Skip to main navigation Skip to main content

Korean. J. Breed. Sci. : Korean Journal of Breeding Science

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Article

벼멸구 저항성 유전자 도입에 따른 벼 후대계통의 수량관련형질의 연관 분석

박재령, 서정환, 이창민, 박송희, 진민아, 이건미, 정오영, 서정필, 박현수*

Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes

Korean Journal of Breeding Science 2024;56(4):381-394.
Published online: December 1, 2024

농촌진흥청 국립식량과학원 작물육종과

Crop Breeding Division, National Institute of Crop Science, Rural Development Administration, Wanju 55365, Republic of Korea

*Corresponding to Hyun-Su ParkTEL. +82-63-238-5214E-mail. mayoe@korea.kr
• Received: July 9, 2024   • Revised: October 11, 2024   • Accepted: October 18, 2024

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 221 Views
  • 3 Download
next
  • Rapid climate change has diversified the dynamics of brown planthoppers, necessitating the development of rice cultivars with enhanced resistance. Brown planthoppers contribute to reduced grain yield and quality, and the rapid ecological changes caused by global warming are expected to exacerbate this damage. In Korea, rice cultivars resistant to brown planthoppers have primarily been bred using Bph1, bph2, and Bph18. Despite the known resistance of Bph3 to brown planthoppers, this gene is underutilized in rice breeding programs. Therefore, in this study, we aimed to analyze the association between brown planthopper resistant genes and rice agronomic traits by breeding segregated populations incorporating Bph3, Bph18, and BPH26. Segregated populations were derived from crosses between ‘Jeonju686’ (carrying Bph3 and BPH26) and ‘JJ621MR’ (carrying Bph18). Our analysis revealed that Bph18 was significantly associated with a reduced fertility rate. However, Bph3 did not significantly affect fertility-related traits. As Bph3 has been reported to confer strong resistance to brown planthoppers, it is expected to be actively utilized in future resistance breeding programs. Ultimately, maximizing the efficiency of molecular breeding techniques is expected to provide valuable insights into the development of rice cultivars with enhanced resistance to brown planthoppers.
벼멸구 저항성 품종을 육성하기 위해서는 저항성 유전자를 도입하는 것이 중요한데 대부분 인디카나 야생 벼에 벼멸구에 대한 저항성원이 분포하고 있다(Hussain et al. 2020, Jena & Kim 2010). 따라서 우리나라의 주된 육성 품종인 자포니카에 저항성 유전자를 도입할 경우 원연교잡을 통한 육종을 해야 하며(Iamba & Dono 2021), 이러한 과정에서 벼멸구 저항성 유전자와 밀접하게 연관되어 있는 열악형질의 도입이 문제 되고 있다(Kim et al. 2017, Lee et al. 2021). 현재 보고되어있는 벼멸구 저항성 유전자는 벼 염색체 모두에 골고루 분포하고 있다. 벼멸구 저항성 유전자로 알려져 있는 Bph13은 2번 염색체에 위치하고 있으며(Rahman et al. 2009), bph11, Bph14, bph19는 3번 염색체, Bph3, bph12, Bph12, Bph15, bph20은 4번 염색체, bph4, Bph25는 6번 염색체, Bph6은 11번 염색체(Jena et al. 2003), Bph1, bph2, Bph9, Bph10, Bph18, Bph21, BPH26은 12번 염색체에 위치하고 있다(Jena et al. 2006, Qiu et al. 2010).
현재 우리나라에서 벼멸구 저항성을 향상시켜 육성된 품종 중에는 bph2를 보유한 화청, 하남, 다청, 친농과 Bph18을 보유하고 있는 안미가 있으며 현재 모두 23개의 벼멸구 저항성 벼 품종이 육성되어 있다(Kim et al. 2013). 우리나라에서 육성된 자포니카 유전자원은 유전배경이 매우 협소하고 유전적 구성이 비슷하기 때문에 생물학적 스트레스에 대한 저항성 유전자를 도입하는 것이 매우 제한적이다(Cheon et al. 2018). 이러한 단점을 극복하기 위해 인디카 유전자원을 활용하여 저항성 및 유용유전자를 자포니카로 도입하고 있지만, 높은 불임률, 초형 불량과 같은 열악 형질을 수반하여 육종적으로 이용하는데 어려움이 따른다(Lee et al. 2021, Muduli et al. 2021). 현재 우리나라에서는 Bph1, Bph2, Bph18, BPH26이 주로 벼멸구 저항성 품종 육성을 위해 활용되고 있다(Kim et al. 2013,Ji et al. 2018). 벼멸구 저항성 유전자 Bph18은 야생벼인 O. australiensis로부터 인디카 계통으로 도입되었으며, 이후 자포니카 배경인 주남에 도입되기 위해 MAS (Marker Assisted Selection)와 전체 게놈 시퀀싱(Whole genome sequencing) 기술이 적용되었다(Ji et al. 2016). 하지만 Bph18은 12번 염색체의 장완 부분에 위치하여 교잡불임과 관련된 대립유전자와 연관되어 있다(Suh et al. 2011). 이전에 IR24와 Asominori를 교잡하였을 때 불임 관련 대립유전자 has1-IR이 보고되었으며(Kubo & Yoshimura 2005), 이 부근에서 교잡불임 관련 유전자 hsY(t)도 보고되어 있다(Yara et al. 2010). 또한 약배양을 통해 Bph18을 도입하는 과정에서 Bph18이 도입된 계통은 그렇지 않은 계통들에 비해 불임 문제가 심각하게 발생하였다고 보고되어 있다(Park et al. 2014). 또한 여교배를 통해 반복친의 유전배경을 회복하더라도 Bph18이 도입된 계통에서는 전체 게놈 배경 분석을 실시 하였을 때 세대 진전과 관계 없이 1, 2, 10, 11, 12번의 염색체에서 Bph18 수여친의 염색체 절편이 남아 있음이 보고되었으며, 이는 불임을 유발하는 것으로 알려져 있다(Shin et al. 2011). Bph18이 위치하고 있는 12번 염색체의 장완 부분에는 Bph1, bph2, Bph9, Bph10, Bph21, BPH26이 위치하고 있는데, 이들은 각각 도복 및 불임과 관련된 유전자와 밀접하게 연관되어 있어 이들 유전자가 도입된 품종들은 도복이 심하다(Qiu et al. 2010). 현재 동남아시아를 중심으로 육성되는 벼멸구 저항성 품종들은 Bph1, bph2, Bph3가 활용 되고 있으며, Bph1bph2 유전자를 보유하고 있는 품종 보다 Bph3 유전자를 보유한 품종이 벼멸구 저항성이 더 크다고 보고 되어 있다(Jena & Kim 2010). 하지만 현재까지 우리나라에서는 가야벼를 제외하고 Bph3를 활용한 저항성 품종은 육성 되어 있지 않다.
현재 우리나라에서 육성된 벼멸구 저항성 벼 품종들은 대부분 열악형질을 수반하고 있다. 하지만 벼멸구 저항성 유전자 Bph3는 벼멸구에 대한 저항성은 강하다고 보고되어 있지만 이를 활용한 저항성 벼 품종은 가야벼 이외에는 육성되지 않았으며, 유전자가 도입되었을 때의 열악형질 수반 및 수량관련 요소들이 조사되지 않았다. 따라서 본 연구는 Bph3BPH26을 보유한 전주686호와 Bph18을 보유하고 있는 JJ621MR을 교배하여 육성된 F2 식물체를 활용하여 저항성 유전자 집적에 따른 농업형질의 변화에 대하여 분석 하였다. 본 연구의 결과는 앞으로 우리나라 벼멸구 저항성 벼 품종 육성에 Bph3를 활용하여 협소한 벼멸구 저항성 벼 품종의 다양화에 기여하고자 수행되었다.
시험재료 및 재배방법
벼멸구 저항성 유전자인 Bph3, Bph18, BPH26과 벼 수량 관련 형질들간의 관계를 분석하기 위해 Bph3BPH26을 보유하고 있는 전주686호를 자방친으로 하고 Bph18을 보유하고 있는 JJ621MR을 화분친으로 하여 인공교배하여 F1을 수확하였다. F1 식물체는 온실에서 재배하였으며, F2 집단은 2023년 하계에 농촌진흥청 국립식량과학원의 벼 시험 포장(위도 35.84064, 경도 127.0453, 해발 20 m)에서 재식거리 30×15 cm로 주당 1본씩 이앙 후 재배하였다. 시험 재료들은 모두 2023년 4월 20일에 파종 하였으며, 5월 20일에 보통기로 손이앙 하였다. 재배기간동안 포장 시비량은 9.0-4.5-5.7 (N-P2O5-K2O) kg/10a로 하였다. 질소는 기비와 분얼비, 수비를 각각 50:20:30의 비율로 분시 하였다. 인산은 전량 기비로 하였으며, 칼륨은 기비와 수비를 70:30의 비율로 분시 하였다. 그리고 기타 재배 관리는 농촌진흥청에서 제시하는 표준 재배법을 준수하였다.
벼멸구 저항성 유전자 확인
시험재료들의 벼멸구 저항성 유전자 도입 및 유전자 종류 확인을 위한 Genomic DNA 추출은 BioSprint 96 (Qiagen, Cat. 940057, Hilden, Germany)을 이용하였으며, 제공된 사용지침을 준수하였다. 시험재료의 잎을 샘플링하여 TissueLyserⅡ (Qiagen, Cat. 85300, Hilden, Germany)로 마쇄하였으며, BioSprint 96 DNA Plant Kit (INDICAL BIOSCIENCE, Cat. SP947057, Leipzig, Germany)의 사용지침을 준수하면서 DNA를 추출 하였다. 전주686호와 JJ621MR의 교배로 얻어진 F2 식물체에서 벼멸구 저항성 유전자 Bph3, Bph18, BPH26을 확인하기 위해 목표 유전자와 밀접하게 연관되어 있는 DNA 분자 마커인 BPH3IND (Ji et al. 2018), 7312.T4A (Suh et al. 2014), BPH26IND (Ji et al. 2018)을 각각 이용하였다(Table 1). 유전자 증폭을 위해 10 ng의 Template DNA와 AccuPower® PCR PreMix (Bioneer Co., Korea)를 이용하여 My-Genie 96 Thermal block (Bioneer Co., Korea)으로 PCR을 수행 하였다. 유전자 증폭을 위한 PCR 반응은 사용된 프라이머의 종류에 따라 다르게 적용 되었다. BPH3INDBPH26IND는 94℃에서 3분간 초기변성 하였으며 이후 95℃에서 40초, 60℃에서 40초, 72℃에서 10초간 총 40회 반복 하였으며, 최종 신장 과정을 72℃에서 7분간 추가적으로 반응 시켰다. 7312.T4A는 94℃에서 5분간 초기변성 하였으며 이후 95℃에서 30초, 57℃에서 30초, 72℃에서 40초간 총 45회 반복 하였으며, 최종 신장 과정을 72℃에서 5분간 추가적으로 반응시켰다. CAPS마커인 7312.T4A에 의해 증폭된 PCR 산물은 HinfⅠ를 이용하여 65℃에서 2시간동안 제한효소 처리 하였다. 그리고 InDel마커인 BPH3INDBPH26IND는 제한효소를 처리하지 않고 증폭산물을 그대로 전기영동에 이용 하였다. PCR 증폭 산물 및 제한효소를 처리한 산물은 6x loading dye (SIGMA, Cat. G2526-5ML, Saint Louis, MO, USA)와 함께 혼합 하였으며, 1x TAE buffer와 EtBr (SIGMA, Cat. E1510, Saint Louis, MO, USA)이 포함되어 있는 0.8% agarose gel (SIGMA, Cat. A9539-25G, Saint Louis, MO, USA)에 로딩 하였다. 100 V로 30분간 전기영동 후 UV transilluminator (Bio-Rad, Cat. 170-8070, Hercules, CA, USA)에서 PCR 증폭 산물을 확인하였다.
수량 및 이삭 관련 형질
포장에 공시되어 있는 시험재료들이 출수 후 30일이 지나 성숙기가 되었을 때 F2 식물체에서 각각 간장(Culm length), 수장(Panicle length), 수수(Number of tillers)를 조사하였다. 또한 농업형질 조사 후 이삭과 관련된 형질을 조사하기 위해 각 시험재료에서 무작위로 3개의 주간 이삭을 샘플링 하여 이삭당 총립수(Number of spikelets), 총지경수(Number of rachis-branches per panicle), 1차 지경수[Number of primary rachis-branches (RPBs) per panicle], 1차지경 총립수(Number of spikelets on PRBs per panicle), 1차지경당 평균립수(Mean number of spikelets on a PRB), 2차지경수[Number of secondary rachis-branches (SRBs) per panicle], 2차지경 총립수(Number of spikelets on SRBs per panicle), 2차지경당 평균립수(Mean number of spikelets on a SRB), 2차지경수/1차지경수(Ratio of SRBs to PRBs), 2차지경립/1차지경립(Ratio of spikelets on SRBs to spikelets on PRBs), 총비립수(Number of abortive grains), 1차지경비립수(Number of abortive grains on PRBs per panicle), 2차지경비립수(Number of abortive grains on SRBs per panicle), 임실률(Fertile rate)을 조사하였다(Park et al. 2018). 1차지경은 수축에서부터 발생한 지경이고, 1차지경 총립수는 1차지경에 착생한 총립수 이다. 2차지경은 1차지경으로부터 발생한 지경이고, 2차지경 총립수는 2차지경에 착생한 총립수 이다. 이삭의 지경을 구분하는 방법으로는 이삭의 수축에서부터 처음으로 분지한 지경이 1차 지경이며, 1차 지경의 마디에서부터 분지한 지경을 2차지경이라고 구분 하였다. 그리고 일부 2차 지경에서부터 분지한 3차 지경은 모두 2차지경에 포함 시켰다. 각각의 지경과 지경에 착생 되어 있는 소수를 육안으로 직접 조사하여 지경의 수와 착생립수를 조사 하였으며, 1차 및 2차 지경에 있는 착생립수를 각 지경수로 나누어 지경에 있는 평균립수를 계산하였다. 그리고 2차 지경수 및 착생립수를 1차 지경수 및 착생립수로 나누어 비율을 계산 하였다. 이삭길이는 이삭목 마디에서부터 이삭 끝의 낟알이 착생되어 있는 부분까지의 길이를 측정하였다.
통계 분석
R (version 4.1.3, The R Foundation for Statistical Computing Platform)은 시험 재료에서 조사된 수량 및 이삭과 관련된 형질들의 통계 분석을 위해 사용되었다. 조사된 시험 재료들의 평균과 표준편차와 같은 기술통계와 t-test를 적용한 각 형질들의 평균간 비교 분석을 위한 분산분석 및 Duncan’s Multiple Range Test (DMRT)는 R의 agricolate package를 적용하였다. T-test와 DMRT 분석에서의 평균값들에 대한 유의성은 p값이 0.05보다 적은 수준을 적용하여 유의한 차이를 분석하였다. 형질들의 히스토그램은 gglot2, ggpubr, cowplot을 이용하여 작성하였다. 또한 조사된 형질들에 대한 관련성을 명확하게 이해하기 위해 psych package를 이용하여 상관관계를 분석하였으며, corr.test package를 적용하여 서로 다른 3개 이상의 특성들을 비교 분석하였다. 분석된 결과를 시각적으로 나타내기 위해 다양한 그래프와 히트맵을 작성하기 위해 corrplot package를 적용하였다.
수량 관련 형질의 표현형 분석
벼멸구 저항성 유전자의 도입과 관련된 농업형질 및 열악형질의 분석을 위해 전주686호와 JJ621MR을 교배하여 육성된 F2 식물체에서 출수기가 비슷한 120개체를 선발하여 이삭 및 수량 관련 형질인 간장, 수장, 수수, 이삭당 총립수, 총지경수, 1차 지경수, 1차지경 총립수, 1차지경당 평균립수, 2차지경수, 2차지경 총립수, 2차지경당 평균립수, 2차지경수/1차지경수, 2차지경립/1차지경립, 총비립수, 1차지경비립수, 2차지경비립수, 임실률을 조사 하였다. 조사된 형질들에서 임실률, 2차지경비립수를 제외한 형질들은 한쪽으로 치우치지 않았으며, 평균을 중심으로하여 연속적인 정규 분포 그래프의 모습을 나타냈다(Fig. 1A-1Q). 조사된 형질들은 모두 연속분포하였으며, 단일 유전자가 아닌 여러 유전자가 형질의 발현에 영향을 주고 있는 양적 형질이라는 것을 의미 하였다. 육성된 집단의 F2 형질 특성은 모본과 부본의 변이 폭 사이에서 초월분리 하는 정규 분포 하는 양상이었지만(Fig. 1A-1O) 2차지경비립수(Fig. 1P), 임실률(Fig. 1Q)에서는 열악형질을 보이는 방향으로 편향되었다. 유전적으로 유사한 양친을 교배하였을 때 육성된 후대 계통에서 농업 형질의 변이 폭이 크게 나타나는 것은 도입된 유전자가 해당 형질에 대해 영향을 주고 있다는 결과로 사료 된다. 저항성 유전자의 집적을 위해 분자마커를 이용할 경우에는 유전자 주변에 위치해 있는 형질이 동반으로 이입되어 유전회복이 늦어지기 때문에 반복친으로 여러 번 여교배 해야한다고 보고되어 있다(Jena et al. 2016). 본 연구에서도 Bph18의 도입에 의해 임실률이 낮게 조사되었던 것이 Bph18 유전자 주변의 형질이 동반 유입되어 형질의 변이에 영향을 준 것으로 예상된다. 따라서 조사된 형질들은 모두 환경에 의한 영향을 많이 받는 양적형질유전자좌에 의해 조절되고 있는 것으로 분석 되었다.
전주686호와 JJ621MR을 교배하여 육성된 F2 식물체의 수량 및 이삭관련 형질들의 특성 조사값들을 Table 2에 제시하였으며, 이들 집단에서는 조사된 특성에 대해서 다양한 표현형 변이가 조사 되었다. 양친인 전주686호와 JJ621MR의 간장은 각각 69 cm와 83 cm로 JJ621MR이 더 길었다. 수장과 수수, 이삭총립수는 전주686호(수장 18 cm, 수수 10개, 이삭총립수 118.0개)와 JJ621MR (18, 10, 118.7)이 동일한 수준이었다. 이삭 관련 형질 중 총지경수는 전주686호(35.0개)가 JJ621MR (29.3개)보다 많았으며, 1차지경수와 1차지경총립수는 전주686호(11.7개, 69.3개)보다 JJ621MR (13.0, 78.7)가 더 많은 것으로 조사 되었다. 2차지경수(전주686호 23.3개, JJ621MR 16.3개), 2차지경총립수(18.7, 40.0), 2차지경수/1차지경수(2.0, 1.2)는 전주686호가 JJ621MR보다 높은 수준으로 조사 되었다. 하지만 2차지경당평균립수(전주686호 2.1, JJ621MR 2.4), 2차지경립/1차지경립(0.7, 0.5)은 전주686호보다 JJ621MR이 더 높은 수준으로 조사되었다. 그리고 1차지경당평균립수는 모부본에서 동일한 수준인것으로 조사되었다. 총비립수(전주686호 5.3개, JJ621MR 25.3개), 1차지경비립수(1.0, 3.0), 2차지경비립수(4.3, 22.3)는 모두 전주686호보다 JJ621MR에서 더 많은 것으로 조사되었으며, 이는 전주686호의 임실률(95.4%)이 JJ621MR (78.6)보다 임실률이 높은 것에 기인한 것으로 보인다. 조사된 형질중 간장(변이계수 2.52%)과 1차지경당 평균립수(9.30)는 변이가 매우 적은 수준이었다. 수장(15.02), 이삭 총립수(14.24), 총지경수(16.39), 1차지경수(9.93), 1차지경 총립수(11.32), 2차 지경당 평균립수(9.30), 임실비율(8.89)은 변이가 보통이었다. 수수(21.97), 2차지경수(22.17), 2차지경 총립수(25.92), 2차지경수/1차지경수(19.94), 2차지경립/1차지경립(25.79), 총비립수(47.48), 1차지경비립수(62.79), 2차지경비립수(43.43)의 변이는 높은 수준이었다. 간장과 1차지경당 평균립수는 변이정도가 가장 낮아서 변이가 거의 없는 것으로 조사 되었다. 이것은 전주686호와 JJ621MR로부터 도입된 Bph3, Bph18, BPH26이 상대적으로 간장과 1차지경당 평균립수에는 영향을 미치지 않은 것으로 생각된다. 하지만 총비립수, 1차지경비립수, 2차지경비립수는 변이계수가 각각 47.48%, 62.79%, 43.43%로 변이가 매우 심각한 수준인 것으로 분석되었다. 벼 유전자원의 다양화와 수량향상을 위한 품종을 육성 할 때 F2 집단에서 농업형질들의 수준은 다양하게 분석된다. 하지만 병해충 저항성 유전자의 도입이 필요한 육종에서는 임심률이 저하된다는 연구결과들이 이전에 보고 되어 있으며(Ruengphayak et al. 2015), 이것은 본 연구의 비립수의 변이가 매우 크다는 것과 일치하는 경향을 보인다. 따라서 벼멸구 저항성 벼 품종을 육성 할 때는 임실률과 관련된 열악형질의 도입이 없으면서 저항성이 강력한 유전자를 선정 하는 것과 열악형질이 도입 되었을 때 열악형질을 제거하는 방향으로 육종 계획을 수립하는 것이 중요할 것으로 판단된다(Jeevanandham et al. 2023, Rezvi et al. 2023).
벼멸구 저항성 유전자 집적에 따른 농업 형질들의 관련성 분석
벼멸구 저항성 유전자의 집적된 형태에 따른 농업적 형질 변화를 분석 하기 위해 전주686호와 JJ621MR을 교배하여 얻은 120개의 F2 식물체에 대한 유전자형 조합을 분석 하였다(Table 3 and Supplementary Figs. 1-3). F2 식물체에서 BPH26만 단독으로 도입된 식물체는 있었지만, Bph3 또는 Bph18이 단독으로 도입된 식물체는 없는 것으로 조사 되었다. 유전자형 조합에 따라 이삭 및 수량 관련 형질을 조사 하였을 때 수장, 수수, 이삭총립수, 총지경수, 1차지경수, 1차지경총립수, 1차지경평균립수, 2차지경수, 2차지경총립수, 2차지경평균립수, 2차지경수/1차지경수, 2차지경립/1차지경립에서는 유전자형 조합에 따른 형질간 차이 없이 동일한 수준 이었다. 하지만 간장, 총비립수, 1차지경비립수, 2차지경비립수, 임실률에서는 벼멸구 저항성 유전자인 Bph3, Bph18, BPH26의 조합에 따라 형질에서 차이가 있는 것으로 조사 되었다(Table 4 and Fig. 2). 총비립수와 2차지경비립수는 동일한 경향으로 조사 되었으며, Bph18의 유전자 보유 형태에 따라서 각 개체들이 서로 구분 되었다. 1차지경비립수도 Bph18의 보유형태에 따라서 각 개체간에 유의미한 차이가 있었지만 그 정도가 총비립수와 2차지경비립수보다 약하게 작용하였다. Bph3BPH26은 유전자의 형태에 따라 유의미한 차이는 보이지 않았지만, Bph18이 동형접합체 또는 이형접합체로 도입되어 있는 경우에는 총비립수, 1차지경비립수, 2차지경비립수가 보유하지 않은 식물체들 보다 더 많은 것으로 조사 되었다. 그리고 Bph18를 보유하지 않은 식물체들은 Bph3BPH26의 유전자형의 보유 형태에 상관없이 Bph18이 도입된 식물체보다 총비립수와 2차지경비립수는 낮은 수준으로 조사 되었다. 또한 임실률을 조사하였을 때도 Bph18이 없는 식물체들은 Bph18이 동형접합 또는 이형접합으로 있는 식물체에 비해 임실률이 높은 수준인것으로 조사 되었다.
본 연구에서는 전주686호와 JJ621MR을 교배하여 육성된 F2 중 120개의 식물체를 무작위로 선정하여 벼멸구 저항성 유전자 Bph3, Bph18, BPH26과 농업형질들의 발현의 연관성에 대해 분석 하였으며, 벼멸구 저항성유전자 Bph18이 1차지경비립수, 2차지경비립수를 증가시켜 최종적으로 임실률 저하에 영향을 주고 있음을 확인 하였다. 따라서 저항성 유전자를 도입 할 때는 목표 형질만 타켓으로 하는 분자마커 뿐만 아니라 저항성 유전자와 인접해 있는 열악형질까지 고려할 수 있는 분자마커를 적용 하는 것이 필요하다고 판단된다. 따라서 저항성 유전자와 가깝게 위치해 있는 열악 형질들을 검출 할 수 있는 분자마커가 개발 된다면 열악형질을 보유한 계통을 초기세대에 도태시킬 수 있으며 현재의 분자육종의 정확성과 효율성을 극대화하여 기후변화에 대응한 병해충 저항성 벼 품종 육성에 효과적으로 활용 할 수 있을 것으로 기대된다.
수량 및 이삭과 관련된 형질들은 벼멸구 저항성 유전자 Bph3, Bph18, BPH26의 보유 형태에 따라 비교분석 하였을 때 간장, 총비립수, 1차지경비립수, 2차지경비립수, 임실률을 제외한 나머지 형질들에 대해서는 Bph3, Bph18, BPH26의 보유 형태에 상관없이 동일한 수준으로 분석 되었다. 하지만 Bph18을 동형접합체 또는 이형접합체로 보유하고 있는 경우에는 그렇지 않았을 때보다 간장은 길어졌고, 총비립수, 1차지경비립수, 2차지경비립수는 증가하여 임실률이 감소 하는 경향을 보였다. 이삭은 1차지경수보다 2차지경의 수가 더 많기 때문에 1차지경비립수는 동일한 수준이더라도 2차지경비립수가 서로 달랐기 때문에 임실률에도 영향을 준 것으로 사료된다. 그리고 유전자가 도입될 때 Bph3, Bph18, BPH26의 동형접합체 또는 이형접합체에 상관없이 농업형질의 발현은 동일한 수준이었다. Bph18이 현재 벼멸구 저항성 벼 품종 육성에 활발하게 활용 되고 있지만 본 연구에서는 Bph18의 도입에 따른 임실률 감소가 조사 되었다. 그렇기 때문에 벼멸구 저항성 벼 품종 육성을 위해 Bph18를 활용 할 경우에는 임실률을 증가 시킬 수 있는 방향으로 육종 전략을 구축해야 할 것으로 사료된다(Samal et al. 2022). Bph3의 도입에 따른 임실률 감소는 조사되지 않았기 때문에 앞으로 벼멸구 저항성 벼 품종 육성사업에 효율적으로 활용 될 수 있을 것으로 기대된다.
농업형질 특성간의 상관관계 분석
전주686호와 JJ621MR 교배 하여 얻은 120개의 F2 식물체에 대한 농업형질들간의 상관관계를 분석하였다(Table 5 and Supplementary Fig. 4). 조사된 형질들 중에서 총지경수와 2차지경수 사이의 상관관계가 0.983으로 가장 높은 것으로 조사되었으며, 이후 총비립수와 2차지경비립수(상관계수 0.980), 1차지경수와 1차지경 총립수(0.963), 이삭 총립수와 총지경수(0.949), 2차지경수/1차지경수와 2차지경립/1차지경립(0.926)이 높은 수준으로 분석되었다. 그리고 임실률과 다른 형질들 간의 상관관계를 분석하였을 때 임실률은 총비립수(상관계수 -0.859) 그리고 2차지경비립수(-0.878)와 가장 큰 부의 상관관계인것으로 조사 되었다. 이삭관련형질 중 이삭총립수는 2차지경당 평균립수에 의해 지배적으로 조절되며, 결국 2차지경의 수가 많아서 2차지경에 맺히는 낟알의 개수가 증가하게 되는 결과는 이전에 보고된 연구결과들과 일치하였다. 또한 임실률은 비립수와 매우 밀접한 관련성이 있고, 벼멸구 저항성 유전자 조합별 농업 형질들간의 변화를 분석 하였을 때 Bph18의 도입이 임실률 감소 및 비립수 증가와 밀접한 관련이 있었다. 이러한 결과를 종합해보면 벼멸구 저항성 벼 품종 육성을 하기 위한 육종 계획을 수립 할 때 임실률에 부정적인 영향을 미치는 Bph18보다는 임실률에 미치는 영향은 적으면서 저항성은 강력하다고 보고된 Bph3을 도입하여 임실률 저하와 같은 열악형질 수반의 문제를 최소화 할 필요성이 있을 것으로 사료되며, 이를 보완하는 방향으로 육종 재료 선정이 중요할 것으로 판단된다.
수량 관련 형질에 대한 계층적 군집화 및 주성분 분석
전주686호와 JJ621MR의 교배로 육성된 F2 식물체에서 시험재료들의 벼멸구 저항성 유전자 도입에 따른 상호작용의 정도와 집단의 구조적인 관계를 파악하기 위해 주성분분석을 하였다(Fig. 3). 주성분분석은 주로 고차원의 데이터에서 의미있는 구조와 패턴을 추출하여 차원을 축소하게 되고, 이를 적용하여 각 집단을 분석하는 방법이다. Fig. 3은 score plot을 나타낸 그래프이며, 이것은 시험재료들의 고차원적인 농업형질들이 조사된 값 들로부터 변환된 주성분(PC)중에서 최대의 분산과 두번째로 높은 분산값을 PC1과 PC2를 적용하여 시험재료들에 대해서 2차원적으로 시각화된 자료를 보여주고 있다. PC1과 PC2를 통해 전주686호와 JJ621MR의 F2 식물체에 대한 전체 형질 변이의 83.75% (PC1 62.06%, PC2 21.69%)를 설명 할 수 있었으며, PC1으로도 전체 형질 변이 대부분을 설명 가능했다. PC1을 기준으로 총비립수와 2차지경비립수는 같은 방향성을 나타냈으며, 임실률과는 서로 다른 방향성으로 나타났다. 분석된 PC값을 이용하여 집단의 그룹화 분석을 하였을 때 시험에 사용된 재료들은 완벽하게 그룹으로 분리 되지 않았으며, 모든 재료들이 넓은 범위로 혼재되어 있는 양상으로 나타났다. Fig. 3에서 제시하는 score plot은 전주686호와 JJ621MR의 120개의 F2 식물체에서 조사된 벼멸구 저항성 유전자 Bph3, Bph18, BPH26의 유전자형으로부터 변환된 PC값을 분석하여 나타낸 그래프이다(Fig. 4). PC1과 PC2를 이용하여 전체 변이의 93.89% (PC1 61.27%, PC2 32.62%)를 설명 할 수 있었다. PC1을 기준으로 하였을 때 Bph3BPH26은 같은 방향성을 나타냈으며, Bph18과는 서로 다른 방향으로 나타났다. 이는 전주686호는 Bph3BPH26을 보유하고 있으며, JJ621MR은 Bph18을 보유하고 있기 때문에 이러한 결과가 나온 것으로 사료된다. 분석된 PC값을 이용하여 그룹화 분석 하였을 때 시험 재료들을 9개의 그룹으로 완벽하게 구분 되었다. 이것은 120개 F2 식물체를 PCR 하여 마커검정 하였을 때 9개의 그룹으로 구분된 것과 동일한 결과를 나타낸다. 유전자형으로 그룹을 구분하였을 때는 완벽하게 구분 되었지만, 조사된 농업형질값을 이용하여 그룹화 하였을 때 혼재된 양상을 나타난 이유는, 분석된 사용된 농업형질들의 변이가 넓은 범위로 조사된 것이 기인한 것으로 사료된다. 또한 각각의 농업형질들을 따로 조사 하였을 때 통계적으로 유의미한 차이가 났다고 하더라도 변이계수값이 높게 조사되었으며, 주성분 분석은 모든 조사값들을 이용하여 고차원적으로 변환된 PC값을 이용했기 때문에 그룹이 뚜렷하게 구분되지 않고 혼재된 양상으로 나타난 것으로 보인다.
예측 불가능한 기후 변화는 지구의 기온을 상승 시키고 있고 병해충들의 균계 발생을 다양화 하고 있다. 이로 인해 균계의 생태형 변화가 가속화 되고 있으며 벼 수량 및 미질 감소에 심각한 피해를 주고 있다. 최근 우리나라에서 벼멸구에 의한 피해 발생 면적은 증가하고 있으며, 지구 온난화에 의한 급격한 생태계 변화는 더 큰 피해를 줄 것 이라고 예상된다. 이러한 문제들에 대해 극복하기 위해서 저항성 벼 품종을 육성하는 것이 필요하다. 하지만 대부분의 저항성 유전자는 인디카에 분포되어 있으며, 우리나라의 자포니카 벼로 도입할 때 원연교잡에 따른 불임립 발생이 많고 열악형질이 도입되는 경우가 많기 때문에 이를 회복 하는데 많은 노력과 시간이 소비된다. 따라서 본 연구에서는 Bph3, Bph18, BPH26을 자포니카 벼 품종 육종사업에 이용할 때 발생할 수 있는 열악형질의 원인을 분석하기 위해 현재까지 벼멸구 저항성이 강하다고 알려진 Bph3와 함께 BPH26를 보유하고 있는 전주686호와 우리나라의 자포니카 벼 품종 육종에 주로 사용되었던 벼멸구 저항성 유전자 Bph18을 보유하고 있는 JJ621MR을 이용하여 저항성 유전자가 집적된 분리 집단을 육성하여 이용 하였으며, 육성된 F2 식물체에서 120개의 개체를 무작위로 선발하여 벼멸구 저항성 유전자 도입에 따른 열악형질과의 상관 관계 및 이들의 연관성에 대해서 구명하였다. 조사된 시험재료들의 형질 특성들은 대부분 연속변이로 정규분포 하였으며, 임실률과 2차지경비립수와 같은 경우에는 한쪽으로 편향되는 분포를 보였다. 육성된 시험재료에서 임실률과 2차지경비립수의 편향된 분포 원인을 구명하기 위해 벼멸구 저항성 유전자 Bph3, Bph18, BPH26과 농업 형질들간의 분산분석을 하였을 때 Bph18이 비립의 증가에 따른 임실률 감소와 연관이 높은 것으로 분석 되었다. 또한 비립의 증가와 연관이 높게 분석된 Bph18 보유계통들에 대한 농업형질을 조사 하였을 때 Bph18의 도입은 비립수와 임실률에 영향을 주는 것으로 조사 되었다. 하지만 Bph3는 임실률과 관련된 형질들에 유의미한 영향을 주지 않는 것으로 조사 되었다. 현재 Bph3는 벼멸구 저항성이 강하다고 다양한 연구가 보고되어 있기 때문에 앞으로 우리나라에서 벼멸구 저항성 육종 계획을 수립할 때 Bph18보다는 Bph3를 효과적으로 활용 할 수 있을 것으로 기대된다. 하지만 벼멸구 저항성 유전자를 도입 할 때는 열악형질이 수반될 경우가 많기 때문에 이를 효과적으로 제거 하기 위한 분자마커 개발이 필요하고, 최종적으로 분자육종효율을 극대화 하여 병해충 저항성이 향상된 벼 품종 육성에 본 연구의 결과가 효과적인 기초자료로 사용 될 수 있을 것으로 기대된다.
본문의 Supplementary Figs. 1-4는 한국육종학회지 홈페이지에서 확인할 수 있습니다.
본 연구는 농촌진흥청 작물시험연구사업[남부지역 적응 밥쌀용 재배안정성 벼 품종개발(3단계), 과제번호: PJ016067 022024]과 국립식량과학원 전문연구원 과정 지원사업에 의해 수행된 결과의 일부입니다.
Fig. 1
Histogram of agricultural traits for 120 plants among F2 derived by crossing Jeonju686 and JJ621MR. All of the traits investigated were in a wider range than the survey values of Jeonju686 and JJ621MR, and they all showed transgressive segregation, and all were normally distributed as continuous variations. The number of abortive grains on SRBs per panicle and fertile rate were normally distributed with a skew to one side. All of the investigated traits were controlled by various genes, and the umber of abortive grains on SRBs per panicle and fertile rate were greatly influenced by the parent plant.
kjbs-56-4-381-f1.jpg
Fig. 2
Changes in agricultural traits following introduction of rice planthopper resistance genes. Agricultural traits caused by introduction of Bph3, Bph18, and BPH26 were investigated. When 120 individuals were randomly selected from the F2 plants derived by crossing Jeonju686 and JJ621MR, 9 genotype combinations were analyzed (Bph3 homo+Bph18 none+BPH26 homo, Bph3 homo+Bph18 hetero+BPH26 hetero, Bph3 homo+Bph18 homo+BPH26 hetero, Bph3 hetero+Bph18 homo+BPH26 hetero, Bph3 hetero+Bph18 hetero+BPH26 hetero, Bph3 hetero+Bph18 none+BPH26 homo, Bph3 none+Bph18 none+BPH26 homo, Bph3 none+Bph18 hetero+BPH26 hetero, Bph3 none+Bph18 homo+BPH26 hetero). In plants into which Bph3 was introduced, the number of abortive grains, number of abortive grains on SRBs per panicles increased, and the fertile rate decreased, regardless of the Bph3 genotype (homo or hetero). Different letters over the bars indicate significant differences at p<0.05 (ANOVA followed by DMRT). CL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.
kjbs-56-4-381-f2.jpg
Fig. 3
Scatterplot of Principal components (PC) 1 (62.3%) and PC 2 (31.8%) based on 12 quantitative traits of 120 F2 plants derived from the cross of Jeonju686 and JJ621MR. When PCA and K-means clustering were performed, 120 F2 plants were mixed and not clearly distinguished. CL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.
kjbs-56-4-381-f3.jpg
Fig. 4
Scatterplot of PC 1 (62.3%) and PC 2 (31.8%) based on the genotypes of Bph3, Bph18, and BPH26 of 120 F2 plants derived from the cross of Jeonju686 and JJ621MR. In PCA and K-means clustering applying the phnotypes of Bph3, Bph18, and BPH26, 120 F2 plants were clearly divided into 9 groups.
kjbs-56-4-381-f4.jpg
Table 1
Information of the DNA markers used for identify Bph3, Bph18, and BPH26.
Table 1
Genes Chr.z Marker name Primers sequence Product size
(bp)
Enzyme Band type Reference

Forward (5' to 3') Reverse (5' to 3')
Bph3 4 BPH3IND GCTTCACCTGTGTCCTGTT GTGTATGAGGGTTGTTCTGGAT 350 - Co-dominant Ji et al. 2018
Bph18 12 7312.T4A ACGGCGGTGAGCATT GG TACAGCGAAAAGCAT AAAGAGTC 398/566 Hinf I Co-dominant Suh et al. 2014
BPH26 12 BPH26IND GGGCAGCTAAGCGCATGGTT GGGTGATAAATCGAACAGCAGAGG 844 - Co-dominant Ji et al. 2018

zChr: Chromosome.

Table 2
Agricultural traits of Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants.
Table 2
Species CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
Jeonju686 Mean 69.4 18.3 10.8 118.0 35.0 11.7 69.3 5.9 23.3 48.7 2.1 2.0 0.7 5.3 1.0 4.3 95.2
SD 1.3 0.8 2.1 2.8 3.8 1.4 2.8 0.4 2.9 3.5 0.3 0.2 0.1 1.7 0.4 1.8 1.9
MAX 74.3 19.3 12.0 120.0 38.0 13.0 71.0 6.2 25.4 52.3 2.5 2.3 0.8 7.2 3.1 4.8 96.8
MIN 67.5 18.2 9.0 116.0 33.0 11.0 67.0 5.7 21.3 47.3 2.1 2.0 0.6 4.8 0.8 2.3 92.1
C.V. (%) 1.5 4.3 19.6 2.4 10.1 12.1 4.1 6.0 12.4 7.3 13.6 10.6 19.9 11.1 11.6 13.3 2.3
JJ621MR Mean 83.0 18.0 10.0 118.7 29.3 13.0 78.7 6.1 16.3 40.0 2.4 1.2 0.5 25.3 3.0 22.3 78.6
SD 2.1 2.1 1.4 2.1 2.8 2.1 1.4 0.7 1.4 1.4 0.1 0.1 0.1 2.3 1.7 1.8 1.6
MAX 85.0 20.0 11.0 120.0 31.0 15.0 80.0 7.0 18.0 42.0 2.5 1.3 0.6 27.3 5.2 24.3 79.4
MIN 81.0 17.0 9.0 117.0 27.0 12.0 78.0 6.0 16.0 40.0 2.4 1.2 0.3 24.1 2.8 21.8 74.2
C.V. (%) 3.1 11.8 14.1 1.8 9.6 16.3 1.8 11.6 8.7 3.5 3.0 5.7 28.7 42.4 56.6 14.4 1.6
F2 plants Mean 75.7 20.1 10.6 118.8 33.3 11.5 67.7 5.9 21.9 51.0 2.3 1.9 0.8 20.7 10.2 11.7 81.5
SD 4.1 3.0 2.3 17.1 5.5 1.1 7.7 0.2 4.8 13.3 0.2 0.4 0.2 9.7 6.4 5.1 7.2
MAX 83.0 31.0 17.0 174.0 50.7 14.7 88.0 6.3 36.0 88.0 2.9 2.9 1.4 64.0 33.0 31.0 95.6
MIN 66.0 2.0 4.0 87.3 21.3 8.7 48.0 5.4 10.7 25.3 2.0 1.0 0.4 4.0 1.7 1.3 63.6
C.V. (%) 5.4 15.1 22.1 14.4 16.5 10.0 11.3 3.3 22.2 26.0 9.3 19.8 25.7 46.9 62.0 43.8 8.8

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate, SD: standard deviation, Min.: minimum, Max.: maximum, CV %: coefficient of variance in percentage.

Table 3
Number of plants in Jeonju686/JJ621MR F2 with introduced brown planthopper resistance gene.
Table 3
Genotype Number of plants Ratio (%)
Bph3 none+Bph18 none+BPH26 homo 7 5.8
Bph3 none+Bph18 hetero+BPH26 hetero 16 13.3
Bph3 none+Bph18 homo+BPH26 hetero 12 10.0
Bph3 hetero+Bph18 none+BPH26 homo 15 12.5
Bph3 hetero+Bph18 hetero+BPH26 hetero 35 29.2
Bph3 hetero+Bph18 homo+BPH26 hetero 8 6.7
Bph3 homo+Bph18 none+BPH26 homo 8 6.7
Bph3 homo+Bph18 hetero+BPH26 hetero 12 10.0
Bph3 homo+Bph18 homo+BPH26 hetero 7 5.8
Total 120 100.0
Table 4
Analysis of yield-related agricultural traits in Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants influenced by Bph3, Bph18 and BPH26 genotype.
Table 4
Genotype CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
Bph3 None 78.4±5.7ns 19.8±3.4ns 10.2±2.4ns 122.0±18.8ns 34.3±5.9ns 11.3±1.2ns 65.9±8.2ns 5.8±0.2ns 22.9±5.1ns 54.0±14.0ns 2.4±0.2ns 2.0±0.3ns 0.8±0.1ns 21.7±9.4ns 3.6±2.0ns 18.1±8.0ns 80.3±7.0ns
Hetero 76.6±4.7ns 19.8±3.2ns 10.3±2.3ns 118.6±15.6ns 33.2±5.0ns 11.6±1.0ns 69.0±6.7ns 5.9±0.1ns 21.6±4.5ns 49.5±13.2ns 2.2±0.1ns 1.8±0.3ns 0.7±0.1ns 21.1±9.6ns 4.1±2.2ns 17.0±8.5ns 81.8±6.7ns
Homo 77.7±4.9ns 20.8±1.3ns 11.3±1.9ns 114.5±16.5ns 32.0±5.5ns 11.3±1.2ns 67.3±8.4ns 5.9±0.1ns 20.7±4.8ns 49.4±11.6ns 2.2±0.1ns 1.8±0.4ns 0.7±0.1ns 20.3±9.7ns 3.2±1.8ns 17.0±8.7ns 80.6±8.7ns
Bph18 None 74.8±3.1ns 20.5±2.3ns 10.2±2.8ns 120.9±16.7ns 33.8±5.5ns 11.7±1.2ns 69.3±8.9ns 5.8±0.1ns 22.0±4.6ns 50.4±11.5ns 2.3±0.2ns 1.8±0.3ns 0.7±0.1ns 7.2±3.2** 2.0±0.9* 5.2±2.5** 91.4±2.3**
Hetero 76.0±4.3ns 20.3±2.7ns 10.6±2.2ns 118.7±17.0ns 33.3±5.3ns 11.3±1.0ns 66.9±7.3ns 5.9±0.1ns 22.0±4.8ns 50.7±13.2ns 2.3±0.1ns 1.9±0.3ns 0.7±0.2ns 23.9±5.1ns 4.2±2.0ns 19.7±4.8ns 79.3±4.3ns
Homo 83.7±3.3** 19.0±3.9ns 10.6±1.9ns 116.4±17.0ns 32.6±5.7ns 11.5±1.0ns 68.0±6.9ns 5.8±0.2ns 21.0±5.1ns 51.6±15.0ns 2.2±0.1ns 1.8±0.3ns 0.7±0.1ns 29.9±4.4* 4.7±2.3ns 25.2±3.4ns 73.8±2.8ns
BPH26 None - - - - - - - - - - - - - - - - -
Hetero 78.2±5.3ns 19.9±3.2ns 10.6±2.1ns 118.0±16.9ns 33.1±5.4ns 11.3±1.0ns 67.2±7.2ns 5.9±0.1ns 21.7±4.9ns 51.0±13.7ns 2.3±0.1ns 1.9±0.3ns 0.7±0.2ns 25.7±5.6* 4.3±2.1ns 21.3±5.0ns 77.7±4.7ns
Homo 74.8±3.1ns 20.5±2.3ns 10.2±2.8ns 120.9±16.7ns 33.8±5.5ns 11.7±1.2ns 69.3±8.9ns 5.8±0.1ns 22.0±4.6ns 50.4±11.5ns 2.3±0.2ns 1.8±0.3ns 0.7±0.1ns 7.2±3.2** 2.0±0.9* 5.2±2.5** 91.4±2.3**

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate. Data are presented as mean±standard deviation, ns non-significant difference, *signifcant at the 0.05 level, **signifcant at the 0.01 level (ANOVA followed by DMRT).

Table 5
Correlation matrix among the agricultural traits of related to panicle structure and yield.
Table 5
Traits CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
CL 1.000
PL -0.254 1.000
NT 0.075 0.005 1.000
NS 0.146 0.047 -0.259 1.000
NR 0.144 0.100 -0.239 0.949 1.000
NPr 0.164 0.116 -0.166 0.670 0.619 1.000
NSPr 0.156 0.103 -0.165 0.655 0.560 0.963 1.000
MNSPr 0.053 0.008 -0.089 0.245 0.070 0.323 0.565 1.000
NSr 0.123 0.085 -0.231 0.913 0.983 0.463 0.405 0.003 1.000
NSSr 0.090 -0.032 -0.179 0.652 0.671 0.297 0.283 0.082 0.687 1.000
MNSSr -0.048 -0.205 -0.096 0.254 0.073 -0.324 -0.295 -0.057 0.159 0.208 1.000
SrPr 0.050 0.043 -0.157 0.678 0.787 0.011 -0.035 -0.163 0.885 0.613 0.326 1.000
SSrSPr 0.017 -0.047 -0.139 0.602 0.638 -0.143 -0.200 -0.277 0.754 0.541 0.628 0.926 1.000
NA 0.439 -0.150 -0.006 0.013 0.007 0.051 0.031 0.069 0.004 0.090 0.036 0.033 0.013 1.000
NAPr 0.305 -0.111 -0.062 0.024 0.003 0.038 0.039 0.010 0.006 0.085 0.046 0.027 0.006 0.622 1.000
NSSAPr -0.421 0.142 0.023 0.008 0.007 0.048 0.026 0.076 0.003 -0.080 -0.029 -0.030 -0.014 0.980 0.452 1.000
FR -0.447 0.067 0.001 -0.056 -0.056 -0.093 -0.051 -0.126 -0.041 0.035 0.049 -0.001 0.027 -0.859 -0.389 -0.878 1.000

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.

  • 1. Cheon KS, Baek J, Cho YI, Jeong YM, Lee YY, Oh J, Won YJ, Kang DY, Oh H, Kim SL, Choi I, Yoon IS, Kim KH, Han JH, Ji H. 2018. Single nucleotide polymorphism (SNP) discovery and kompetitive allele-specific PCR (KASP) marker development with Korean japonica rice varieties. Plant Breed Biotech 6: 391-403.
  • 2. Hussain S, Huang J, Huang J, Ahmad S, Nanda S, Anwar S, Shakoor A, Zhu C, Zhu L, Cao X. 2020. Rice production under climate change: Adaptations and mitigating strategies. In: Environment, climate, plant and vegetation growth. Springer, pp. 659-686.
  • 3. Iamba K, Dono D. 2021. A review on brown planthopper (Nilaparvata lugens Stål), a major pest of rice in Asia and Pacific. Asian J Res Crop Sci 6: 7-19.
  • 4. Jeevanandham N, Raman R, Ramaiah D, Senthilvel V, Mookaiah S, Jegadeesan R. 2023. Rice: Nilaparvata lugens Stal interaction-current status and future prospects of brown planthopper management. J Plant Dis Protect 130: 125-141.
  • 5. Jena K, Jeung J, Lee J, Choi H, Brar D. 2006. High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18 (t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor Appl Genet 112: 288-297.
  • 6. Jena K, Pasalu I, Rao Y, Varalaxmi Y, Krishnaiah K, Khush G, Kochert G. 2003. Molecular tagging of a gene for resistance to brown planthopper in rice (Oryza sativa L.). Euphytica 129: 81-88.
  • 7. Jena KK, Ballesfin MLE, Vinarao RB. 2016. Development of Oryza sativa L. by Oryza punctata Kotschy ex Steud. monosomic addition lines with high value traits by interspecific hybridization. Theor Appl Genet 129: 1873-1886.
  • 8. Jena KK, Kim SM. 2010. Current status of brown planthopper (BPH) resistance and genetics. Rice 3: 161-171.
  • 9. Ji H, Ahn E, Seo B, Kang H, Choi I, Kim K. 2016. Genome-wide detection of SNPs between two Korean Tongil-type rice varieties. Korean J Breed Sci 48: 460-469.
  • 10. Ji H, Ahn E, Seo BY, Kang HJ, Lee SB, Hyun UJ, Choi I, Kim KH, Kim SL, Lee SB. 2018. Detection of genes conferring resistance to the brown planthopper (BPH) in Gayabyeo through genome resequencing and development of their selection markers. Korean J Breed Sci 50: 104-115.
  • 11. Kim CK, Chu SH, Park HY, Seo J, Kim B, Lee G, Koh HJ, Chin JH. 2017. Identification of heterosis QTLs for yield and yield-related traits in indica-japonica recombinant inbred lines of rice (Oryza sativa L.). Plant Breed Biotech 5: 371-389.
  • 12. Kim W, Back S, Shin W, Park H, Ha K, Park J, Cho Y, Kim B, Lee J. 2013. Development of brown planthopper resistanct lines carrying Bph18 gene using marker-assisted selection in Japonica rice (Oryza sativa L.). J Korean Soc Int Agric 25: 378-384.
  • 13. Kubo T, Yoshimura A. 2005. Epistasis underlying female sterility detected in hybrid breakdown in a Japonica-Indica cross of rice (Oryza sativa L.). Theor Appl Genet 110: 346-355.
  • 14. Lee CM, Park HS, Baek MK, Suh JP, Jeong OY, Yun SJ, Kim SM. 2021. Effect of Resistance Genes on the Occurrence of Rice Undesirable Characters in a Wide Cross. Korean J Breed Sci 53: 392-403.
  • 15. Muduli L, Pradhan SK, Mishra A, Bastia DN, Samal KC, Agrawal PK, Dash M. 2021. Understanding brown planthopper resistance in rice: Genetics, biochemical and molecular breeding approaches. Rice Sci 28: 532-546.
  • 16. Park HS, Baek MK, Kim CS, Lee GM, Park SG, Lee CM, Suh JP, Cho YC. 2018. Development and Characterization of Rice Lines with Clustered Spikelets and Dense Panicles. Korean J Breed Sci 50: 415-423.
  • 17. Park HS, Baek SH, Kim WJ, Jeung JU, Lee JH, Ha KY, Park JH, Nam JK, Baek MK, Yoo JS. 2014. Development of multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus using anther culture in rice. Korean J Breed Sci 46: 078-089.
  • 18. Qiu Y, Guo J, Jing S, Zhu L, He G. 2010. High-resolution mapping of the brown planthopper resistance gene Bph6 in rice and characterizing its resistance in the 9311 and Nipponbare near isogenic backgrounds. Theor Appl Genet 121: 1601-1611.
  • 19. Rahman ML, Jiang W, Chu SH, Qiao Y, Ham T-H, Woo M-O, Lee J, Khanam MS, Chin JH, Jeung JU. 2009. High-resolution mapping of two rice brown planthopper resistance genes, Bph20 (t) and Bph21 (t), originating from Oryza minuta. Theor Appl Genet 119: 1237-1246.
  • 20. Rezvi HUA, Tahjib-Ul-Arif M, Azim MA, Tumpa TA, Tipu MMH, Najnine F, Dawood MF, Skalicky M, Brestič M. 2023. Rice and food security: Climate change implications and the future prospects for nutritional security. Food Energy Secur 12: e430.
  • 21. Ruengphayak S, Chaichumpoo E, Phromphan S, Kamolsukyunyong W, Sukhaket W, Phuvanartnarubal E, Korinsak S, Korinsak S, Vanavichit A. 2015. Pseudo-backcrossing design for rapidly pyramiding multiple traits into a preferential rice variety. Rice 8: 1-16.
  • 22. Samal P, Babu SC, Mondal B, Mishra SN. 2022. The global rice agriculture towards 2050: An inter-continental perspective. Outlook Agr J 51: 164-172.
  • 23. Shin MS, Kim WJ, Shin WC, Park HS, Seo CS, Choi IB, Ha KY, Kang HJ, Ko JK. 2011. Effect of Brown Planthopper Resistance Gene, Bph18 to Yield Components in Rice. Korean J Breed Sci 43: 56-61.
  • 24. Suh JP, Jeung JU, Kim YG, Jena KK, Cho YC, Lee JH, Kim MK, Hong HC, Lee JH, Kim JJ. 2014. A brown planthopper resistant and high grain quality rice variety 'Anmi'developed by molecular breeding method. Korean J Breed Sci 46: 152-159.
  • 25. Suh JP, Yang SJ, Jeung JU, Pamplona A, Kim JJ, Lee JH, Hong HC, Yang CI, Kim YG, Jena KK. 2011. Development of elite breeding lines conferring Bph18 gene-derived resistance to brown planthopper (BPH) by marker-assisted selection and genome-wide background analysis in japonica rice (Oryza sativa L.). Field Crops Res 120: 215-222.
  • 26. Yara A, Phi CN, Matsumura M, Yoshimura A, Yasui H. 2010. Development of near-isogenic lines for BPH25 (t) and BPH26 (t), which confer resistance to the brown planthopper, Nilaparvata lugens (Stål.) in indica rice 'ADR52'. Breed Sci 60: 639-647.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes
Korean. J. Breed. Sci.. 2024;56(4):381-394.   Published online December 1, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes
Korean. J. Breed. Sci.. 2024;56(4):381-394.   Published online December 1, 2024
Close

Figure

  • 0
  • 1
  • 2
  • 3
Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes
Image Image Image Image
Fig. 1 Histogram of agricultural traits for 120 plants among F2 derived by crossing Jeonju686 and JJ621MR. All of the traits investigated were in a wider range than the survey values of Jeonju686 and JJ621MR, and they all showed transgressive segregation, and all were normally distributed as continuous variations. The number of abortive grains on SRBs per panicle and fertile rate were normally distributed with a skew to one side. All of the investigated traits were controlled by various genes, and the umber of abortive grains on SRBs per panicle and fertile rate were greatly influenced by the parent plant.
Fig. 2 Changes in agricultural traits following introduction of rice planthopper resistance genes. Agricultural traits caused by introduction of Bph3, Bph18, and BPH26 were investigated. When 120 individuals were randomly selected from the F2 plants derived by crossing Jeonju686 and JJ621MR, 9 genotype combinations were analyzed (Bph3 homo+Bph18 none+BPH26 homo, Bph3 homo+Bph18 hetero+BPH26 hetero, Bph3 homo+Bph18 homo+BPH26 hetero, Bph3 hetero+Bph18 homo+BPH26 hetero, Bph3 hetero+Bph18 hetero+BPH26 hetero, Bph3 hetero+Bph18 none+BPH26 homo, Bph3 none+Bph18 none+BPH26 homo, Bph3 none+Bph18 hetero+BPH26 hetero, Bph3 none+Bph18 homo+BPH26 hetero). In plants into which Bph3 was introduced, the number of abortive grains, number of abortive grains on SRBs per panicles increased, and the fertile rate decreased, regardless of the Bph3 genotype (homo or hetero). Different letters over the bars indicate significant differences at p<0.05 (ANOVA followed by DMRT). CL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.
Fig. 3 Scatterplot of Principal components (PC) 1 (62.3%) and PC 2 (31.8%) based on 12 quantitative traits of 120 F2 plants derived from the cross of Jeonju686 and JJ621MR. When PCA and K-means clustering were performed, 120 F2 plants were mixed and not clearly distinguished. CL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.
Fig. 4 Scatterplot of PC 1 (62.3%) and PC 2 (31.8%) based on the genotypes of Bph3, Bph18, and BPH26 of 120 F2 plants derived from the cross of Jeonju686 and JJ621MR. In PCA and K-means clustering applying the phnotypes of Bph3, Bph18, and BPH26, 120 F2 plants were clearly divided into 9 groups.
Association Analysis of Yield-Related Traits in Rice Following the Introduction of Brown Planthopper Resistant Genes

Information of the DNA markers used for identify Bph3, Bph18, and BPH26.

Genes Chr.z Marker name Primers sequence Product size
(bp)
Enzyme Band type Reference

Forward (5' to 3') Reverse (5' to 3')
Bph3 4 BPH3IND GCTTCACCTGTGTCCTGTT GTGTATGAGGGTTGTTCTGGAT 350 - Co-dominant Ji et al. 2018
Bph18 12 7312.T4A ACGGCGGTGAGCATT GG TACAGCGAAAAGCAT AAAGAGTC 398/566 Hinf I Co-dominant Suh et al. 2014
BPH26 12 BPH26IND GGGCAGCTAAGCGCATGGTT GGGTGATAAATCGAACAGCAGAGG 844 - Co-dominant Ji et al. 2018

zChr: Chromosome.

Agricultural traits of Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants.

Species CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
Jeonju686 Mean 69.4 18.3 10.8 118.0 35.0 11.7 69.3 5.9 23.3 48.7 2.1 2.0 0.7 5.3 1.0 4.3 95.2
SD 1.3 0.8 2.1 2.8 3.8 1.4 2.8 0.4 2.9 3.5 0.3 0.2 0.1 1.7 0.4 1.8 1.9
MAX 74.3 19.3 12.0 120.0 38.0 13.0 71.0 6.2 25.4 52.3 2.5 2.3 0.8 7.2 3.1 4.8 96.8
MIN 67.5 18.2 9.0 116.0 33.0 11.0 67.0 5.7 21.3 47.3 2.1 2.0 0.6 4.8 0.8 2.3 92.1
C.V. (%) 1.5 4.3 19.6 2.4 10.1 12.1 4.1 6.0 12.4 7.3 13.6 10.6 19.9 11.1 11.6 13.3 2.3
JJ621MR Mean 83.0 18.0 10.0 118.7 29.3 13.0 78.7 6.1 16.3 40.0 2.4 1.2 0.5 25.3 3.0 22.3 78.6
SD 2.1 2.1 1.4 2.1 2.8 2.1 1.4 0.7 1.4 1.4 0.1 0.1 0.1 2.3 1.7 1.8 1.6
MAX 85.0 20.0 11.0 120.0 31.0 15.0 80.0 7.0 18.0 42.0 2.5 1.3 0.6 27.3 5.2 24.3 79.4
MIN 81.0 17.0 9.0 117.0 27.0 12.0 78.0 6.0 16.0 40.0 2.4 1.2 0.3 24.1 2.8 21.8 74.2
C.V. (%) 3.1 11.8 14.1 1.8 9.6 16.3 1.8 11.6 8.7 3.5 3.0 5.7 28.7 42.4 56.6 14.4 1.6
F2 plants Mean 75.7 20.1 10.6 118.8 33.3 11.5 67.7 5.9 21.9 51.0 2.3 1.9 0.8 20.7 10.2 11.7 81.5
SD 4.1 3.0 2.3 17.1 5.5 1.1 7.7 0.2 4.8 13.3 0.2 0.4 0.2 9.7 6.4 5.1 7.2
MAX 83.0 31.0 17.0 174.0 50.7 14.7 88.0 6.3 36.0 88.0 2.9 2.9 1.4 64.0 33.0 31.0 95.6
MIN 66.0 2.0 4.0 87.3 21.3 8.7 48.0 5.4 10.7 25.3 2.0 1.0 0.4 4.0 1.7 1.3 63.6
C.V. (%) 5.4 15.1 22.1 14.4 16.5 10.0 11.3 3.3 22.2 26.0 9.3 19.8 25.7 46.9 62.0 43.8 8.8

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate, SD: standard deviation, Min.: minimum, Max.: maximum, CV %: coefficient of variance in percentage.

Number of plants in Jeonju686/JJ621MR F2 with introduced brown planthopper resistance gene.

Genotype Number of plants Ratio (%)
Bph3 none+Bph18 none+BPH26 homo 7 5.8
Bph3 none+Bph18 hetero+BPH26 hetero 16 13.3
Bph3 none+Bph18 homo+BPH26 hetero 12 10.0
Bph3 hetero+Bph18 none+BPH26 homo 15 12.5
Bph3 hetero+Bph18 hetero+BPH26 hetero 35 29.2
Bph3 hetero+Bph18 homo+BPH26 hetero 8 6.7
Bph3 homo+Bph18 none+BPH26 homo 8 6.7
Bph3 homo+Bph18 hetero+BPH26 hetero 12 10.0
Bph3 homo+Bph18 homo+BPH26 hetero 7 5.8
Total 120 100.0

Analysis of yield-related agricultural traits in Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants influenced by Bph3, Bph18 and BPH26 genotype.

Genotype CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
Bph3 None 78.4±5.7ns 19.8±3.4ns 10.2±2.4ns 122.0±18.8ns 34.3±5.9ns 11.3±1.2ns 65.9±8.2ns 5.8±0.2ns 22.9±5.1ns 54.0±14.0ns 2.4±0.2ns 2.0±0.3ns 0.8±0.1ns 21.7±9.4ns 3.6±2.0ns 18.1±8.0ns 80.3±7.0ns
Hetero 76.6±4.7ns 19.8±3.2ns 10.3±2.3ns 118.6±15.6ns 33.2±5.0ns 11.6±1.0ns 69.0±6.7ns 5.9±0.1ns 21.6±4.5ns 49.5±13.2ns 2.2±0.1ns 1.8±0.3ns 0.7±0.1ns 21.1±9.6ns 4.1±2.2ns 17.0±8.5ns 81.8±6.7ns
Homo 77.7±4.9ns 20.8±1.3ns 11.3±1.9ns 114.5±16.5ns 32.0±5.5ns 11.3±1.2ns 67.3±8.4ns 5.9±0.1ns 20.7±4.8ns 49.4±11.6ns 2.2±0.1ns 1.8±0.4ns 0.7±0.1ns 20.3±9.7ns 3.2±1.8ns 17.0±8.7ns 80.6±8.7ns
Bph18 None 74.8±3.1ns 20.5±2.3ns 10.2±2.8ns 120.9±16.7ns 33.8±5.5ns 11.7±1.2ns 69.3±8.9ns 5.8±0.1ns 22.0±4.6ns 50.4±11.5ns 2.3±0.2ns 1.8±0.3ns 0.7±0.1ns 7.2±3.2** 2.0±0.9* 5.2±2.5** 91.4±2.3**
Hetero 76.0±4.3ns 20.3±2.7ns 10.6±2.2ns 118.7±17.0ns 33.3±5.3ns 11.3±1.0ns 66.9±7.3ns 5.9±0.1ns 22.0±4.8ns 50.7±13.2ns 2.3±0.1ns 1.9±0.3ns 0.7±0.2ns 23.9±5.1ns 4.2±2.0ns 19.7±4.8ns 79.3±4.3ns
Homo 83.7±3.3** 19.0±3.9ns 10.6±1.9ns 116.4±17.0ns 32.6±5.7ns 11.5±1.0ns 68.0±6.9ns 5.8±0.2ns 21.0±5.1ns 51.6±15.0ns 2.2±0.1ns 1.8±0.3ns 0.7±0.1ns 29.9±4.4* 4.7±2.3ns 25.2±3.4ns 73.8±2.8ns
BPH26 None - - - - - - - - - - - - - - - - -
Hetero 78.2±5.3ns 19.9±3.2ns 10.6±2.1ns 118.0±16.9ns 33.1±5.4ns 11.3±1.0ns 67.2±7.2ns 5.9±0.1ns 21.7±4.9ns 51.0±13.7ns 2.3±0.1ns 1.9±0.3ns 0.7±0.2ns 25.7±5.6* 4.3±2.1ns 21.3±5.0ns 77.7±4.7ns
Homo 74.8±3.1ns 20.5±2.3ns 10.2±2.8ns 120.9±16.7ns 33.8±5.5ns 11.7±1.2ns 69.3±8.9ns 5.8±0.1ns 22.0±4.6ns 50.4±11.5ns 2.3±0.2ns 1.8±0.3ns 0.7±0.1ns 7.2±3.2** 2.0±0.9* 5.2±2.5** 91.4±2.3**

Correlation matrix among the agricultural traits of related to panicle structure and yield.

Traits CLz PL NT NS NR NPr NSPr MNSPr NSr NSSr MNSSr SrPr SSrSPr NA NAPr NSSAPr FR
CL 1.000
PL -0.254 1.000
NT 0.075 0.005 1.000
NS 0.146 0.047 -0.259 1.000
NR 0.144 0.100 -0.239 0.949 1.000
NPr 0.164 0.116 -0.166 0.670 0.619 1.000
NSPr 0.156 0.103 -0.165 0.655 0.560 0.963 1.000
MNSPr 0.053 0.008 -0.089 0.245 0.070 0.323 0.565 1.000
NSr 0.123 0.085 -0.231 0.913 0.983 0.463 0.405 0.003 1.000
NSSr 0.090 -0.032 -0.179 0.652 0.671 0.297 0.283 0.082 0.687 1.000
MNSSr -0.048 -0.205 -0.096 0.254 0.073 -0.324 -0.295 -0.057 0.159 0.208 1.000
SrPr 0.050 0.043 -0.157 0.678 0.787 0.011 -0.035 -0.163 0.885 0.613 0.326 1.000
SSrSPr 0.017 -0.047 -0.139 0.602 0.638 -0.143 -0.200 -0.277 0.754 0.541 0.628 0.926 1.000
NA 0.439 -0.150 -0.006 0.013 0.007 0.051 0.031 0.069 0.004 0.090 0.036 0.033 0.013 1.000
NAPr 0.305 -0.111 -0.062 0.024 0.003 0.038 0.039 0.010 0.006 0.085 0.046 0.027 0.006 0.622 1.000
NSSAPr -0.421 0.142 0.023 0.008 0.007 0.048 0.026 0.076 0.003 -0.080 -0.029 -0.030 -0.014 0.980 0.452 1.000
FR -0.447 0.067 0.001 -0.056 -0.056 -0.093 -0.051 -0.126 -0.041 0.035 0.049 -0.001 0.027 -0.859 -0.389 -0.878 1.000

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.

Table 1 Information of the DNA markers used for identify Bph3, Bph18, and BPH26.

zChr: Chromosome.

Table 2 Agricultural traits of Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants.

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate, SD: standard deviation, Min.: minimum, Max.: maximum, CV %: coefficient of variance in percentage.

Table 3 Number of plants in Jeonju686/JJ621MR F2 with introduced brown planthopper resistance gene.
Table 4 Analysis of yield-related agricultural traits in Jeonju686, JJ621MR, Jeonju686/JJ621MR F2 plants influenced by Bph3, Bph18 and BPH26 genotype.

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate. Data are presented as mean±standard deviation, ns non-significant difference, *signifcant at the 0.05 level, **signifcant at the 0.01 level (ANOVA followed by DMRT).

Table 5 Correlation matrix among the agricultural traits of related to panicle structure and yield.

zCL: Culm length, PL: Panicle length, NT: Number of tillers, NS: Number of spikelets, NR: Number of rachis-branches per panicle, NPr: Number of RPBs per panicle, NSPr: Number of spikelets on PRBs per panicle, MNSPr: Mean number of spikelets on a PRB, NSr: Number of SRBs per panicle, NSSr: Number of spikelets on SRBs per panicle, MNSSr: Mean number of spikelets on a SRB, SrPr: Ratio of SRBs to PRBs, SSrSPr: Ratio of spikelets on SRBs to spikelets on PRBs, NA: Number of abortive grains, NAPr: Number of abortive grains on PRBs per panicle, NSSAPr: Number of abortive grains on SRBs per panicle, FR: Fertile rate.