 4 Quantity of each HMW-GS composition. HMW-GS protein was separated on Protein 230 chip with 2100 bioanalyzer and quantity of HMW-GS was calculate with 2100 expert program (Agilent Technologies, CA, USA). Each content was measured as relative content.
Fig. 5 Evaluation of molecular markers for genotype analysis of Glu-D1 locus. A-C. Molecular markers, UMN25 (A), Dx5-1 (B) and UMN26 (C), were examined after agarose gel electrophoresis. All of markers were applied with touch-down method from 65°C for 10 cycles and then followed more 30 PCR cycles at 55 °C for annealing. Gel photograph was taken after electrophoresis on 3% agarose gel for 1 hour. D. Scatter plots for Glu-D1d_SNP. D. Red color indicates Glu1-Dx5 allele and blue color shows Glu1-nonDx5 allele of each varieties. All experiments were repeated three times independently.
Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat

Allelic information of HMW-GS at Glu-1 loci.

Locus name Locus allele Gene allele (x-type + y-type) SDS-PAGE allele
Glu-A1 Glu-A1a Glu1-Ax1 1
Glu-A1b Glu1-Ax2* 2*
Glu-A1c Glu1-AxNull Null
Glu-B1 Glu-B1a Glu1-Bx7 7
Glu-B1b Glu1-Bx7 + Glu1-By8 7+8
Glu-B1c Glu1-Bx7 + Glu1-By9 7+9
Glu-B1d Glu1-Bx6 + Glu1-By8 6+8
Glu-B1f Glu1-Bx13 + Glu1-By16 13+16
Glu-B1i Glu1-Bx17 + Glu1-By18 17+18
Glu-B1al Glu1-Bx7OE + Glu1-By8 7OE+8
Glu-D1 Glu-D1a Glu1-Dx2 + Glu1-Dy12 2+12
Glu-D1c Glu1-Dx4 + Glu1-Dy12 4+12
Glu-D1d Glu1-Dx5 + Glu1-Dy10 5+10
Glu-D1f Glu1-Dx2.2 + Glu1-Dy12 2.2+12

Primer information of high-molecular-weight glutenin subunits used in the study.

Locus Gene type Primer name Marker type Target Allele PCR size (bp) Forward primer sequence (5'-3') Referencesz

Reverse primer sequence (5'-3')
Glu-A1 x-type UMN19 Co-dominant 2* 344 CGAGACAATATGAGCAGCAAG Liu et al. (2008)
non-2* 362 CTGCCATGGAGAAGTTGGA
Glu-Ax2* Dominant 2* 1200 ATGACTAAGCGGTTGGTTCTT Ma et al. (2003)
non-2* No band ACCTTGCTCCCCTTGTCTTT

Glu-B1 x-type Bx-17 Co-dominant Bx17 669 CGCAACAGCCAGGACAATT Ma et al. (2003)
nonBx17 630,766 AGAGTTCTATCACTGCCTGGT
cauBx642 Co-dominant Bx17 534 GGGCAATCGGGGTACTTCC Xu et al. (2008)
nonBx17 642 CCCTTGTCTTGGCTGTTGTC
Bx-7OE left Dominant Bx7oe 447 ACGTGTCCAAGCTTTGGTTC Ragupathy et al. (2008)
non-Bx7oe (x) GATTGGTGGGTGGATACAGG
Bx-7OE right Dominant Bx7oe 844 CCACTTCCAAGGTGGGACTA Ragupathy et al. (2008)
non-Bx7oe No band TGCCAACACAAAAGAAGCTG
y-type ZSBy8 Dominant By8 527 TTAGCGCTAAGTGCCGTCT Liu et al. (2008)
nonBy8 (x) TTGTCCTATTTGCTGCCCTT
ZSBy9a Co-dominant By9 662 TTCTCTGCATCAGTCAGGA Liu et al. (2008)
nonBy9 707 AGAGAAGCTGTGTAATGCC

Glu-D1 x-type UMN25 Co-dominant Dx2 299 GGGACAATACGAGCAGCAAA Liu et al. (2008)
Dx5 281 CTTGTTCCGGTTGTTGCCA
Dx-5-1 Dominant Dx5 478 CGTCCCTATAAAAGCCTAGC Liu et al. (2008)
non-Dx5 No band AGTATGAAACCTGCTGCGGAC
Dx-5-2 Dominant Dx5 450 GCCTAGCAACCTTCACAATC Liu et al. (2008)
non-Dx5 No band GAAACCTGCTGCGGACAAG
y-type UMN26 Co-dominant Dy10 397 CGCAAGACAATATGAGCAAACT Liu et al. (2008)
Dy12 415 TTGCCTTTGTCCTGTGTGC
Dy-10 Co-dominant Dy10 576 GTTGGCCGGTCGGCTGCCATG Ahmad (2000)
Dy12 612 TGGAGAAGTTGGATAGTACC

Kompetitive allele-specific PCR (KASP) assay information used in the studyz.

Locus Primer Name Target Allele SNP Primer sequence (5'-3')
Glu-A1 Glu-Ax1/2*_SNP Ax1, Ax2* G FAM AAGTGTAACTTCTCCGCAACG
Ax-null A HEX ACCTAAGTGTAACTTCTCCGCAACA
Common CGAAGAAGCTTGGCCTGGATAGTAT
Glu-Ax2*_IND Ax1, Ax-null Indel FAM ATTCTTGTTGTCCTTGTCCTGGCT
Ax2* HEX CTTGTTGTCCTTGTCCTGGCC
Common GGTTTCATACTATCCAGGCCAAGCTT

Glu-B1 BX7OE_866_SNP Bx7OE C FAM GTGGAATATTAGTGATGGCGTGAC
non-Bx7OE G HEX GTGGAATATTAGTGATGGCGTGAG
Common TTCTTCTCTCGTTGGCCTTATCGC
Bx13_SNP non-Bx13 - FAM CAACGACCGGGACAAGGGCAAC
Bx13 - HEX CAACGACCGGGACAAGGGCAAT
Common CTGTGGAGAGGTTGGGTAGTACCC

Glu-D1 Glu-D1d_SNP non-Dx5 C FAM ATAGTATGAAACCTGCTGCGGAG
Dx5 G HEX ATAGTATGAAACCTGCTGCGGAC
Common TACTAAAAAGGTATTACCCAAGTGTAACTT

High-molecular-weight glutenin subunit of varieties used in the study.

Cultivar Glu-A1 Locus Glu-B1 Locus Glu-D1 Locus



Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker Reported SDS-PAGE DNA Marker
Petrel null null null 7 7 - 5+10 5+10 5+10
Brimstone null null null 6+8 6+8 6+8 2+12 2+12 -
Junggye5336 null null null 7+8 7+8 7+8 2.2+12 2.2+12 -
Chukoku122 null null null 7+9 7+9 7+9 2.2+12 2.2+12 -
Jopoom null null null 13+16 13+16 - 2.2+12 2.2+12 -
Joongmo2008 null null null 17+18 17+18 17+18 5+10 5+10 5+10
Jokyoung 1 1 1 7+8 7+8 7+8 5+10 5+10 5+10
Cajeme 1 1 1 17+18 17+18 17+18 5+10 5+10 5+10
Kenya-5 1 1 1 13+16 13+16 - 5+10 5+10 5+10
Joongmo2012 2* 2* 2* 7+8 7+8 7+8 5+10 5+10 5+10
Norin 61 2* 2* 2* 7+8 7+8 7+8 2.2+12 2.2+12 -
Sukwang 2* 2* 2* 13+16 13+16 - 2.2+12 2.2+12 -
Younbaek 2* 2* 2* 13+16 13+16 - 2.2+12 2.2+12 -
Bl1102 2* 2* 2* 17+18 17+18 17+18 5+10 5+10 5+10
Table 1 Allelic information of HMW-GS at Glu-1 loci.
Table 2 Primer information of high-molecular-weight glutenin subunits used in the study.

Each primer information was obtained from published articles.

Table 3 Kompetitive allele-specific PCR (KASP) assay information used in the studyz.

All primer information was obtained from Rasheed et al. (2016).

Table 4 High-molecular-weight glutenin subunit of varieties used in the study.