Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

사과 저장성 연관 , , 분자표지의 활용성 평가

권영순, 권순일*, 김정희, 박무용, 박종택, 김선애

Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples

Korean Journal of Breeding Science 2020;52(4):322-331.
Published online: December 1, 2020

국립원예특작과학원 사과연구소

Apple Research Institute, National Institute of Horticultural and Herbal Science, RDA, Gunwi 39000, Republic of Korea

*Corresponding Author (E-mail: topapple@korea.kr, Tel: +82-54-380-3130, Fax: +82-54-380-3109)
• Received: August 6, 2020   • Revised: August 14, 2020   • Accepted: October 4, 2020

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 279 Views
  • 1 Download
  • 2 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Changes in Cell Wall Sugar Neutral Composition Contribute to Apple Texture Loss during Storage among Cultivars
    Hui Liu, Shiyu Lin, Mengyuan Zhang, Yanrong Lv, Yanping Ma, Jingping Rao, Qinggang Zhu
    Horticulturae.2023; 9(3): 292.     CrossRef
  • Identification of apple genes Md-Exp7 and Md-PG1 alleles in advanced selections resistant to scab
    I. I. Suprun, S. V. Tokmakov, E. A. Al-Nakib, E. V. Lobodina
    Vavilov Journal of Genetics and Breeding.2022; 26(7): 645.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples
Korean. J. Breed. Sci.. 2020;52(4):322-331.   Published online December 1, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples
Korean. J. Breed. Sci.. 2020;52(4):322-331.   Published online December 1, 2020
Close

Figure

  • 0
Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples
Image
Fig. 1 Difference in fresh and storage fruit firmness according to harvest season and Md-ACS1 (A), Md-ACO1 (B), Md-PG1 (C) genotype in 108 samples. Same small letters are not significantly different at the 5% level by Duncan’s multiple range test.
Validation Assay of Md-ACS1, Md-ACO1, and Md-PG1 Molecular Markers Associated with Storability in Apples

Primer sequences used for amplifying Md-ACS1, Md-ACO1, and Md-PG1 genes.

Primers Sequence (5'→3') Amplicon size
(bp)
Annealing Temp.
(℃)
Reference
Md-ACS1 ACS1-F
ACS1-R
CTCCTCCTTTCCTTCGTTGA
ACCATGTCGTCGTTGGAGTAG
2 : 655, 1 : 489 58 Sunako et al. (1999)
Md-ACO1 ACO1-F
ACO1-R
ATCAATGATGCTTGTGAGAACTG
GGTCTTCTTGTAGTGATCCTTGG
2 : 587, 1 : 525 65 Costa et al. (2005)
Md-PG1SSR10kd PG1-F
PG1-R
TTTCTTCCTTGGGTTTTTGG
ACTCGTGCGCCAGATAGC
3 : 298, 2 : 291, 1 : 288 56 Longhi et al. (2013)

Md-ACS1, Md-ACO1, and Md-PG1 genotype of 750 apple germplasm preserved in Apple Research Institute (Gunwi), NIHHS, RDA.

Genotypez Cultivar or collection namey

ACS1 ACO1 PG1
1/1 1/1 1/1 Almey, Annurca, Dorothea, Gorgeous, Roberts Crab, SI-22-40
1/1 1/1 1/3 67PRI 1279-9 (27-55)
1/1 1/1 2/2 Adam’s Crab, Ashiro 3, Indian Summer Crab, Malus koreara, Malus sikkimensis Koehn, Red Jade, Robinson Crab
1/1 1/1 3/3 Akita Tare, Oswego, Snowdrift, Suislepper
1/1 1/2 1/1 Aegisagwa, Akita Maruba Tachi, Crimson King, Eley Purple Crab, FO73.11D.3, Hopa Crab A, Hopa Crab B, Malus prunifolia Fastigiata, Malus prunifolia var. macrocar, Malus robusta Baily, Malus robusta var. eleta 88075, Malus sylvestris Plena, Megumi x Jonathan, Morioka 55, Noret, Pink Beauty, Profusion, Purple Wave, Robusta 5, Tartan, Tohoku #4, Wakapingguo, Winter Gold Crab
1/1 1/2 1/3 Blaxstayman, Butter Ball, Collet, Columbia, Cowichan, De Jaune, Derman Winesap (4X), DIR68T492, Eosocheonwon, Hoehwa, Isawevis, Jonagram, M. gloriosa, Noiphing, Parker’s Pippin, Salute, Schoner aus Itzstedt, Tawria, Terry, Trusevitch Ⅰ-48-41, Verginia Crab K6, Wellington, White Pippin, Youyi
1/1 1/2 2/2 Adams’s Pearmain, Crimson Glory, Malus sargentii Rosea, Midget crab, Nagasaki Zumi, Pink Perfection, Prinicia, Sentinel Crab, St. Edmund’s Russet
1/1 1/2 2/3 Chulanka, Collins June, Court Pendu, Court Pendude France, CourtPenduPlat, Crawley Beauty, Dab325, Humboldt, Landsberger Reinette, M.platycarpa IRA 38-1, Malabols, Malus prunifolia DE 229, Max Trio, Reinette Clochard, Reinette du Canada, Shandongpingguo, Trial Ornamental, Urawa Tare, Whitney, Yeikan
1/1 1/2 3/3 Baxter, Chehalis, Early Joe, Early Strawberry, Malus columnaris, Malus Darth Mounta, Noiprim, Nova Easygro, Red June, Reid’s Seedling, Summer Champion, Whitney Crab
1/1 2/2 1/1 Anhaeng Tare, Arnold Crab, Atlas (UZ-84), Belle Fleur Large Mouche, Bessemyanka Michurina, Charlamoff, Demir, Doch Diany, Foxwhelp, Harcourt, Hatsubenishibori, Kemp, Keuleman, Malus laurifolia, Malus prunifolia Sikora, Malus pumila Royalty, Malus turesii, Merton Beauty, Nishtani Jonathan, Novosibirski Sweet, Paides Ziemas Abols, Roter Eiserapfel, Royale d’Angleterre, Samar Candskoe rannee, Scheidecker Crab, Stark Earliest, Succary, Virginiagold, Yeondaejohongha
1/1 2/2 1/2 Drap D’or Guemene, Primus
1/1 2/2 1/3 Alton, Ananas Rouge, Antonovka Karmen, Aromatic Russet, Arthur Turner, Battleford, Beatrix, Bellefleur Record, Beninomai, Blenheim Orange, Blenheim Pippin, BrabantBellefleur, Caravel (=Portia), Crow Egg, De Flanders, Democrat, Dubbele Zoete Aagt, Egremont, Frostproof, Greeveston Fanny, Gros Bois, Gros Frequin, Guldborg, Hibernal, Hwado, Lady (Lady Apple, Api), Lixiang, Macfree, Nubeena, Olga Crab, Orleans Reinette, P.18, Pederstrup, Pingguo, Pink Wood, Poeltsamaa Winter Apple, Pomme Royale, Prince Nicolas, Prinzen Apfel, Purpurroter Cousinot, Quastresse, R12740, Severny Sinap K-21, 39, Spasovka Kvasna, Spy 227, Summer Rose, Sylvia, Trent, Uralian Butter, Van Eseltine, York Imperial, Young America, Youyiaben, Zaohwang, Zhongqiu
1/1 2/2 2/2 Antonovka, Antonovka Shafran, Belle Fille, Budagovsky 57-491, Hillieri, Michelin, Spur Lodi, Stark Primo, Xinshuai
1/1 2/2 2/3 Altaiski Sweet, Bongli, Carmine Crab 81108 HT, Cestra Belferkitaika, Crimson Superb, Earl, Flontish, Gross Bohn, Gwendolyn, Huidobro, HunterOttawa244 4×, Ikorrocavka Alaja, James Grieve (Red Rosamund Strain), Kuoteshaho, Lalla Red Delicious (T1-27-77), Lemoine Purple Crab, Local 6 (907579), M. robusta Joan, M. soulardii, Major, Malus jacki, Malus zumi, Menkoi Hime, Mislimka, Muscadet de Dieppe, NO pip, Norfolk Royal, Norhey, Northwood, Ogden, PK-14, PRI 77-1, Reinerre d’espagne, Repinvaldo de Liebana, Roda Mantet, Rozovoye Priewoskhodnoye, Sensacion, Steacy, Yukari
1/1 2/2 3/3 A 2, Alpha 68, Alpha 68A, Anisim, Anoka, Appa No. 3, Arkansas Black, Aromat de vara, Athabasca, Beautiful Arcade, BernerRosen, Beverly Hills, Bolero, Britemac, Carroll, CG 10, Chouyou, Chunhyang, Cortland, Court Royal, Crollon, Dayton, Derman McIntosh (4X), Desertnoe Petrove, Doux Normandie, Doux-AMR, E559-13, Earliblaze, Early Golden, Field Spy, Flaym, FlowerofKent, Frequin, Geneva Early, Gingergold, Gloria Mundi, Grenadier, Hall Keeper, Improved McIntosh, Ingol, Jabchenab, Jadernicka, Jajang, Jamba, Kestrel, King of Tompkins 2, Kitanosachi, Klarapfel, Laxton’s Superb, Liestnaya Antonoffku #1836-A, Local 2 (907575), Local 4 (907577), Local 5 (907578), Loyda, M.1, M.3, M.5, M.7 EMLA, Malus pumila Apetala, Manitoba Spy, Marin Onfroy, Marshall McIntosh, Maypole, McIntosh Spur, McIntosh Summerland Red, Merton 793, Merton Ace, Merton Worcester, Milton, MM.102, MM.103, MM.104, MM.115, Nico, Northern Spy, Obilnoye, Ottawa 1, Ottawa 3, Ottawa 8, P.13, P.14, Pajam 1, Papirovkapolska, Parkland, Patricia, PRI 333-9, Primate, Prime Golden, Puritan, Red Apple, Red Canel, Red Dijmanszoet, Redfree, Reinette de Champagne, Reinette De Cuzy, Reinette van Ekenstein, Rosemary Russet, Rossoshanskoje Polosatoje, Schoharie Spy, Shaphran Letnij, Shenandoah, Shuihongsepingguo, Sops of wine, Spencer Seedlss, Spur Red Delicious, Spur Starking, Stayma Keel, Stearns, Sterappel, Striped Tawny, Suislepas Rozabols, Susvorenskoye #4, Szapanska, Thurgauer Weinapfel, Tohoku #2, Tuscan, Vandevere B-26-4, Wabskaw, Wayne, Wellington Bloomless, Williams Favourite, Yellow Bellflower, Yellow Siberian
1/2 1/1 1/1 Fukutami, Jeongseonmaeju, Schlect Spur Red Delicious, Zhigulevskoe
1/2 1/1 1/2 Early Stripe Spur
1/2 1/1 1/3 Ben Spur, Bisbee Spur, Brigham Delicious, Chellan Red, Red Delicious, Delicious, Derman Delicious (4X), Double Red Delicious, Fruitland Delicious, Imperial Red Delicious, Jonadee, Kinrei, Miller Sturdy Spur, Shiro, Short Well, Sky Spur, Stahls Prinz, Starkspur Delicious, Strip Bisbee, Wayne Spur Delicious
1/2 1/1 3/3 Mu-Jon, Nero Rome, Ryan, White Winter, White Winter Pearmain, Wickson
1/2 1/2 1/1 Akane, Bel Golden, Boller McIntosh, Chestnut Crab, Eikou, Ellison Orange, Kiou, Michinoku, Nero-26, Prairie Spy, Royal Jonathan, Staymared, Stembridge Cluster, Sundale Sturdee Spur, Tsugaru-Sayaka, Wealthy Double Red Delicious
1/2 1/2 1/2 Stark Florence
1/2 1/2 1/3 Alps Otome, Antonovka Zheltaia, Arlet, Bhrens, Bramley’s Seedling, Captain Kidd, Conrad, Cut, Delistein, Eurika, Great Ralls, Hillwell Red Braeburn, Hunter Sandow 2-4-4, Idared-1, Idared-2, Ivette, Moira, Newfane, Oilase, Priscilla, Red Cinnamon, Subtropical Apple, Sun Gold, Sweet Delicious, Tilsith, Trusevitch V-5-38, Turley Winesap, Yantaishaguo
1/2 1/2 2/2 Early Banta, Hwangtaepyeong, Inducoa No.1, Longguan, Minisker von Hammerstein, Yellow Newtown, Yesansamyeob
1/2 1/2 2/3 Berlepsch Red, Chinatsu, Giant Janet, Improved Lambrook Pippin, Kile, Korei, Lord Wolsley, Loyalist, Northern Lights, Rozovoe, Sheisyun, Shizuka, Swiss Gourmet
1/2 1/2 3/3 Amelia, Empire, Franklin, Jersey Spur, King Edward Ⅶ, Malus coronaria Wynema, Mantuanskoye, NFT 1, Orin, Pitsmaston Pineapple x 692, Red Fortune, Sudeten Reinette, Sunlight, Tropical Beauty, Webster, York-A-Red
1/2 2/2 1/1 Aroma, Baumann’s Reinette, Beauty Tsugaru, Bedford Pippin, Bercon, Blue Pearmain, Carola, De Roche st lawrence, De Roche st. Lawrence, Early Red Rich, Emneth Earlry, Florina, Frian Dise, Kem Tsugaru, Natsuka Tsugaru, Pink Lady, Spur Earliblaze, St. Cecilia, Sturmer Pippin, Tsugaru, Tsugaru-Hime, William s Pride, Yamamo Tsugaru
1/2 2/2 1/3 Alfa, Amere, Amere de Berthecourt (True), Aori No.1, Bedfordshir Foundling, Berthecourt, Beverly Crab, Bulmer Norman, Burgundy, Cherry cox, Chuxiao, Coast Apple, Cox’s Orange Pippin, Cox’s Orange pippin Self-fortile clone4, Delago, Devonshire Quarreden, DL-11-12, Dutch Mignonne, Eickhoff, Eikan, Empress, Fallwater, Fantazja, Fuhong, Geneva Black, Gladstone, Golden Grecoce, Gravenstein, Greenball, Hausmar, Jonagored, Jonica, Karmijn, Local 10 (907583), Local 11 (907584), Lombart’s Calville, Longfield, Malus rockii, McIntosh, Nepal, Nugget Spur, NY 674, Potomac, Potter, Red Melba, Shinkou, Tsugaru-Hayate, Zuccalmaglio
1/2 2/2 2/2 Hongso, Lady Williams, Martini VH/430, Merton Pearmain, Spuree Rome, Stembridge Jersey, Vandevere
1/2 2/2 2/3 Blairmont, Blushing Gold, Chautauqua, Doud Golden Delicious (4X), Doyle, Early Harvest, Gold Spur, Golden Delicious, Malus mandshurica 2330, Mutsu, Odin, Peck’s Pleasant, Pepin Shafrannyi, Pigeonnet, Regent, Reinette Grise, Rugenthaons, Smoothee Golden, Smordodina, Spigold, Spur Golden Delicious, Summer Dream, Sunrise, Tale Sweet, Telamon, Wolf River, Yellow Delicious
1/2 2/2 3/3 Aizaohui, Alkmene, Anna, Aurora, Baldwin, Bancroft, Beforest, Brusnichoe, Calville Blanc, Charlotte, Chesapeak Apple, Chicheng, Clarke, Crandall, Diana, Esopus Spitzenburg, Fillbarrel, Gallia Beauty, Glockenapfel, Goro, Granny Smith, Greensleeves, Heyer #12, Hongsim, Indo, Ingram, Jonagold,Rubinstar, Lord Lambourne, M255-0010, Mahe-7, Manshu, Michaelmas Red, Mollie’s Delicious, Monmouth Beauty, Morden 359, Mother, Muscadet de Lense, OBIR2T47, Ontario, Oregon Spur, Oriole, Ortley, Ottawa, Oyusanjeong, Piervomaiskoie, Pink Pearl, Pixie, Pomme Cloche, PRI 2050-2, Priam, Radoux, Ranger, Red Astrachan, Red coy’s Pomona, Redstreak, Rhode Island Greening, SA54-43, Sampion, Scarlet Sentinel M.11 apple, Shin Indo, Sir Prize, Smokehouse, Spencer, Stafford, Stoke Red, Summerred, Sunburn, Sweet Alford, Sweet Coppin, Sweet McIntosh, Tallmans Sweet, Tumanga, VIP, Winesap, Winter Banana, Yuggyehaedang, Zaohui, Zigeunerinapfel, Zuboff
2/2 1/1 1/1 Chubu, E36-7, Fuji, Fuji-Benishogun, Fuji-Champion, Fuji-Hangawi, Fuji-Jubilee, Fuji-KIKU 8, Fuji-Myra Red, Fuji-Nagafu 12, Fuji-Nagafu 2, Fuji-Nagafu 6, Narita Fuji, Fuji-Rakuraku, Yamadani 2gei Fuji, Fuji-Akifu-1, Fuji-Royal, Fuji-Royal 21, Iwakami, Mimaki Spur, Spur Fuji, Standel, Sun Fuji, Wangsil, Yataka
2/2 1/1 2/2 Marie-Joseph d’Othee, Nyeongpung
2/2 1/2 1/1 Aori No.15, Dulcet (Bailey), Geumwangja, Holly, Honggeum, Hwangok, Idajon, Kagayaki, Nyeongsu, Pilot, Splendor
2/2 1/2 1/3 Annie Elizabeth, Dunkerton Late, Hwamugold, Kinsei, Picnic, Sandel
2/2 1/2 2/2 Hongan, Malus fusca F2, Miki Life, Mitsuyoshi, Shenshu
2/2 1/2 2/3 Gala-Regal, Gala-Scarlet, Sahmiga (G), Sosogwa, Topaz
2/2 1/2 3/3 4814018, C. R. Fireside, Gala, Galaxy Gala, Gloster 69, Lakeland, Orei, Seohong, Shengli, Vystavochnoye, Yume Oirase, Yunqing, Gamhong
2/2 2/2 1/1 Akagi, Alome Mills, Liaofu, Opalescent, Shinano Gold, Undine
2/2 2/2 1/3 Bonnoe, Charles Ross, Discovery, Ingrid Marie, Reverend. W. Wilks, Spartan, State Fair, Vanda
2/2 2/2 2/3 Kandil Sinap, Lustre Elstar, Northwest Greening, Rumut
2/2 2/2 3/3 Belle de Jardins, Delbarestivale, Jewel, Meran, Resista, Willow Twig

Fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage and difference between firmness at harvest and firmness after storage in 108 samples.

Cultivar or collection Harvest date Firmness (N) Cultivar or collection Harvest date Firmness (N)


Fresh fruit Storage fruit Difference Fresh fruit Storage fruit Difference
4814018 10-Sep 72.4 51.4 21.0 Iwakami 21-Aug 67.7 46.3 21.4
Akane 10-Aug 45.4 41.0 4.4 Jadernicka 20-Aug 77.2 0.0 77.2
Amere 22-Aug 77.4 0.0 77.4 Kinrei 3-Sep 72.4 44.3 28.1
Anna 14-Aug 32.1 0.0 32.1 Kio 14-Aug 66.7 47.8 18.9
Annurca 6-Nov 98.6 72.4 26.1 Korei 1-Oct 60.0 39.5 20.5
Antonovka shafran 9-Aug 50.2 27.1 23.2 McIntosh 30-Aug 76.7 35.5 41.3
Arkansas black 29-Oct 106.6 81.3 25.3 Michelin 30-Aug 71.7 35.0 36.7
Arlet 11-Aug 65.3 41.1 24.2 Mollie`s Delicious 14-Aug 58.9 0.0 58.9
Arthur Turner 11-Aug 59.7 33.4 26.3 Mutsu 3-Sep 78.3 49.0 29.3
Beforest 3-Sep 58.5 29.3 29.3 Nero Rome 30-Aug 61.6 24.9 36.7
Beninomai 11-Aug 79.4 0.0 79.4 Nishtani Jonathan 8-Aug 35.0 0.0 35.0
Beverly hills 1-Aug 44.9 30.7 14.2 Northern Spy 3-Sep 98.8 50.7 48.0
Blairmont 1-Aug 57.7 25.8 32.0 Northwest Greening 1-Oct 96.7 78.5 18.3
Blushing Gold 3-Sep 94.0 55.2 38.9 Nubeena 1-Nov 106.3 94.4 11.9
Bonnoe 10-Sep 69.9 45.8 24.1 Nugget Spur 1-Oct 67.2 61.4 5.8
Charles Ross 13-Aug 86.5 0.0 86.5 Obilnoye 30-Aug 95.4 0.0 95.4
Chicheng 14-Sep 55.3 52.7 2.6 Oregon Spur 6-Nov 65.3 44.8 20.5
Collet 13-Aug 56.0 0.0 56.0 Orin 3-Sep 78.4 59.9 18.5
Crimson King 14-Aug 74.6 0.0 74.6 Oswego 1-Oct 90.5 52.4 38.1
Dayton 14-Aug 61.8 44.9 16.9 Pederstrup 11-Sep 67.7 0.0 67.7
Delicious 30-Aug 58.9 27.9 31.0 Picnic 25-Sep 69.7 36.2 33.5
Demir 17-Oct 102.1 79.8 22.3 Pink Lady 9-Nov 77.0 66.0 11.0
Diana 11-Oct 69.3 38.8 30.4 Pink Wood 1-Aug 59.9 21.8 38.0
Double Red Delicious 30-Aug 66.3 38.5 27.8 Pixie 31-Aug 111.0 74.9 36.2
Early Golden 2-Aug 70.8 0.0 70.8 Prairie Spy 11-Sep 81.5 52.9 28.6
Eikou 9-Aug 53.4 48.1 5.3 Red delicious 3-Sep 60.8 24.4 36.4
Empress 8-Aug 53.4 0.0 53.4 Royal Jonathan 31-Aug 75.8 44.9 30.9
Eurika 2-Aug 51.9 0.0 51.9 Sampion 1-Oct 59.7 24.2 35.5
Fallwater 1-Nov 72.9 46.0 26.9 Seohong 9-Aug 47.4 32.6 14.8
Field Spy 11-Sep 64.2 49.8 14.4 Shenshu 3-Sep 63.8 60.8 3.0
FO73.11D.3 5-Nov 86.9 63.6 23.3 Shinano Gold 17-Sep 72.5 65.1 7.4
Frequin 14-Aug 64.8 0.0 64.8 Shiro 3-Sep 66.0 31.6 34.5
Fuji 31-Oct 50.5 48.9 1.6 Smokehouse 20-Aug 53.0 0.0 53.0
Fuji-Nagafu 6 15-Oct 57.9 56.7 1.2 Smoothee Golden 26-Sep 62.9 33.0 29.9
Fuji-Rakuraku 15-Oct 59.5 56.6 2.9 Spartan 31-Aug 83.4 40.4 43.0
Gala 14-Aug 80.2 55.1 25.1 Spur Golden Delicious 14-Sep 59.6 41.5 18.1
Galaxy Gala 21-Aug 77.5 57.1 20.4 Spur Starking 24-Aug 62.9 37.1 25.9
Gamhong 2-Oct 64.1 58.3 5.8 Stearns 13-Aug 60.9 35.2 25.8
Geneva Black 14-Aug 49.7 36.3 13.4 Sun Gold 20-Aug 56.6 31.6 25.1
Giant Janet 6-Nov 76.8 38.2 38.5 Sundale Sturdee Spur 14-Sep 116.2 97.5 18.7
Gingergold 8-Aug 44.4 0.0 44.4 Sunlight 14-Aug 54.2 34.8 19.4
Gold spur 3-Sep 76.8 42.8 34.0 Sunrise 1-Aug 46.0 0.0 46.0
Golden Delicious 3-Sep 63.5 42.9 20.5 Sweet Delicious 31-Aug 65.3 37.8 27.5
Gravenstein 14-Aug 46.9 0.0 46.9 Tallmans Sweet 31-Aug 80.0 61.0 19.0
Great Ralls 6-Nov 78.6 43.6 34.9 Telamon 27-Sep 64.1 31.3 32.8
Gros Bois 20-Aug 65.0 37.9 27.2 Trent 27-Sep 89.3 74.7 14.5
Hillwell Red Braeburn 17-Oct 66.6 33.7 32.9 Tsugaru-Sayaka 11-Aug 61.8 39.2 22.6
Holly 6-3 15-Oct 56.5 43.2 13.3 Turley Winesap 17-Sep 51.7 19.3 32.4
Hongan 27-Sep 56.3 53.8 2.5 Virginiagold 1-Oct 60.0 53.7 6.3
Hongso 14-Sep 72.7 64.1 8.6 White Winter Pearmain 8-Nov 60.7 26.4 34.3
Hwangok 14-Sep 57.2 54.3 2.9 Wickson 8-Nov 60.2 25.9 34.3
Idajon 17-Sep 61.9 32.4 29.5 Yellow Bellflower 27-Sep 75.3 37.0 38.4
Idared-1 25-Sep 62.8 45.2 17.6 Yellow Delicious 19-Sep 62.8 42.7 20.1
Ikorrocavka Alaja 14-Aug 38.0 0.0 38.0 zuboff 6-Sep 94.5 20.8 73.8

According to genotype of Md-ACS1, Md-ACO1, and Md-PG1, fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage, difference between firmness at harvest and firmness after storage in 108 samples.

Genotypez Firmness (N)

Fresh fruit Storage fruit Difference in fresh and storage fruit
ACS1-1/1 71.6ay 32.7b 38.9a
ACS1-1/2 66.3a 36.3b 29.9a
ACS1-2/2 67.6a 48.7a 18.9b

ACO1-1/1 66.5a 41.2a 25.3a
ACO1-1/2 66.5a 41.8a 24.8a
ACO1-2/2 69.1a 34.6a 34.5a

PG1-1/1 69.0a 50.5a 18.6bc
PG1-2/2 62.9a 48.2a 14.8c
PG1-1/3 67.2a 31.9a 35.4a
PG1-2/3 67.8a 36.3a 31.5ab
PG1-3/3 68.9a 34.1a 34.9a
Table 1 Primer sequences used for amplifying Md-ACS1, Md-ACO1, and Md-PG1 genes.
Table 2 Md-ACS1, Md-ACO1, and Md-PG1 genotype of 750 apple germplasm preserved in Apple Research Institute (Gunwi), NIHHS, RDA.

zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.

yBold text indicate that cultivar or collection was used for firmness analysis.

Table 3 Fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage and difference between firmness at harvest and firmness after storage in 108 samples.
Table 4 According to genotype of Md-ACS1, Md-ACO1, and Md-PG1, fresh fruit firmness at harvest, firmness after 20 days of room temperature (20~25℃) storage, difference between firmness at harvest and firmness after storage in 108 samples.

zGenotype means the allelic composition of Md-ACS1, Md-ACO1, and Md-PG1 by PCR analysis.

yMeans followed by the same letters within the column per parameter are not significantly different (p<0.05).