Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

국내 밀 품종의 붉은곰팡이병 저항성 유전자 평가

이명희1, 최창현1, 홍수민2, 강천식1, 윤미라1, 장기창1, 박철수2, 김경민1,*

Assessment of Fusarium Head Blight Resistance Genes in Domestic Wheat Varieties

Korean Journal of Breeding Science 2024;56(3):205-223.
Published online: September 1, 2024

1농촌진흥청 국립식량과학원

2전북대학교 작물생명과학과

1National Institute of Crop Science, Rural Development Administration, Wanju, 55365, Republic of Korea

2Department of Crop Science and Biotechnology, Jeonbuk National University, Jeonju, 54896, Republic of Korea

*Corresponding to Kyeong-Min Kim TEL. +82-63-238-5458 FAX. +82-63-238-5463 E-mail. raiders87@korea.kr
• Received: April 25, 2024   • Revised: July 8, 2024   • Accepted: July 16, 2024

Copyright © 2024 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 26 Views
  • 0 Download
prev next
  • Fusarium head blight (FHB) causes yield reduction, quality deterioration, and mycotoxin contamination in wheat, highlighting the need for resistant wheat varieties. In this study, we evaluated FHB resistance genes and infection rates in 44 domestic wheat varieties. Among them, 42 had the Type I resistance gene Fhb4, 37 had Fhb5, and 35 possessed both. For Type II resistance, 14 had Fhb1, 11 had Fhb2, and five had both. Twenty cultivars had both type I and type II resistance genes, and among them, Chungkye, Dahong, Gobun, Namhae, and Ol had all of the Fhb1, Fhb2, Fhb4, and Fhb5 genes. The average infection rate over three years was 42.6% in cases with both Type I and Type II resistance genes and 44.3% in cases without Type II resistance genes. The infection rate was very high in 2020 and very low in 2021, complicating the analysis of the three-year average. However, when the infection rate was evenly distributed in 2019, there was a tendency for increased resistance among the varieties carrying Type II resistance genes. This suggested that external factors may influence infection rates, emphasizing the need for a precise evaluation system suitable for selecting additional resistance genes. In addition, it is necessary to develop resistant varieties suited to the domestic environment through additional resistance gene selection and integration of resistance genes. This study contributes to understanding FHB resistance genes in domestic wheat varieties and developing resistant domestic wheat varieties.
Fusarium 속의 여러 종에 의해 발생하는 붉은곰팡이병(Fusarium head blight, FHB)은 밀에서 수량 감소와 품질 저하를 일으킨다. 출수와 개화 이후 잦은 강우 시 발생이 증가하며 FHB 병원균에 감염된 곡물에서 생산되는 트리코테신(trichothecenes, TCT)에 속하는 독소는 가축은 물론 사람에게도 중독증 피해를 일으킨다(Azimi et al. 2020, Buerstmayr et al. 2020, Ghimire et al. 2020, Ryu et al. 2011). 밀의 FHB 병원균 감염에 대한 저항성 유형은 5가지(Type I-Ⅴ)로 나뉘며 Type I은 초기 감염에 관련된 저항성, Type Ⅱ는 감염된 FHB 병원균의 이삭내 확산에 대한 저항성, Type Ⅲ는 DON과 같은 곰팡이 독소 축적에 대한 저항성, Type Ⅳ는 곰팡이의 종자 감염에 대한 저항성이며 Type Ⅴ는 수량 감소에 대한 저항성이다(Mesterházy 1995, Miller et al. 1985, Miller & Arnison 1986, Schroeder & Christensen 1963). FHB 저항성 평가에 Type Ⅰ과 Ⅱ 저항성 평가가 가장 많이 사용되지만 형태적 특성에 관련된 농업형질이 저항성에 영향을 미치기 때문에 Type Ⅱ의 저항성 평가를 포장이나 실내 검정으로 가장 많이 이용한다(Bai et al. 2003, Bai & Shaner 2004, Bushnell et al. 2003, Mesterházy 1995).
현재까지 400개 이상의 quantitative trait loci (QTL)가 보고되었지만 다양한 유전적 배경이나 환경조건에서 저항성이 검증된 Fhb 유전자는 7개(Fhb1-Fhb7)이며 현재까지 가장 많이 이용되고 있는 유전자는 Type Ⅱ 저항성인 Fhb1Fhb2 이다(Bai & Shaner 2004, Ma et al. 2020). Fhb1 유전자는 Sumai 3에서 유래하였으며 TaHRC (histidine-rich calcium-binding protein, His)유전자로 동정되었고(Jia et al. 2018, Li et al. 2019, Rawat et al. 2016, Su et al. 2019), Fhb2는 Sumai 3 파생 계통의 재조합 근교계집단(recombinant inbred lines, RILs)을 이용한 유전분석으로 6BS 염색체의 Xgwm133Xgwm644 사이에 위치함이 확인되었다(Anderson et al. 2001, Buerstmayr et al. 2002, Cuthbert et al. 2007, Jia et al. 2018, Waldron et al. 1999, Xue et al. 2010, Zhou et al. 2002). Fhb4Fhb5는 Type Ⅰ 저항성 선발 마커로 이용되며 Fhb4는 4BL 염색체의 Xhbg226Xgwm149 사이에 존재한다(Jia et al. 2018, Xue et al. 2010). Fhb5 (Qfhs.ifa-5A)는 5A 염색체에 존재하며 두개의 독립된 QTL인 Qfhs.ifa-5AcQfhs.ifa-5AS로 분리되며 각각 Xgwm304-Xgwm415Xwgrb0222-Xwgrb1621에서 매핑 되었고, Type Ⅱ 저항성 선발에도 이용이 가능하다(Buerstmayr et al. 2018, Jia et al. 2018, Lin et al. 2006, Xue et al. 2011).
FHB 저항성 관련 QTL은 다른 농업형질과 매우 밀접하게 관련이 있는데, 키가 클수록, 무망(awnless) 품종 일수록, 그리고 개화 시 영이 열리는 정도가 적을수록 병원균과의 접촉 가능성이 줄어든다(Buerstmayr et al. 2009, Buerstmayr & Buerstmayr 2016, Gilsinger et al. 2005, Mesterhazy 1995, Steiner et al. 2017). 수밀도와 개화와 관련된 특성은 FHB와 관련이 있으며 이와 관련된 유전자들은 FHB QTL과 연관되어 있고(Buerstmayr & Buerstmayr 2016, Yi et al. 2018), 순화(domestication)와 관련된 유전자인 Q도 FHB와 연관이 있으며, 이는 다양한 이삭 형태 및 특성에도 영향을 미친다(Buerstmayr et al. 2020, Faris & Gill 2002, He et al. 2016, Islam et al. 2016, Liu et al. 2013, Miedaner & Voss 2008, Petersen et al. 2017, Simons et al. 2006, Yi et al. 2018). 이러한 다면 발현현상은 FHB 저항성 품종의 효율적인 선발을 위해 농업형질의 종합 고려가 필요함을 시사한다.
기후 변화로 인한 이상 기후 발생으로 FHB 발생 빈도와 심각성이 증가하고 있어서 주요 밀 생산국들은 FHB 저항성 강화를 위해 많은 노력을 기울이고 있다(Bai & Shaner 2004, Buerstmayr et al. 2009, Buerstmayr et al. 2020, Dill-Macky & Jones 2000, Ghimire et al. 2020, Gorash et al. 2021, Hao et al. 2020, Khan et al. 2020, Lee et al. 2023, Li et al. 2020, Ma et al. 2020, Zhu et al. 2019). 국내에서도 이상 기온으로 인한 FHB 발생이 증가하고 있다. 기존에 보고된 SSR marker와 STS marker를 이용한 국내 밀 23 품종에서 저항성 품종 선발 결과가 보고되었지만 저항성 유전자 발굴 및 품종개발 관련 연구는 매우 미흡한 실정이며, 국내 밀 품종들은 주로 중도저항성 품종들이다(Baek et al. 2022, Jung et al. 2010, Jung et al. 2011, Kang et al. 2014, Kim et al. 2019, Kim et al. 2021, Shin et al. 2014). 따라서 저항성 유전자 및 유전자원 선별과 분자 마커 개발을 통한 국내환경에 적합한 저항성 품종 개발이 필요하다.
본 연구에서는 우선적으로 국내에서 육성한 밀 44 품종에서 FHB 저항성 유전자 Fhb1, Fhb2, Fhb4, Fhb5의 보유 여부를 기존에 보고된 PCR 마커로 판별하고자 하였다. 그리고 3개년간 FHB 병원균(Fusarium graminearum)감염률을 조사하여 국내 밀의 FHB 저항성 유전자와 FHB 감염률에 대한 이해를 돕고자 하였다.
공시 재료
본 연구에서 이용된 밀 종자는 국내에서 육성 및 재배한 44 품종으로 국립식량과학원(전라북도 완주군) 전작 포장에서 농촌진흥청 표준재배법(RDA 2012)에 준하여 파종하고 수확하였다(Lee et al. 2022). 품종 정보는 Table 1에 표기하였으며, 대조구로는 전 세계적으로 많이 사용되고 있는 FHB 저항성 품종 Sumai 3와 Ning 7840을 사용하였다.
Genomic DNA 추출 및 PCR 분석
Genomic DNA는 밀 종자를 Petri Dish에서 키운 어린잎을 채취하여 plastic grinder를 이용하여 분쇄한 후 식물 Genomic DNA prep kit (Solgent, Korea)로 추출하였다(Lee et al. 2022, Son et al. 2013). 추출된 genomic DNA는 Nanodrop 1000 spectrophotometer (Thermo Scientific, Wilmington, USA)를 이용하여 정량 하였다. PCR 분석은 VeritiTM Dx96-Well Thermal Cycle (Applied Biosystem, USA)를 이용하였고, primer 정보 및 PCR 조건은 Table 2에 표기하였다. PCR 반응을 위해 100 ng genomic DNA, 각 10 pmole의 forward primer와 reverse primer, 1× PCR master mix solution (인터론바이오, Korea)을 사용하였다. PCR 조건은 94℃에서 5분간 pre-denaturation을 수행한 후 denaturation 94℃에서 30초, annealing 66℃ 또는 68℃에서 30초, extension 72℃에서 30초 과정을 30회 반복하였다. 이후 final extension을 72℃에서 5분간 진행하였다. PCR 산물은 1.2-2.0% agarose gel에서 전기영동 후 젤 이미지 시스템(Davinch-K, Korea)으로 이미지를 획득하였다(Lee et al. 2022).
붉은곰팡이병 감염률 검정
국내 밀 44 품종을 국립식량과학원(전라북도 완주군) 전작 포장에 파종하여 3개년간(2019-2021년) FHB 감염률을 농업과학기술 연구조사 분석기준(2012)에 준하여 검정하였다. Fusarium graminearum (GZ3639) (Shin et al. 2018) 균을 개화기 spray 방법으로 접종하고 수분유지를 위해 비닐봉지를 3일 동안 덮어 두었다. FHB 감염률은 접종 후 2-3주(2019년과 2020년에는 2주, 2021년은 3주) 후에 증상이 있는 스파이클렛(Spikelet)의 비율로 평가하였다.
통계 분석
데이터의 통계적 분석은 R software (ver.4.3.2)을 이용하여 분산분석(ANOVA)을 실시하고 상관관계는 피어슨의 상관계수를 이용하였다. 2019년 붉은곰팡이병에 대한 각 마커의 유전자형별 감염률에 대한 분산분석을 수행하였으며, 피어슨의 상관계수는 유전자형에서 유의수준 p≤0.05 수준으로 실시하였다.
기상환경 조사
2019-2021년의 기상환경(온도와 강수량)은 기상청 자료를 사용하였고 전라북도 전주시를 기준으로 분석하였다. 자세한 정보는 분문에 설명되었다.
Type Ⅰ 저항성 유전자 검정
Type Ⅰ 저항성은 Fhb4Fhb5 저항성 유전자 선별 마커가 주로 이용된다(Jia et al. 2018, Xue et al. 2010). PCR 선발 마커를 이용하여 국내 밀 44 품종의 Fhb4Fhb5 유전자 보유 여부를 판별하고자 하였다. 대조구로 Fhb5 유전자를 보유한 Sumai 3 품종을 사용하였다(Dai et al. 2022). Fhb4 선발 마커는 Xgwm349-4BXgwm149를 사용하였으며, Fhb5 선발 마커로는 Xgwm304, Xwmc705, Xgwm156을 이용하여 저항성 여부를 판별하였다(Fig. 1, Table 2).
Sumai 3에서 파생된 FHB 저항성 품종인 Ning 7840은 Fhb4 판별 마커에서는 Sumai 3와 동일하게 검출되어 Fhb4 유전자를 보유하지 않은 것으로 판단되며, Fhb5 유전자는 Xgwm304Xgwm156 마커에 검출되었지만 Xwmc705 마커에서는 검출되지 않았다(Supplementary Fig. 1). Fhb4 유전자를 가진 품종은 알찬과 조아를 제외한 42 품종이었으며, 두 판별 마커에 모두 저항성을 보이는 품종은 22 품종이었다(Fig. 1A, Table 3). Fhb5 유전자를 지닌 품종은 아리흑, 백중, 한백, 호중, 조은, 태중, 연백을 제외한 37 품종이었으며, 3개 마커에서 모두 검출된 품종은 18 품종이었다(Fig. 1B, Table 3). 그리고 Fhb4Fhb5 유전자를 모두 가진 품종은 35 품종이었으며 그 중에 청계, 다분, 다홍, 다중, 고소, 조품, 올그루, 새금강, 새올, 서둔, 신미찰이 Fhb4 유전자 판별 마커 2개와 Fhb5 유전자 판별 마커 3개 모두에서 검출되었다. Fhb4Fhb5 유전자 및 두 유전자를 공통적으로 보유한 품종 수를 Venn diagram에 표시하고 각 유전자의 모든 마커에 저항성을 보이는 품종 수는 괄호안에 따로 표시하였다(Fig. 2).
Type Ⅱ 저항성 유전자 검정
Type Ⅱ 저항성 유전자로는 Fhb1Fhb2가 많이 이용되고 있다(Bai & Shaner 2004, Ma et al. 2020). PCR 기반 마커를 이용하여 국내 밀 44 품종의 Fhb1Fhb2 유전자 보유 여부를 판별하고자 하였고, 대조구로는 Fhb1Fhb2 유전자를 보유한 Sumai 3를 사용하였다(Dai et al. 2022). Fhb1 유전자 판별마커로 TaHRC-GSMSGNH-GSP를 사용하였고, Fhb2 유전자 판별마커로는 Xwmc398Xwmc397를 사용하였다(Fig. 3, Table 2). Ning 7840은 Sumai 3와 동일하게 모든 마커에서 Fhb1Fhb2 유전자가 검출되었다(Supplementary Fig. 1). Fhb1 유전자를 가진 품종은 청계, 다홍, 은파, 고분, 진품. 조아, 조은, 중모2008, 밀성, 남해, 올, 새올, 서둔, 수강이었으며 2가지 마커에서 동일한 결과를 얻었다(Fig. 3A). Xwmc398Xwmc397 마커로 검정한 결과 Fhb2 유전자를 가진 품종은 11 품종이었으며 2가지 마커에서 모두 검출된 품종은 청계, 다홍, 남해, 올, 신미찰1 이었다(Fig. 2, Fig. 3B). Fhb1Fhb2 유전자를 모두 가진 품종은 5 품종으로 청계, 다홍, 고분, 남해, 올이었으며 청계, 다홍, 남해, 올이 모든 마커에서 검출되었다(Fig. 2). 그리고 Fhb1Fhb2 두 유전자 모두를 포함하지 않은 품종은 24 품종이었다. Fhb1Fhb2 유전자 및 두 유전자를 공통적으로 보유한 품종 수를 Venn diagram에 표시하고 각 유전자의 모든 마커에 저항성을 보이는 품종 수는 괄호안에 표시하였다(Fig. 2). 국내 품종 중에 Type Ⅰ 저항성 유전자에 비해 Type Ⅱ 저항성 유전자를 포함하는 품종은 많지 않았다.
국내 밀 품종의 붉은곰팡이병 감염률 평가
최근 3개년간(2019-2021년) 국내 밀 44 품종의 FHB 감염률을 포장에서 검정하여 결과를 Table 4Fig. 4A에 나타내었다. 대조구로는 FHB 저항성 품종인 Sumai 3와 Ning 7840을 사용하였다. 3개년 감염률의 평균은 26.7%로 연차간 변이가 크게 나타났으며, 2021년이 5.1%로 제일 낮은 반면 2020년은 평균이 47.9%로 3개년 중에 가장 높았으며, 2019년은 27.0%를 나타내었다. 최대 감염률의 평균은 2019년은 42.8%, 2020년은 74.8%, 2021년은 14.4%이었다(Fig. 4A, Table 4). 중모2008은 FHB 감염률 평가가 이루어지지 않았고, 아리흑, 우주, 황금알은 2019년에는 평가되지 않아서 분석에는 포함하지 않았다. 3개년간 평균 감염률은 Sumai 3와 Ning 7840에서 각각 10.3%와 21.3%를 보였고, 최대 감염률 평균은 각각 30.0%와 33.3%를 보였다. 국내 품종 중에 감염률이 낮은 품종은 백찰, 밀성, 서둔, 태중이었으며 각각 평균값은 4.3%, 7.0%, 10.0%, 14.0%를 보였고, 최대 감염률의 평균값은 각각 10.0%, 20.0%, 26.7%, 26.7%이었다.
전반적인 감염률이 높은 2020년을 제외한 2019년과 2021년에서 최대 감염률의 평균이 10% 이하를 보인 품종은 안백, 백찰, 백강, 고분, 밀성, 새금강, 신미찰, 수안, 수강이었다. 3개년간 감염률이 높은 품종은 백중, 조은, 조경, 조농, 조품, 금강, 연백으로 최대 감염률의 평균값이 60% 이상을 나타내었으며, 2019년과 2021년의 2개년간 감염률이 높게 나타난 품종은 백중, 고소, 호중, 조은, 조중, 조경, 조농, 조품, 금강, 새올이며 최대 감염률의 평균값이 45-55%를 나타내었다(Fig. 4A, Table 4).
다음으로 감염률이 고르게 분포되어 있는 2019년의 품종 별 감염률을 비교하였다. 최고 감염률이 10% 이하를 보이는 품종은 안백, 백찰, 백강, 다홍, 진품, 밀성, 신미찰, 수안, 탑동이었으며 평균 감염률이 50% 이상인 품종은 백중, 고소, 조은, 조한, 조농, 조품, 금강, 새올, 연백이었다. Jung et al. (2010, 2011)에 의해 Type Ⅰ과 Type Ⅱ 저항성으로 보고된 진품은 2019년도 저항성 평가에서도 최대 감염률의 평균이 10%로 상대적으로 저항성이 높은 것으로 평가되었으나, 감수성으로 평가된 다홍과 연백의 평균 감염률은 각각 2%와 98%를 보여 결과가 일치하지는 않았다(Table 4).
기상현상과 붉은곰팡이병 감염률 분석
FHB는 출수기와 유숙기에 해당하는 4월 중하순부터 5월의 기온이 18-20℃, 3일 연속으로 비가 내리고, 상대습도가 80% 이상인 날이 계속될 때 감염되기 쉽다. 기상청 자료에 의하면 2019-2021년의 전라북도 전주시의 년 강우 일수는 각각 102일, 119일, 132일로 년 강수량은 각각 968.9 mm, 1,780.8 mm, 1,496.6 mm 이었으며, 7월의 강수일수는 각각 13일, 25일, 16일로 2020년이 유독 긴 강수일수를 보였다. 하지만 4월의 강수량은 각각 98.5 mm, 23.0 mm, 34.5 mm 로 오히려 2020년이 적었고, 5월의 강수량은 각각 45.6 mm, 79.0 mm, 182.2 mm를 보였다. 1월의 평균기온은 각각 0.55℃, 3.45℃, 0.49℃를 보였고, 4월의 평균기온은 각각 12.6℃, 10.9℃, 14.4℃로 2020년의 1월은 평균적으로 높은 기온을 보인 반면 4월은 평균 기온이 낮았다(Fig. 4B). 5월 기온은 18.9℃, 18.6℃, 17.7℃로 년도 별 평균온도의 차이는 유의하지 않았다. 그러나 5월 초 9일간의 평균기온은 각각 15.6℃, 19.3℃, 17.4℃로 2020년도가 2019년과 2021년에 비해 각각 3.7℃와 4.6℃ 높았고, 최저기온은 각각 4.8℃와 4.9℃, 최고기온은 각각 1.7℃와 4.2℃ 정도 높았다(Figs. 4B, 4C).
2019-2021년의 출수일은 조품이 각각 4월 21일, 4월 10일, 4월 7일로 제일 빨랐으며, 태중이 각각 5월 5일, 4월 27일, 4월 23일로 가장 늦었다. 그리고 개화기는 조품이 각각 4월 30일, 4월 22일, 4월 19일이었고, 태중이 각각 5월 11일, 5월 2일, 4월 28일이었다(Table 5). 2019년의 접종은 4월 30일과 5월 11일 사이였으며(Fig. 4C, 구역 Ⅲ), 조사일은 5월 14일과 5월 28일 사이(Fig. 4C, 구역 Ⅳ)에 수행되었고 접종기와 조사일 사이에는 거의 비가 오지 않았다(Fig. 4D). 2020년의 출수기는 4월 10일과 4월 27일 사이였고, 개화기는 4월 22일과 5월 2일이었으며 4월 20일에는 대부분의 품종이 개화를 하였다. 출수기에는 기온이 내려갔으나(Fig. 4C, 구역 Ⅱ), 균 접종 후 관찰기인 4월 하순에서 5월 상순에는 비와 함께 기온이 상승하였다(Fig. 4C, 구역 Ⅱ, Ⅲ). 2021년은 4월 초에 기온이 높았고(구역 Ⅰ), 출수가 4월 7일에서 4월 23일 사이였으며 개화는 4월 19일과 4월 28일 사이로 기온이 상승했다가 하락하였다(Fig. 4C, 구역 Ⅱ). 조사기인 5월 5일에서 10일까지 비가 거의 없고, 발병이 거의 되지 않아서 감염률 조사를 1주일 늦추었다. F. graminearum 접종 후에 비와 함께 온도가 올라간 2020년의 발병률이 매우 높았으며, 비가 거의 오지 않은 2021년도에는 발병률이 매우 낮았다. 해마다 감염률이 다른 원인은 4월과 5월의 출수와 개화기(균 접종기)에 강수와 함께 온도에 영향을 많이 받은 것으로 추측된다. 따라서 정교한 평가를 위해서 환경에 영향을 받지 않는 FHB 실내 온실검정시스템 구축이 필요하다.
FHB 감염률에서 Type Ⅰ과 Type Ⅱ 저항성 유전자 효과
국내 밀 품종은 하나 이상의 마커에서 Type Ⅰ 저항성 유전자를 보유한 것으로 판별되었다. 따라서 Type Ⅰ 저항성 유전자와 Type Ⅱ 저항성 유전자의 조합에 따른 감염률을 비교하고자 하였다(Table 3, Table 4, Fig. 2). Type Ⅰ 저항성의 Fhb4 유전자와 Type Ⅱ 저항성의 Fhb1 유전자를 보유한 품종은 청계, 다홍, 은파, 고분, 진품, 조은, 중모2008, 밀성, 남해, 올, 새올, 서둔, 수강 13 품종으로 청계, 다홍, 밀성, 새올, 서둔, 수강은 Fhb4Fhb1 유전자의 판별 마커에서 모두 검출되었다. 3개년 평균 12.7-52.3%의 감염률을 보였으며, 3개년 최대 감염률 평균은 20.0-73.3% 범위를 나타내었다. Type Ⅰ의 Fhb4와 Type Ⅱ의 Fhb2 유전자를 보유한 품종은 안백, 청계, 다홍, 고분, 남해, 올, 신미찰1, 수안, 탑동, 우리 10 품종으로 모든 마커에 검출된 품종은 청계와 다홍 두 품종이었다. 3개년 평균 12.7-38.7%의 감염률을 보였으며, 3개년 최대 감염률은 평균 33.3-46.7%를 보였다. Type Ⅰ의 Fhb5 유전자와 Type Ⅱ의 Fhb1 유전자가 검출된 품종은 청계, 다홍, 은파, 고분, 진품, 조아, 중모2008, 밀성, 남해, 올, 새올, 서둔, 수강이었으며, 그 중에 9 품종이 모든 마커에서 검출되었다. 3개년 평균 7.0-36.3% 감염률을 보였으며, 3개년 최대 감염률 평균은 20-53.3% 사이였다. Type Ⅰ의 Fhb5 유전자와 Type Ⅱ의 Fhb2 유전자가 검출된 품종은 알찬, 안백, 청계, 다홍, 고분, 남해, 올, 신미찰, 수안, 탑동, 우리 11 품종이며 청계, 다홍, 남해, 올이 모든 마커에서 검출되었다. 3개년 평균 12.7-36.3% 감염률을 보였으며, 3개년 최대 감염률 평균은 33.3-46.7% 사이였다.
Type Ⅰ의 Fhb4, Fhb5 유전자와 Type Ⅱ의 Fhb1 유전자를 보유한 품종은 청계, 다홍, 은파, 고분, 진품, 중모2008, 밀성, 남해, 올, 새올, 서둔, 수강 12 품종이었으며 청계, 다홍, 새올, 서둔이 모든 마커에서 검출되었다. 3개년 평균 7.0-38.7% 감염률을 보였으며, 3개년 최대 감염률 평균은 20.0-53.3%를 보였다. TypeⅠ의 Fhb4, Fhb5 유전자와 Type Ⅱ의 Fhb2 유전자를 가진 품종은 안백, 청계, 다홍, 고분, 남해, 올, 신미찰1, 수안, 탑동, 우리 10 품종이었으며 청계와 다홍이 모든 마커에서 유전자가 검출되었다. 3개년 평균 14.0-38.7%의 감염률을 보였고, 3개년 최대 감염률 평균은 33.3-46.7% 이었다. Type Ⅰ의 Fhb5 유전자와 Type Ⅱ의 Fhb1Fhb2 유전자를 가진 품종은 청계, 다홍, 고분, 남해, 올 5 품종으로 청계, 다홍, 남해, 올이 모든 판별 마커에서 검출되었다. 3개년 평균 12.7-38.7% 감염률을 보였으며, 3개년 최대 감염률은 평균 33.3%-46.7%를 보였다. 동일하게 Type Ⅰ의 Fhb4와 Type Ⅱ의 Fhb1, Fhb2 저항성 유전자를 가진 품종과 Type Ⅰ의 Fhb4, Fhb5와 Type Ⅱ의 Fhb1, Fhb2 저항성 유전자 모두를 가지는 품종은 청계, 다홍, 고분, 남해, 올 이었으며 모든 마커에서 검출된 품종은 청계, 다홍이었다.
Type Ⅱ 저항성 유전자 집적 효과
3개년간 감염률이 낮은 품종은 백찰, 밀성, 서둔, 태중이었으며 3개년 최대 감염률 평균이 각각 10.0%, 20.0%, 26.7%, 26.7% 이었다(Table 4). 백찰, 밀성과 서둔, 태중은 각각 Fhb4+Fhb5, Fhb1+Fhb4+Fhb5, Fhb4 유전자를 보유하였다(Table 3). 전반적인 감염률이 높은 2020년을 제외한 2019년과 2021년에서 최대 감염률이 평균 10% 이하를 보인 품종은 안백, 백찰, 백강, 고분, 밀성, 새금강, 신미찰, 수안, 수강으로 백찰, 백강, 새금강, 신미찰은 Fhb4+Fhb5 유전자를 보유하였고, 고분은 Fhb1+Fhb2+Fhb4+Fhb5, 밀성과 수강은 Fhb1+Fhb4+Fhb5, 안백과 수안은 Fhb2+Fhb4+Fhb5 유전자를 보유하였다. 3개년간 평균 최대 감염률이 높은 품종은 백중, 조은, 조경, 조농, 조품, 금강, 연백으로 감염률이 60% 이상이었으며 조경, 조농, 조품, 금강이 Fhb4+Fhb5, 백중은 Fhb1, 조은은 Fhb1+Fhb4, 연백이 Fhb4 유전자를 보유하고 있었다. 2019년과 2021년의 2개년간 최대 감염률이 높게 나타난 품종은 백중, 고소, 호중, 조은, 조중, 조경, 조농, 조품, 금강, 새올로 최대 감염률 평균은 45-55%를 나타내었다. 고소, 호중, 조중, 조경, 조농, 조품, 금강은 Fhb4+ Fhb5, 백중은 Fhb4, 조은은 Fhb1+Fhb4, 새올은 Fhb1+Fhb4+Fhb5 저항성 유전자를 보유하고 있다. Type Ⅰ의 Fhb4, Fhb5와 Type Ⅱ의 Fhb1Fhb2 유전자 모두를 가지는 청계, 다홍, 고분, 남해, 올의 3개년 최대 감염률 평균은 각각 46.7%, 40%, 40%, 36.7%, 33.3%로 감염률과 저항성 유전자 보유정도와는 일치하지 않았다(Table 3, Table 4).
2020년은 전반적으로 감염률이 높았고, 대조적으로 2021에는 전반적으로 감염률이 낮아서 3개년 평균으로는 분석하기가 어려웠다. 그래서 감염률이 고르게 분포되어 있는 2019년의 감염률을 Type Ⅱ 저항성 유전자별로 분석하였다(Table 3, Table 4). Type Ⅱ 저항성 유전자가 없는 금강, 조품, 조농, 연백, 백중, 고소, 조한의 감염률은 66-98%로 평균 27% 감염률에 비해 매우 높았으며, 조경과 조중도 평균이 각각 49%와 46%로 상대적으로 높게 나왔다. 그리고 새올과 조은을 제외하고 Type Ⅱ 저항성 유전자 중에 Fhb1 유전자만을 가진 품종은 1-8% 감염률을 보였고, Fhb2 유전자만을 가진 품종도 2-10% 감염률을 보였다. 게다가 Fhb1Fhb2 유전자를 모두 가진 올, 다홍, 청계, 남해는 각각 2-11%로 모두 감염률이 낮았다. 하지만 Fhb1 유전자를 보유한 새올과 조은은 각각 91%와 60%로 감염률이 높게 나왔고, Fhb1 유전자를 보유하지 않은 올그루, 신미찰, 백찰, 백강, 새금강도 낮은 감염률을 보였다. Type Ⅱ 저항성 유전자의 보유와 감염률이 정확히 일치하지 않지만 저항성 유전자의 보유 따라 저항성이 높아지는 경향을 보였다. 이전 연구에서 국내 밀 품종의 FHB Type Ⅱ 저항성과 관련된 마커 분석에서 XSTS3B-57 마커가 explained variation (%)이 32.4%로 FHB 저항성과 밀접하게 관련 있다고 설명하였다(Jung et al. 2011). 본 연구에서는 9개의 마커 중에 SGNH-GSP를 제외하고 polymorphism을 보인 8개의 마커에서 2019년의 국내 밀 40 품종과 Sumai 3의 FHB 평균 감염률로 유전자형에 따른 상관분석을 수행하였다(Table 6). Fhb2와 관련된 마커인 Xwmc398Xwmc397의 저항성 유전자형과 감수성 유전자형의 감염률 평균이 각각 6.40%와 31.75% 및 6.70%와 31.66%를 보였으며 유의수준은 p≤0.001로 유의미한 값을 보였다. 하지만 explained variation은 각 10.37%과 8.92%로 낮은 값을 보여 설명력은 낮았다. 그러나 이러한 경향은 감염률이 높게 나오는 해에는 의미가 없어 보인다. 따라서 위의 저항성 유전자 이외에도 국내 환경에 맞는 저항성 유전자의 추가 선발 및 저항성을 가지는 자원들을 활용한 저항성 유전자를 집적한 품종 개발이 필요하다.
Type Ⅰ 저항성 유전자인 Fhb4Fhb5를 보유한 품종은 각각 42개와 37개였으며, Fhb4Fhb5 유전자 모두 보유한 품종은 35개였다. Type II의 Fhb1Fhb2 유전자를 보유한 품종은 각각 14개와 11개였고, Fhb1Fhb2 유전자를 동시에 가지는 품종은 5개였다. Type Ⅰ의 Fhb5 유전자와 Type Ⅱ의 Fhb1 유전자를 가지는 품종은 13 품종이였으며 Type Ⅰ의 Fhb4, Fhb5와 Type Ⅱ의 Fhb1 유전자를 포함하는 품종은 12 품종이었다. Type Ⅰ의 Fhb5와 Type Ⅱ의 Fhb1Fhb2 유전자를 포함한 품종은 5 품종이었으며 Type Ⅰ의 Fhb4, Fhb5와 Type Ⅱ의 Fhb1Fhb2 유전자 모두를 가지는 품종은 5 품종이었다. 그 중에 모든 마커에 검출된 품종은 2 품종(청계, 다홍) 이었다.
국내 44 품종에서 붉은곰팡이병 감염률을 평가했을 때 Type Ⅰ과 Type Ⅱ 저항성 유전자 보유여부에 따른 감염률 정도는 일치하지 않았으며 해마다 감염률 차이가 크게 나타났다. 붉은곰팡이병의 감염률이 해마다 다른 원인은 4월과 5월의 출수기와 개화기에 강수와 함께 온도에 영향을 많이 받은 것으로 추측된다. 2019년의 감염률로 평가하였을 때 Type Ⅱ 저항성 유전자를 보유한 품종들이 보유하지 않은 품종들에 비해 전반적으로 감염률이 낮은 경향을 보였다. 그러나 정교한 평가를 위해서는 환경에 영향을 받지 않는 붉은곰팡이병 실내 온실검정시스템 구축이 필요하며 위의 저항성 유전자 이외에 국내환경에 맞는 저항성 유전자의 추가 선발과 집적을 통한 저항성 품종 개발이 필요하다. 또한 앞으로는 DON 생산형 균 F. graminearum 외에 피해가 증가하고 있는 NIV 생산형 균 F. asiaticum에 대한 저항성 평가도 필요하다.
붉은곰팡이병에 감염된 밀은 수량 감소와 품질 저하는 물론 인축 독성의 위험이 있기 때문에 저항성 품종의 육성은 매우 중요하다. 본 연구에서는 국산 밀 44 품종의 저항성 유전자의 보유에 따른 붉은곰팡이병 감염률과 저항성 정도를 비교하고자 하였다. Type Ⅰ 저항성의 Fhb4Fhb5 유전자를 보유한 품종은 각각 42개와 37개였으며 두 유전자 모두 보유한 품종은 35개였다. Type II 저항성의 Fhb1Fhb2 유전자를 보유한 품종은 각각 14개와 11개였고, 두 유전자를 동시에 가지는 품종은 5개였다. 그리고 Type Ⅰ의 저항성 유전자와 Type Ⅱ의 저항성 유전자를 가지는 품종은 20 품종이었으며 그 중에 Fhb1, Fhb2, Fhb4, Fhb5 유전자 모두를 가지는 품종은 5 품종이며 모든 마커에서 저항성 유전자가 검출되는 품종은 2 품종으로 청계와 다홍이었다. 국내품종은 1개 이상의 마커에서 Type I 저항성 유전자를 보유한 것으로 판별되었으며, Type I과 Type II 저항성 유전자를 보유한 품종의 3개년 평균 감염률과 최대 감염률의 평균은 각각 26.0%와 42.6% 이었고, 그렇지 못한 품종이 26.9%와 44.3%로 저항성 유전자 보유에 따른 차이가 나타나지 않았다. 그리고 다홍과 청계의 최대 평균 감염률은 각각 40.0%와 46.7%로 44 품종의 최대 평균 감염률과 차이가 없었다. 하지만 해마다 감염률이 일정치 않아 상대적으로 감염률이 고르게 분포된 2019년의 감염률 평가에서는 Type Ⅱ 저항성 유전자를 가진 품종들이 그렇지 않은 품종들에 비해 전반적으로 감염률이 낮은 경향을 보였다. 이러한 결과는 외부 환경 등 여러 요인이 영향을 미친 것으로 추정되며, 정교한 평가시스템 구축 및 국내 환경에 맞는 추가적인 저항성 유전자 선발 및 저항성 유전자의 집적을 통한 저항성 품종 개발의 필요성을 나타낸다. 본 연구에서 평가한 붉은곰팡이병 저항성 유전자 정보를 통하여 국내 붉은곰팡이병 저항성 밀 품종개발에 유용하게 활용할 수 있을 것으로 판단된다.
본문의 Supplementary Fig. 1은 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 연구는 2024년도 농촌진흥청 국립식량과학원 전문연구원 과정 지원사업과 농촌진흥청 연구사업(과제명: 가공 용도별 밀 품종개발 및 육종효율 증진연구(4단계), 과제번호: PJ016771012024)의 지원으로 수행되었습니다.
Fig. 1
PCR analysis of Fusarium head blight Type Ⅰ resistance genes Fhb4 (A) and Fhb5 (B) in 44 domestic wheat cultivars. The variety numbers above the figure are the same as in the Table 1 and Table 3, respectively. Arrows indicate amplified DNA fragments predicted to be candidate genes. DM, DNA size marker; S3, Sumai 3.
kjbs-56-3-205-f1.jpg
Fig. 2
Venn diagram analysis of 44 domestic wheat cultivars harboring Fusarium head blight resistance genes. The numbers are representing the number of cultivars containing each resistance gene and the numbers in parentheses indicate the number of cultivars showing resistance across all markers for each gene in Fig. 1, Fig. 3, and Table 3.
kjbs-56-3-205-f2.jpg
Fig. 3
PCR analysis of Fusarium head blight Type Ⅱ resistance genes Fhb1 (A) and Fhb2 (B) in 44 domestic wheat cultivars. The variety numbers above the figure are the same as in the Table 1 and Table 3. Arrows indicate amplified DNA fragments predicted to be candidate genes. DM, DNA size marker; S3, Sumai 3.
kjbs-56-3-205-f3.jpg
Fig. 4
Evaluation of weather conditions and Fusarium head blight infection rate. (A) Fusarium head blight infection rates, (B, C) temperature, and (D) precipitation over three years (2019-2021). The cultivars number are the same as Table 4. C1, Sumai 3; C2, Ning 7840.
kjbs-56-3-205-f4.jpg
Table 1
List of domestic wheat varieties and Fusarium head blight resistance cultivars used in this study.
Table 1
No. Cultivar Pedigree No. Cultivar Pedigree
C1z Sumai 3 Funo/Taiwanxiaomai 22 Johan Suwon262/Joeun
C2 Ning 7840 Avrova/Anhui 11/Sumai 3 23 Jojoong Suwon272/Olgeuru//Keumkang/Suwon252
1 Alchan Suwon210/Tapdong 24 Jokyung Seri82/Keumkang
2 Anbaek Sae/Geuru 25 Jonong Suwon234/SW80199
3 Ariheuk K253305/Sinmichal 26 Jopoom Kanto75//OR8500494P/Bezostaya
4 Baekchal Sinmichal/Keumkang 27 Joongmo2008 Eunpa*2//SH3/CBRD/3/Keumkang
5 Baekjoong Keumkang/Olgeuru 28 Keumkang Geuru/Kanto75//Eunpa
6 Baekkang Topdong/Klasic 29 Milsung Shirogane//Norin43/Sonalika
7 Chungkye Norin4/Sharbatisonora 30 Namhae Ol/Calidad
8 Dabun Suwon234//sw76039/Suwon22 31 Ol Norin72/Norin12
9 Dahong Norin72/Wonkwang 32 Olgeuru Geuru/Chokwang//Saikai143
10 Dajoong SW992114-NM-131-7/Gobun 33 Saekeumkang Keumkang/Olgeuru
11 Eunpa Chugoku81/3/Tob-CNO//Yuksung3/Suwon185 34 Saeol Shirogane//Norin43/Sonalika
12 Geuru Strampelli/69D-3607//Chokwang 35 Seodun Geuru/Genaro81
13 Gobun Eunpa/Tapdong//Eunpa/Shannung6521 36 Sinmichal Olgeuru//Kanto107/BaiHuo
14 Goso Gobun/Ol 37 Sinmichal1 Alchan//Kanto107/BaiHuo
15 Hanbaek Shann7859/Keumkang//Guamuehill 38 Suan Keumkang/Eunpa//Keumkang
16 Hojoong Alchan2/3/Chunm18//JUP/BJY/4/Keumkang 39 Sukang Suwon266/Asakaze
17 Hwanggeumal Jokyung/Kauz/Rayo//Jopoom 40 Taejoong Xian83 (104).11/Keumkang
18 Jeokjoong Keumkang/Tapdong 41 Tapdong Chugoku81//Suwon158/Toropi
19 Jinpoom Geuru/Genaro81 42 Uri Geuru/Ol
20 Joa SW86054-MB-27-3-2-1-1-1/Sumai 3 43 Younbaek Keumkang/Tapdong
21 Joeun Eunpa/Suwon242 44 Wooju Jokyung/K253306

zC: control

Table 2
Primers used in this study for detection of Fusarium head blight resistance genes.
Table 2
Gene Primer name 5'-3' ATz (℃) Agarose gel (%) Genome Reference
Fhb1 TaHRC-GSM-F ATTCCTACTAGCCGCCTGGT 68 1.2 3B Su et al. 2019
TaHRC-GSM-R ACTGGGGCAAGCAAACATTG
SGNH_GSP-F CAATTCCAGCAGTTCATCAAC 68 2.0 3B Singh et al. 2019
SGNH_GSP-R CATACCCGCAACACACAT
Fhb2 Xwmc398-F GGAGATTGACCGAGTGGAT 66 2.0 6B Cuthbert et al. 2007
Xwmc398-R CGTGAGAGCGGTTCTTTG
Xwmc397-F AGTCGTGCACCTCCATTTTG 68 2.0 6B Cuthbert et al. 2007
Xwmc397-R CATTGGACATCGGAGACCTG
Fhb4 Xgwm349-4B-F ACACACACTCGATCGCAC 66 3.0 4B Xue et al. 2010
Xgwm349-4B-R GCAGTTGATCATCAAAACACA
Xgwm149-F CATTGTTTTCTGCCTCTAGCC 68 2.0 4B Somers et al. 2003, Xue et al. 2011
Xgwm149-R CTAGCATCGAACCTGAACAAG
Fhb5 Xgwm304-F AGGAAACAGAAATATCGCGG 68 2.0 5A Xue et al. 2011
Xgwm304-R AGGACTGTGGGGAATGAATG
Xwmc705-F GGTTGGGCTCCTGTCTGTGAA 68 2.0 5A McCartney et al. 2004
Xwmc705-R TCTTGCACCTTCCCATGCTCT
Xgwm156-F CCAACCGTGCTATTAGTCATTC 68 2.0 5A Jing et al. 2007
Xgwm156-R CAATGCAGGCCCTCCTAAC

zAT; annealing temperature.

Table 3
Results of Fusarium head blight resistance genetic evaluation in 44 domestic wheat cultivars.
Table 3
No. Cultivar Type Ⅰ Type Ⅱ


Fhb4 Fhb5 Fhb1 Fhb2




Xgwm349-4B Xgwm149 Xgwm304 Xwmc705 Xgwm156 TaHRC-GSM SGNH_GSP Xwmc398 Xwmc397
C1z Sumai 3 - - + + + + + + +
C2 Ning 7840 - - + - + + + + +
1 Alchan - - + - + - - - +
2 Anbaek + + + - - - - - +
3 Ariheuk + + - - - - - - -
4 Baekchal + + + - - - - - -
5 Baekjoong + + - - - - - - -
6 Baekkang - + + - - - - - -
7 Chungkye + + + + + + + + +
8 Dabun + + + + + - - - -
9 Dahong + + + + + + + + +
10 Dajoong + + + + + - - - -
11 Eunpa - + + + + + + - -
12 Geuru + + + - - - - - -
13 Gobun + - + + + + + + -
14 Goso + + + + + - - - -
15 Hanbaek - + - - - - - - -
16 Hojoong - + + + + - - - -
17 Hwanggeumal - + + - - - - - -
18 Jeokjoong + + - - - - - - -
19 Jinpoom - + + + + + + - -
20 Joa - - - - + + + - -
21 Joeun - + - - - + + - -
22 Johan - + + - + - - - -
23 Jojoong - + - - + - - - -
24 Jokyung - + + - - - - - -
25 Jonong + + + - + - - - -
26 Jopoom + + + + + - - - -
27 Joongmo2008 - + - - + + + - -
28 Keumkang - + + - - - - - -
29 Milsung + + - - + + + - -
30 Namhae - + + + + + + + +
31 Ol - + + + + + + + +
32 Olgeuru + + + + + - - - -
33 Saekeumkang + + + + + - - - -
34 Saeol + + + + + + + - -
35 Seodun + + + + + + + - -
36 Sinmichal + + + + + - - - -
37 Sinmichal1 + - + - + - - + +
38 Suan + + + - - - - + -
39 Sukang + + - - + + + - -
40 Taejoong + - - - - - - - -
41 Tapdong + - - - + - - + -
42 Uri + - + + + - - - +
43 Younbaek + + - - - - - - -
44 Wooju - + + - + - - - -

Cz: control; (+), presence of Fhb gene in wheat cultivars; (-), absence of Fhb gene in wheat cultivars; C, control.

Table 4
Fusarium head blight infection rates over three years (2019-2021) for domestic wheat cultivars.
Table 4
No. Cultivar Infection rating (%)

2019 2020 2021 average




average max average max average max average max
C1z Sumai 3 1 10 21 40 9 40 10.3 30.0
C2 Ning 7840 0 0 34 60 31 40 21.3 33.3
1 Alchan 8 20 52 100 10 20 23.3 46.7
2 Anbaek 4 10 67 90 0 0 23.7 33.3
3 Ariheuk - - 50 90 2 10 2.0 50.0
4 Baekchal 5 10 8 20 0 0 4.3 10.0
5 Baekjoong 79 100 18 80 1 10 32.7 63.3
6 Baekkang 6 10 35 50 4 10 15.0 23.3
7 Chungkye 11 20 96 100 9 20 38.7 46.7
8 Dabun 10 30 22 70 14 20 15.3 40.0
9 Dahong 2 10 100 100 5 20 35.7 40.0
10 Dajoong 15 50 51 90 0 0 22.0 46.7
11 Eunpa 5 20 60 100 23 40 29.3 53.3
12 Geuru 7 20 25 70 6 20 12.7 36.7
13 Gobun 3 10 62 100 9 10 24.7 40.0
14 Goso 97 100 22 60 0 10 39.7 56.7
15 Hanbaek 12 30 48 80 3 10 21.0 40.0
16 Hojoong 30 90 6 50 0 0 12.0 46.7
17 Hwanggeumal - - 52 70 0 0 26.0 35.0
18 Jeokjoong 12 30 30 60 3 10 15.0 33.3
19 Jinpoom 5 10 93 100 8 20 35.3 43.3
20 Joa 7 20 100 90 2 10 36.3 40.0
21 Joeun 60 100 87 100 10 20 52.3 73.3
22 Johan 67 100 19 60 3 10 29.7 56.7
23 Jojoong 46 90 17 40 10 20 24.3 50.0
24 Jokyung 49 100 69 90 4 10 40.7 66.7
25 Jonong 90 100 57 80 8 10 67.3 63.3
26 Jopoom 66 80 100 100 0 10 55.3 63.3
27 Joongmo2008 - - - - - - - -
28 Keumkang 98 100 51 100 0 10 49.7 70.0
29 Milsung 1 10 18 40 2 10 7.0 20.0
30 Namhae 7 20 27 70 11 20 15.0 36.7
31 Ol 7 30 18 50 13 20 12.7 33.3
32 Olgeuru 8 20 44 70 1 10 17.7 33.3
33 Saekeumkang 6 10 56 100 1 10 21.0 31.4
34 Saeol 81 100 13 30 2 10 32.0 46.7
35 Seodun 5 20 15 30 10 30 10.0 26.7
36 Sinmichal 2 10 52 80 2 10 18.7 33.3
37 Sinmichal1 17 40 82 90 2 10 33.7 46.7
38 Suan 7 10 61 90 0 10 22.7 36.7
39 Sukang 8 10 68 80 4 10 26.7 33.3
40 Taejoong 19 40 12 20 11 20 14.0 26.7
41 Tapdong 9 10 29 80 18 50 18.7 46.7
42 Uri 10 20 55 90 1 20 22.0 43.3
43 Younbaek 98 100 65 100 2 10 55.0 70.0
44 Wooju - - - - 6 20 6.0 20.0
Average 27.0 42.8 47.9 74.8 5.1 14.4 26.7 43.9

zC: control.

Table 5
Evaluation of heading and flowering stages over three years (2019-2021) for 44 domestic wheat varieties.
Table 5
No. Cultivar 2019 2020 2021



Heading date Flowing time Heading date Flowing time Heading date Flowing time
C1z Sumai 3 5/2 5/6 4/29 5/2 4/25 4/30
C2 Ning 7840 5/11 5/13 5/6 5/11 4/28 5/6
1 Alchan 4/26 5/4 4/18 4/29 4/20 4/26
2 Anbaek 4/25 5/4 4/17 4/29 4/17 4/23
3 Ariheuk - - - - 4/20 4/26
4 Baekchal 4/24 5/2 4/17 4/27 4/13 4/21
5 Baekjoong 4/23 5/2 4/16 4/27 4/15 4/23
6 Baekkang 4/23 5/2 4/17 4/27 4/14 4/21
7 Chungkye 4/26 1/10 4/18 4/29 4/20 4/26
8 Dabun 4/24 5/2 4/14 4/27 4/12 4/21
9 Dahong 4/28 5/6 4/20 5/2 4/21 4/26
10 Dajoong 4/24 5/4 4/17 4/29 4/16 4/23
11 Eunpa 4/26 5/4 4/20 4/29 4/19 4/26
12 Geuru 4/24 5/4 4/20 5/2 4/19 4/26
13 Gobun 4/25 5/4 4/20 4/29 4/18 4/26
14 Goso 4/22 5/2 4/16 4/27 4/13 4/23
15 Hanbaek 4/24 5/4 4/17 4/29 4/13 4/23
16 Hojoong 4/24 4/30 4/17 4/27 4/19 4/23
17 Hwanggeumal - - 4/17 4/27 4/16 4/23
18 Jeokjoong 4/23 5/2 4/16 4/27 4/15 4/23
19 Jinpoom 4/26 5/4 4/18 4/27 4/19 4/26
20 Joa 4/26 5/4 4/14 4/25 4/13 4/23
21 Joeun 4/21 4/30 4/12 4/27 4/10 4/21
22 Johan 4/22 4/30 4/14 4/25 4/10 4/21
23 Jojoong 4/22 4/30 4/14 4/25 4/12 4/21
24 Jokyung 4/22 5/2 4/17 4/27 4/15 4/23
25 Jonong 4/21 4/30 4/15 4/27 4/9 4/21
26 Jopoom 4/21 5/30 4/10 4/22 4/7 4/19
27 Joongmo2008 - - - - - -
28 Keumkang 4/22 5/2 4/15 4/27 4/12 4/21
29 Milsung 4/25 5/4 4/18 4/29 4/16 4/23
30 Namhae 4/25 5/4 4/17 4/29 4/17 4/26
31 Ol 4/28 5/6 4/20 5/2 4/21 4/26
32 Olgeuru 4/25 5/4 4/17 4/27 4/14 4/23
33 Saekeumkang 4/25 5/4 4/17 4/27 4/18 4/23
34 Saeol 4/22 5/2 4/12 4/25 4/10 4/21
35 Seodun 4/28 5/4 4/18 4/29 4/20 4/26
36 Sinmichal 4/28 5/4 4/20 4/29 4/20 4/26
37 Sinmichal1 4/25 5/4 4/18 4/29 4/19 4/26
38 Suan 4/23 5/4 4/16 4/27 4/15 4/23
39 Sukang 4/24 5/2 4/18 4/29 4/19 4/26
40 Taejoong 5/5 5/11 4/27 5/2 4/23 4/28
41 Tapdong 4/24 5/4 4/18 4/29 4/18 4/26
42 Uri 4/28 5/4 4/19 4/29 4/18 4/23
43 Younbaek 4/22 5/2 4/16 4/27 4/14 4/23
44 Wooju - - - - 4/20 4/26

zC, control.

Table 6
Infection rates of Fusarium head blight of 40 domestic wheat cultivars and Sumai 3 according to allelic compositions of markers in 2019.
Table 6
Resistance type Gene Marker Allele Infection (%) Explained variation (%)
Type Ⅰ Fhb4 Xgwm349-4B 0.04
az 25.85
by 25.50
Xgwm149 1.84
a 28.63
b 16.4
Fhb5 Xgwm156 3.23
a 21.52
b 35.08
Xgwm304 0.56
a 25.00
b 27.73
Xwmc705 5.26
a 18.00
b 33.43
Type Ⅱ Fhb1 TaHRC-GSM 7.25
a 13.53
b 32.48
Fhb2 Xwmc398 10.37***
a 6.40
b 31.75
Xwmc397 8.92***
a 6.70
b 31.66

za, resistance allele; yb, susceptible allele; Asterisks indicate significant differences at p≤0.001.

  • 1. Anderson JA, Stack RW, Liu S, Waldron BL, Fjeld AD, Coyne C, Moreno-Sevilla B, Fetch JM, Song QJ, Cregan PB, Frohberg RC. 2001. DNA markers for fusarium head blight resistance QTLs in two wheat populations. Theor Appl Genet 102: 1164-1168.
  • 2. Azimi N, Sofalian O, Davari M, Asghari A, Zare N. 2020. Statistical and machine learning-based FHB detection in durum wheat. Plant Breed Biotech 8: 265-280.
  • 3. Baek SG, Park JJ, Kim S, Lee MJ, Paek JS, Choi J, Jang JY, Kim J, Lee Y. 2022. Evaluation of barley and wheat germplasm for resistance to head blight and mycotoxin production by Fusarium asiaticum and F. graminearum. The Plant Pathology Journal 38: 637-645.
  • 4. Bai G, Guo P, Kolb FL. 2003. Genetic relationships among head blight resistant cultivars of wheat assessed on the basis of molecular markers. Crop Sci 43: 498-507.
  • 5. Bai G, Shaner G. 2004. Management and resistance in wheat and barley to fusarium head blight. Annu Rev Phytopathol 42: 135-161.
  • 6. Buerstmayr H, Ban T, Anderson JA. 2009. QTL mapping and marker-assisted selection for Fusarium head blight resistance in wheat: A review. Plant Breed 128: 1-26.
  • 7. Buerstmayr H, Lemmens M, Hartl L, Doldi L, Steiner B, Stierschneider M, Ruckenbauer P. 2002. Molecular mapping of QTLs for Fusarium head blight resistance in spring wheat. I. Resistance to fungal spread (Type II resistance). Theor Appl Genet 104: 84-91.
  • 8. Buerstmayr M, Buerstmayr H. 2016. The semidwarfing alleles Rht-D1b and Rht-B1b show marked differences in their associations with anther-retention in wheat heads and with Fusarium head blight susceptibility. Phytopathology 106: 1544-1552.
  • 9. Buerstmayr M, Steiner B, Buerstmayr H. 2020. Breeding for Fusarium head blight resistance in wheat-progress and challenges. Plant Breed 139: 429-454.
  • 10. Buerstmayr M, Steiner B, Wagner C, Schwarz P, Brugger K, Barabaschi D, Volante A, Valè G, Cattivelli L, Buerstmayr H. 2018. High-resolution mapping of the pericentromeric region on wheat chromosome arm 5AS harbouring the Fusarium head blight resistance QTL Qfhs.ifa-5A. Plant Biotechnol J 16: 1046-1056.
  • 11. Bushnell WR, Hazen BE, Pritsch C. Leonard KJ, Bushnell WR, 2003. editors. Histology and physiology of Fusarium head blight. . Fusarium Head Blight of Wheat and Barley. APS Press, St. Paul, MN, USA. pp. 44-83.
  • 12. Cuthbert PA, Somers DJ, Brulé-Babel A. 2007. Mapping of Fhb2 on chromosome 6BS: A gene controlling Fusarium head blight field resistance in bread wheat (Triticum aestivum L.). Theor Appl Genet 114: 429-437.
  • 13. Dai X, Huang Y, Xue X, Yu S, Li T, Liu H, Yang L, Zhou Y, Li H, Zhang H. 2022. Effects of Fhb1, Fhb2 and Fhb5 on Fusarium head blight resistance and the development of promising lines in winter wheat. Int J of Mol Sci 2): 15047..
  • 14. Dill-Macky R, Jones RK. 2000. The effect of previous crop residues and tillage on Fusarium head blight of wheat. Plant Dis 84: 71-76.
  • 15. Faris JD, Gill BS. 2002. Genomic targeting and high-resolution mapping of the domestication gene Q in wheat. Genome 45: 706-718.
  • 16. Ghimire B, Sapkota S, Bahri BA, Martinez-Espinoza AD, Buck JW, Mergoum M. 2020. Fusarium head blight and rust diseases in soft red winter wheat in the southeast United States: State of the art, challenges and future perspective for breeding. Front Plant Sci 11: 1080
  • 17. Gilsinger J, Kong L, Shen X, Ohm H. 2005. DNA markers associated with low Fusarium head blight incidence and narrow flower opening in wheat. Theoretical and Applied Genetics 110: 1218-1225.
  • 18. Gorash A, Armoniene R, Kazan K. 2021. Can effectoromics and loss-of-susceptibility be exploited for improving Fusarium head blight resistance in wheat? Crop J 9: 1-16.
  • 19. Hao Y, Rasheed A, Zhu Z, Wulff BBH, He Z. 2020. Harnessing wheat Fhb1 for Fusarium resistance. Trends Plant Sci 25: 1-3.
  • 20. He XY, Singh PK, Dreisigacker S, Singh S, Lillemo M, Duveiller E. 2016. Dwarfing genes Rht-B1b and Rht-D1b are associated with both Type I FHB susceptibility and low anther extrusion in two bread wheat populations. PLoS One 11: e0162499.
  • 21. Islam MS, Brown-Guedira G, Van Sanford D, Ohm H, Dong YH, McKendry AL. 2016. Novel QTL associated with the Fusarium head blight resistance in Truman soft red winter wheat. Euphytica 207: 571-592.
  • 22. Jia HY, Zhou JY, Xue SL, Li GQ, Yan HS, Ran CF, Zhang YD, Shi JX, Jia L, Wang X, Luo J, Ma ZQ. 2018. A journey to understand wheat Fusarium head blight resistance in the Chinese wheat landrace Wangshuibai. Crop J 6: 48-59.
  • 23. Jing HC, Kornyukhin D, Kanyuka K, Orford S, Zlatska A, Mitrofanova OP, Koebner R, Hammond-Kosack K. 2007. Identification of variation in adaptively important traits and genome-wide analysis of trait-marker associations in Triticum monococcum. J Exp Bot 58: 3749-3764.
  • 24. Jung Y, Park CS, Jeung JU, Kang CS, Lee GA, Choi YM, Lee JR, Lee MC, Kim CK, Seo YW. 2011. Phenotypic and Marker Assisted Evaluation of Korean Wheat Cultivars. Korean J Breed Sci 43: 273-281.
  • 25. Jung Y, Park CS, Jeung JU, Kim CK, Park JC, Kang CS, Seo YW. 2010. Employment of wheat grain properties in evaluation of Fusarium head blight resistance. J Crop Sci Biotechnol 13: 275-281.
  • 26. Kang CS, Cheong YK, Kim KH, Kim HS, Kim YJ, Kim KH, Park JC, Park HH, Kim HS, Kang SJ, Choi HJ, Kim JG, Kim KJ, Lee CK, Park KG, Park KH, Park CS. 2014. A white wheat variety, 'Joongmo2004' with high milling, good noodle quality and moderate resistance to fusarium head blight. Korean J Breed Sci 46: 276-283.
  • 27. Khan MK, Pandey A, Athar T, Choudhary S, Deval R, Gezgin S, Hamurcu M, Topal A, Atmaca E, Santos PA, Omay MR, Suslu H, Gulcan K, Inanc M, Akkaya MS, Kahraman A, Thomas G. 2020. Fusarium head blight in wheat: Contemporary status and molecular approaches. 3 Biotech 10: 172
  • 28. Kim KM, Kim KH, Cheong YK, Choi CH, Kim YG, Park JH, Kim KH, Jang K, Choi JK, Bae JS, Min BK, Kim SN, Han OK, Kim YJ, Kim BY, Park TI, Park CS, Kang CS. 2019. 'Taejoong' a wheat variety with good noodle quality, red grain wheat, long spike, and moderate resistance to fusarium head blight. Korean J Breed Sci 51: 454-461.
  • 29. Kim KM, Kim KH, Choi CH, Jeong HY, Park J, Yang SM, Shon J, Park TI, Kang CS. 2021. A wheat cultivar 'Baekkang' with good bread quality, white grain wheat, large kernel and moderate resistance to fusarium head blight. Korean J Breed Sci 53: 145-153.
  • 30. Lee MH, Choi C, Kim KH, Son JH, Park J, Lee GE, Choi JY, Kang CS, Shon J, Ko JM, Kim KM. 2022. Analysis of protein properties and gluten protein composition evaluation of wheat genetic resources. Korean J Breed Sci 54: 245-259.
  • 31. Lee MH, Hong S, Kim KM, Kwak SH, Choi C, Kang CC, Park CS, Mo Y, Kim KH. 2023. Research advances in wheat breeding and genetics for fusarium head blight resistance. Korean J Breed Sci 55: 195-217.
  • 32. Li G, Zhou J, Jia H, Gao Z, Fan M, Luo Y, Zhao P, Xue S, Li N, Yuan Y, Ma S, Kong Z, Jia L, An X, Jiang G, Liu W, Cao W, Zhang R, Fan J, Xu X, Liu Y, Kong Q, Zheng S, Wang Y, Qin B, Cao S, Ding Y, Shi J, Yan H, Wang X, Ran C. 2019. Mutation of a histidine-rich calcium-binding-protein gene in wheat confers resistance to Fusarium head blight. Nat Genet 51: 1109-1112.
  • 33. Li W, Deng Y, Ning Y, He Z, Wang GL. 2020. Exploiting broad-spectrum disease resistance in crops: From molecular dissection to breeding. Annu Rev Plant Biol 71: 575-603.
  • 34. Lin F, Xue SL, Zhang ZZ, Zhang CQ, Kong ZX, Yao GQ, Tian DG, Zhu HL, Li CJ, Cao Y, Wei JB, Luo QY, Ma ZQ. 2006. Mapping QTL associated with resistance to Fusarium head blight in the Nanda2419×Wangshuibai population. II: Type I resistance. Theor Appl Genet 112: 528-535.
  • 35. Liu S, Griffey CA, Hall MD, McKendry AL, Chen J, Brooks WS, Brown-Guedira G, Sanford DV, Schmale DG. 2013. Molecular characterization of field resistance to Fusarium head blight in two US soft red winter wheat cultivars. Theor Appl Genet 126: 2485-2498.
  • 36. Ma Z, Xie Q, Li G, Jia H, Zhou J, Kong Z, Li N, Yuan Y. 2020. Germplasms, genetics and genomics for better control of disastrous wheat Fusarium head blight. Theor Appl Genet 133: 1541-1568.
  • 37. McCartney CA, Somers DJ, Fedak G, Cao W. 2004. Haplotype diversity at fusarium head blight resistance QTLs in wheat. Theor Appl Genet 109: 261-271.
  • 38. Mesterhzy A. 1995. Types and components of resistance to Fusarium head blight of wheat. Plant Breed 114: 377-386.
  • 39. Miedaner T, Voss HH. 2008. Effect of dwarfing Rht genes on Fusarium head blight resistance in two sets of near-isogenic lines of wheat and check cultivars. Crop Sci 48: 2115-2122.
  • 40. Miller JD, Arnison PG. 1986. Degradation of deoxynivalenol by suspension cultures of the Fusarium head blight resistant wheat cultivar Frontana. Can J Plant Pathol 8: 147-15.
  • 41. Miller JD, Young JC, Sampson DR. 1985. Deoxynivalenol and Fusarium head blight resistance in spring cereals. J Phytopathol 113: 359-367.
  • 42. Petersen S, Lyerly JH, McKendry AL, Islam MS, Brown-Guedira G, Cowger C, Dong Y. MurphyJP2017. Validation of Fusarium head blight resistance QTL in US winter wheat. Crop Sci 57: 1-12.
  • 43. Rawat N, Pumphrey MO, Liu S, Zhang X, Tiwari VK, Ando K, Trick HN, Bockus WW, Akhunov E, Anderson JA, Gill BS. 2016. Wheat Fhb1 encodes a chimeric lectin with agglutinin domains and a pore-forming toxin-like domain conferring resistance to Fusarium head blight. Nat Genet 48: 1576-1580.
  • 44. Ryu JG, Lee SH, Lee SH, Son SW, Nam YJ, Kim MJ, Lee T, Yun JC. 2011. Natural occurrence of Fusarium head blight and its mycotoxins in 2010-harvested barley and wheat grains in Korea. Res Plant Dis 17: 272-279.
  • 45. Schroeder HW, Christensen JJ. 1963. Factors affecting resistance of wheat to scab caused by Gibberella zeae. Phytopathology 53: 831-838.
  • 46. Shin S, Kim KH, Kang CS, Cho KM, Park CS, Okagaki R, Park JC. 2014. A simple method for the assessment of Fusarium head blight resistance in Korean wheat seedlings inoculated with Fusarium graminearum. Plant Pathol J 30: 25-32.
  • 47. Shin S, Son JH, Park JC, Kim KH, Yoon YM, Cheong Y-K, Kim K-H, Hyun J-N, Park CS, Dill-Macky R, Kang CS. 2018. Comparative pathogenicity of Fusarium graminearum isolates from wheat kernels in Korea. Plant Pathol J 34: 347-355.
  • 48. Simons KJ, Fellers JP, Trick HN, Zhang Z, Tai YS, Gill BS, Faris JD. 2006. Molecular characterization of the major wheat domestication gene Q. Genetics 172: 547-555.
  • 49. Singh L, Anderson JA, Chen J, Gill BS, Tiwari VK, Rawat N. 2019. Development and validation of a perfect KASP marker for Fusarium head blight resistance gene Fhb1 in wheat. Plant Pathol J 35: 200-207.
  • 50. Somers DJ, Fedak G, Savard M. 2003. Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat. Genome 46: 555-564.
  • 51. Son JH, Kim KH, Shin S, Kim HS, Kim NS, Hyun JN, Shim SI, Lee CK, Park KG, Kang CS. 2013. ISSR-derived molecular markers for Korean wheat cultivar identification. Plant Breed Biotech 1: 262-269.
  • 52. Steiner B, Buerstmayr M, Michel S, Schweiger W, Lemmens M, Buerstmayr H. 2017. Breeding strategies and advances in line selection for Fusarium head blight resistance in wheat. Trop Plant Pathol 42: 165-174.
  • 53. Su Z, Bernardo A, Tian B , Chen H, Wang H, Ma H, Cai S, Liu D, Zhang D, Li T, Trick H , Amand PS, Yu J , Zhang Z, Bai G. 2019. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat Genet 51: 1099-1105.
  • 54. Waldron BL, Moreno-Sevilla B, Anderson JA, Stack RW, Frohberg RC. 1999. RFLP mapping of QTL for Fusarium head blight resistance in wheat. Crop Sci 39: 805-811.
  • 55. Xue S, Li G, Jia H, Xu F, Lin F, Tang M, Wang Y, An X, Xu H, Zhang L, Kong Z, Ma Z. 2010. Fine mapping Fhb4, a major QTL conditioning resistance to Fusarium infection in bread wheat (Triticum aestivum L.). Theor Appl Genet 121: 147-156.
  • 56. Xue S, Xu F, Tang M, Zhou Y, Li G, An X, Lin F, Xu H, Jia H, Zhang L, Kong L, Ma Z. 2011. Precise mapping Fhb5, a major QTL conditioning resistance to Fusarium infection in bread wheat (Triticum aestivum L.). Theor Appl Genet 123: 1055-1063.
  • 57. Yi X, Cheng J, Jiang Z, Hu W, Bie T, Gao D, Li D, Wu R, Li Y, Chen S, Cheng X, Liu Jm Zhang Y, Cheng S. 2018. Genetic analysis of Fusarium head blight resistance in CIMMYT bread wheat line C615 using traditional and conditional QTL mapping. Front Plant Sci 9: 573
  • 58. Zhou W, Kolb FL, Bai G, Shaner G, Domier LL. 2002. Genetic analysis of scab resistance QTL in wheat with microsatellite and AFLP markers. Genome 45: 719-727.
  • 59. Zhu Z, Hao Y, Mergoum M, Bai G, Humphreys G, Cloutier S, Xia X, He Z. 2019. Breeding wheat for resistance to Fusarium head blight in the Global North: China, USA, and Canada. Crop J 7: 730-738.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Assessment of Fusarium Head Blight Resistance Genes in Domestic Wheat Varieties
Korean. J. Breed. Sci.. 2024;56(3):205-223.   Published online September 1, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Assessment of Fusarium Head Blight Resistance Genes in Domestic Wheat Varieties
Korean. J. Breed. Sci.. 2024;56(3):205-223.   Published online September 1, 2024
Close

Figure

  • 0
  • 1
  • 2
  • 3
Assessment of Fusarium Head Blight Resistance Genes in Domestic Wheat Varieties
Image Image Image Image
Fig. 1 PCR analysis of Fusarium head blight Type Ⅰ resistance genes Fhb4 (A) and Fhb5 (B) in 44 domestic wheat cultivars. The variety numbers above the figure are the same as in the Table 1 and Table 3, respectively. Arrows indicate amplified DNA fragments predicted to be candidate genes. DM, DNA size marker; S3, Sumai 3.
Fig. 2 Venn diagram analysis of 44 domestic wheat cultivars harboring Fusarium head blight resistance genes. The numbers are representing the number of cultivars containing each resistance gene and the numbers in parentheses indicate the number of cultivars showing resistance across all markers for each gene in Fig. 1, Fig. 3, and Table 3.
Fig. 3 PCR analysis of Fusarium head blight Type Ⅱ resistance genes Fhb1 (A) and Fhb2 (B) in 44 domestic wheat cultivars. The variety numbers above the figure are the same as in the Table 1 and Table 3. Arrows indicate amplified DNA fragments predicted to be candidate genes. DM, DNA size marker; S3, Sumai 3.
Fig. 4 Evaluation of weather conditions and Fusarium head blight infection rate. (A) Fusarium head blight infection rates, (B, C) temperature, and (D) precipitation over three years (2019-2021). The cultivars number are the same as Table 4. C1, Sumai 3; C2, Ning 7840.
Assessment of Fusarium Head Blight Resistance Genes in Domestic Wheat Varieties

List of domestic wheat varieties and Fusarium head blight resistance cultivars used in this study.

No. Cultivar Pedigree No. Cultivar Pedigree
C1z Sumai 3 Funo/Taiwanxiaomai 22 Johan Suwon262/Joeun
C2 Ning 7840 Avrova/Anhui 11/Sumai 3 23 Jojoong Suwon272/Olgeuru//Keumkang/Suwon252
1 Alchan Suwon210/Tapdong 24 Jokyung Seri82/Keumkang
2 Anbaek Sae/Geuru 25 Jonong Suwon234/SW80199
3 Ariheuk K253305/Sinmichal 26 Jopoom Kanto75//OR8500494P/Bezostaya
4 Baekchal Sinmichal/Keumkang 27 Joongmo2008 Eunpa*2//SH3/CBRD/3/Keumkang
5 Baekjoong Keumkang/Olgeuru 28 Keumkang Geuru/Kanto75//Eunpa
6 Baekkang Topdong/Klasic 29 Milsung Shirogane//Norin43/Sonalika
7 Chungkye Norin4/Sharbatisonora 30 Namhae Ol/Calidad
8 Dabun Suwon234//sw76039/Suwon22 31 Ol Norin72/Norin12
9 Dahong Norin72/Wonkwang 32 Olgeuru Geuru/Chokwang//Saikai143
10 Dajoong SW992114-NM-131-7/Gobun 33 Saekeumkang Keumkang/Olgeuru
11 Eunpa Chugoku81/3/Tob-CNO//Yuksung3/Suwon185 34 Saeol Shirogane//Norin43/Sonalika
12 Geuru Strampelli/69D-3607//Chokwang 35 Seodun Geuru/Genaro81
13 Gobun Eunpa/Tapdong//Eunpa/Shannung6521 36 Sinmichal Olgeuru//Kanto107/BaiHuo
14 Goso Gobun/Ol 37 Sinmichal1 Alchan//Kanto107/BaiHuo
15 Hanbaek Shann7859/Keumkang//Guamuehill 38 Suan Keumkang/Eunpa//Keumkang
16 Hojoong Alchan2/3/Chunm18//JUP/BJY/4/Keumkang 39 Sukang Suwon266/Asakaze
17 Hwanggeumal Jokyung/Kauz/Rayo//Jopoom 40 Taejoong Xian83 (104).11/Keumkang
18 Jeokjoong Keumkang/Tapdong 41 Tapdong Chugoku81//Suwon158/Toropi
19 Jinpoom Geuru/Genaro81 42 Uri Geuru/Ol
20 Joa SW86054-MB-27-3-2-1-1-1/Sumai 3 43 Younbaek Keumkang/Tapdong
21 Joeun Eunpa/Suwon242 44 Wooju Jokyung/K253306

Primers used in this study for detection of Fusarium head blight resistance genes.

Gene Primer name 5'-3' ATz (℃) Agarose gel (%) Genome Reference
Fhb1 TaHRC-GSM-F ATTCCTACTAGCCGCCTGGT 68 1.2 3B Su et al. 2019
TaHRC-GSM-R ACTGGGGCAAGCAAACATTG
SGNH_GSP-F CAATTCCAGCAGTTCATCAAC 68 2.0 3B Singh et al. 2019
SGNH_GSP-R CATACCCGCAACACACAT
Fhb2 Xwmc398-F GGAGATTGACCGAGTGGAT 66 2.0 6B Cuthbert et al. 2007
Xwmc398-R CGTGAGAGCGGTTCTTTG
Xwmc397-F AGTCGTGCACCTCCATTTTG 68 2.0 6B Cuthbert et al. 2007
Xwmc397-R CATTGGACATCGGAGACCTG
Fhb4 Xgwm349-4B-F ACACACACTCGATCGCAC 66 3.0 4B Xue et al. 2010
Xgwm349-4B-R GCAGTTGATCATCAAAACACA
Xgwm149-F CATTGTTTTCTGCCTCTAGCC 68 2.0 4B Somers et al. 2003, Xue et al. 2011
Xgwm149-R CTAGCATCGAACCTGAACAAG
Fhb5 Xgwm304-F AGGAAACAGAAATATCGCGG 68 2.0 5A Xue et al. 2011
Xgwm304-R AGGACTGTGGGGAATGAATG
Xwmc705-F GGTTGGGCTCCTGTCTGTGAA 68 2.0 5A McCartney et al. 2004
Xwmc705-R TCTTGCACCTTCCCATGCTCT
Xgwm156-F CCAACCGTGCTATTAGTCATTC 68 2.0 5A Jing et al. 2007
Xgwm156-R CAATGCAGGCCCTCCTAAC

Results of Fusarium head blight resistance genetic evaluation in 44 domestic wheat cultivars.

No. Cultivar Type Ⅰ Type Ⅱ


Fhb4 Fhb5 Fhb1 Fhb2




Xgwm349-4B Xgwm149 Xgwm304 Xwmc705 Xgwm156 TaHRC-GSM SGNH_GSP Xwmc398 Xwmc397
C1z Sumai 3 - - + + + + + + +
C2 Ning 7840 - - + - + + + + +
1 Alchan - - + - + - - - +
2 Anbaek + + + - - - - - +
3 Ariheuk + + - - - - - - -
4 Baekchal + + + - - - - - -
5 Baekjoong + + - - - - - - -
6 Baekkang - + + - - - - - -
7 Chungkye + + + + + + + + +
8 Dabun + + + + + - - - -
9 Dahong + + + + + + + + +
10 Dajoong + + + + + - - - -
11 Eunpa - + + + + + + - -
12 Geuru + + + - - - - - -
13 Gobun + - + + + + + + -
14 Goso + + + + + - - - -
15 Hanbaek - + - - - - - - -
16 Hojoong - + + + + - - - -
17 Hwanggeumal - + + - - - - - -
18 Jeokjoong + + - - - - - - -
19 Jinpoom - + + + + + + - -
20 Joa - - - - + + + - -
21 Joeun - + - - - + + - -
22 Johan - + + - + - - - -
23 Jojoong - + - - + - - - -
24 Jokyung - + + - - - - - -
25 Jonong + + + - + - - - -
26 Jopoom + + + + + - - - -
27 Joongmo2008 - + - - + + + - -
28 Keumkang - + + - - - - - -
29 Milsung + + - - + + + - -
30 Namhae - + + + + + + + +
31 Ol - + + + + + + + +
32 Olgeuru + + + + + - - - -
33 Saekeumkang + + + + + - - - -
34 Saeol + + + + + + + - -
35 Seodun + + + + + + + - -
36 Sinmichal + + + + + - - - -
37 Sinmichal1 + - + - + - - + +
38 Suan + + + - - - - + -
39 Sukang + + - - + + + - -
40 Taejoong + - - - - - - - -
41 Tapdong + - - - + - - + -
42 Uri + - + + + - - - +
43 Younbaek + + - - - - - - -
44 Wooju - + + - + - - - -

Fusarium head blight infection rates over three years (2019-2021) for domestic wheat cultivars.

No. Cultivar Infection rating (%)

2019 2020 2021 average




average max average max average max average max
C1z Sumai 3 1 10 21 40 9 40 10.3 30.0
C2 Ning 7840 0 0 34 60 31 40 21.3 33.3
1 Alchan 8 20 52 100 10 20 23.3 46.7
2 Anbaek 4 10 67 90 0 0 23.7 33.3
3 Ariheuk - - 50 90 2 10 2.0 50.0
4 Baekchal 5 10 8 20 0 0 4.3 10.0
5 Baekjoong 79 100 18 80 1 10 32.7 63.3
6 Baekkang 6 10 35 50 4 10 15.0 23.3
7 Chungkye 11 20 96 100 9 20 38.7 46.7
8 Dabun 10 30 22 70 14 20 15.3 40.0
9 Dahong 2 10 100 100 5 20 35.7 40.0
10 Dajoong 15 50 51 90 0 0 22.0 46.7
11 Eunpa 5 20 60 100 23 40 29.3 53.3
12 Geuru 7 20 25 70 6 20 12.7 36.7
13 Gobun 3 10 62 100 9 10 24.7 40.0
14 Goso 97 100 22 60 0 10 39.7 56.7
15 Hanbaek 12 30 48 80 3 10 21.0 40.0
16 Hojoong 30 90 6 50 0 0 12.0 46.7
17 Hwanggeumal - - 52 70 0 0 26.0 35.0
18 Jeokjoong 12 30 30 60 3 10 15.0 33.3
19 Jinpoom 5 10 93 100 8 20 35.3 43.3
20 Joa 7 20 100 90 2 10 36.3 40.0
21 Joeun 60 100 87 100 10 20 52.3 73.3
22 Johan 67 100 19 60 3 10 29.7 56.7
23 Jojoong 46 90 17 40 10 20 24.3 50.0
24 Jokyung 49 100 69 90 4 10 40.7 66.7
25 Jonong 90 100 57 80 8 10 67.3 63.3
26 Jopoom 66 80 100 100 0 10 55.3 63.3
27 Joongmo2008 - - - - - - - -
28 Keumkang 98 100 51 100 0 10 49.7 70.0
29 Milsung 1 10 18 40 2 10 7.0 20.0
30 Namhae 7 20 27 70 11 20 15.0 36.7
31 Ol 7 30 18 50 13 20 12.7 33.3
32 Olgeuru 8 20 44 70 1 10 17.7 33.3
33 Saekeumkang 6 10 56 100 1 10 21.0 31.4
34 Saeol 81 100 13 30 2 10 32.0 46.7
35 Seodun 5 20 15 30 10 30 10.0 26.7
36 Sinmichal 2 10 52 80 2 10 18.7 33.3
37 Sinmichal1 17 40 82 90 2 10 33.7 46.7
38 Suan 7 10 61 90 0 10 22.7 36.7
39 Sukang 8 10 68 80 4 10 26.7 33.3
40 Taejoong 19 40 12 20 11 20 14.0 26.7
41 Tapdong 9 10 29 80 18 50 18.7 46.7
42 Uri 10 20 55 90 1 20 22.0 43.3
43 Younbaek 98 100 65 100 2 10 55.0 70.0
44 Wooju - - - - 6 20 6.0 20.0
Average 27.0 42.8 47.9 74.8 5.1 14.4 26.7 43.9

Evaluation of heading and flowering stages over three years (2019-2021) for 44 domestic wheat varieties.

No. Cultivar 2019 2020 2021



Heading date Flowing time Heading date Flowing time Heading date Flowing time
C1z Sumai 3 5/2 5/6 4/29 5/2 4/25 4/30
C2 Ning 7840 5/11 5/13 5/6 5/11 4/28 5/6
1 Alchan 4/26 5/4 4/18 4/29 4/20 4/26
2 Anbaek 4/25 5/4 4/17 4/29 4/17 4/23
3 Ariheuk - - - - 4/20 4/26
4 Baekchal 4/24 5/2 4/17 4/27 4/13 4/21
5 Baekjoong 4/23 5/2 4/16 4/27 4/15 4/23
6 Baekkang 4/23 5/2 4/17 4/27 4/14 4/21
7 Chungkye 4/26 1/10 4/18 4/29 4/20 4/26
8 Dabun 4/24 5/2 4/14 4/27 4/12 4/21
9 Dahong 4/28 5/6 4/20 5/2 4/21 4/26
10 Dajoong 4/24 5/4 4/17 4/29 4/16 4/23
11 Eunpa 4/26 5/4 4/20 4/29 4/19 4/26
12 Geuru 4/24 5/4 4/20 5/2 4/19 4/26
13 Gobun 4/25 5/4 4/20 4/29 4/18 4/26
14 Goso 4/22 5/2 4/16 4/27 4/13 4/23
15 Hanbaek 4/24 5/4 4/17 4/29 4/13 4/23
16 Hojoong 4/24 4/30 4/17 4/27 4/19 4/23
17 Hwanggeumal - - 4/17 4/27 4/16 4/23
18 Jeokjoong 4/23 5/2 4/16 4/27 4/15 4/23
19 Jinpoom 4/26 5/4 4/18 4/27 4/19 4/26
20 Joa 4/26 5/4 4/14 4/25 4/13 4/23
21 Joeun 4/21 4/30 4/12 4/27 4/10 4/21
22 Johan 4/22 4/30 4/14 4/25 4/10 4/21
23 Jojoong 4/22 4/30 4/14 4/25 4/12 4/21
24 Jokyung 4/22 5/2 4/17 4/27 4/15 4/23
25 Jonong 4/21 4/30 4/15 4/27 4/9 4/21
26 Jopoom 4/21 5/30 4/10 4/22 4/7 4/19
27 Joongmo2008 - - - - - -
28 Keumkang 4/22 5/2 4/15 4/27 4/12 4/21
29 Milsung 4/25 5/4 4/18 4/29 4/16 4/23
30 Namhae 4/25 5/4 4/17 4/29 4/17 4/26
31 Ol 4/28 5/6 4/20 5/2 4/21 4/26
32 Olgeuru 4/25 5/4 4/17 4/27 4/14 4/23
33 Saekeumkang 4/25 5/4 4/17 4/27 4/18 4/23
34 Saeol 4/22 5/2 4/12 4/25 4/10 4/21
35 Seodun 4/28 5/4 4/18 4/29 4/20 4/26
36 Sinmichal 4/28 5/4 4/20 4/29 4/20 4/26
37 Sinmichal1 4/25 5/4 4/18 4/29 4/19 4/26
38 Suan 4/23 5/4 4/16 4/27 4/15 4/23
39 Sukang 4/24 5/2 4/18 4/29 4/19 4/26
40 Taejoong 5/5 5/11 4/27 5/2 4/23 4/28
41 Tapdong 4/24 5/4 4/18 4/29 4/18 4/26
42 Uri 4/28 5/4 4/19 4/29 4/18 4/23
43 Younbaek 4/22 5/2 4/16 4/27 4/14 4/23
44 Wooju - - - - 4/20 4/26

Infection rates of Fusarium head blight of 40 domestic wheat cultivars and Sumai 3 according to allelic compositions of markers in 2019.

Resistance type Gene Marker Allele Infection (%) Explained variation (%)
Type Ⅰ Fhb4 Xgwm349-4B 0.04
az 25.85
by 25.50
Xgwm149 1.84
a 28.63
b 16.4
Fhb5 Xgwm156 3.23
a 21.52
b 35.08
Xgwm304 0.56
a 25.00
b 27.73
Xwmc705 5.26
a 18.00
b 33.43
Type Ⅱ Fhb1 TaHRC-GSM 7.25
a 13.53
b 32.48
Fhb2 Xwmc398 10.37***
a 6.40
b 31.75
Xwmc397 8.92***
a 6.70
b 31.66
Table 1 List of domestic wheat varieties and Fusarium head blight resistance cultivars used in this study.

zC: control

Table 2 Primers used in this study for detection of Fusarium head blight resistance genes.

zAT; annealing temperature.

Table 3 Results of Fusarium head blight resistance genetic evaluation in 44 domestic wheat cultivars.

Cz: control; (+), presence of Fhb gene in wheat cultivars; (-), absence of Fhb gene in wheat cultivars; C, control.

Table 4 Fusarium head blight infection rates over three years (2019-2021) for domestic wheat cultivars.

zC: control.

Table 5 Evaluation of heading and flowering stages over three years (2019-2021) for 44 domestic wheat varieties.

zC, control.

Table 6 Infection rates of Fusarium head blight of 40 domestic wheat cultivars and Sumai 3 according to allelic compositions of markers in 2019.

za, resistance allele; yb, susceptible allele; Asterisks indicate significant differences at p≤0.001.