1 농촌진흥청 국립식량과학원,
1 National Institute of Crop Science, RDA, Wanju 55365, Korea
2 농촌진흥청 연구정책국,
2 Research Policy Bureau, RDA, Jeonju 54875, Korea
3 충남대학교 농업생명과학대학
3 Department of Agronomy, Chungnam National University, Daejoen 34134, Korea
© The Korean Society of Breeding Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
| R-genes | Chr.No. | Marker name |
Primer sequences |
Expected size (bp) | Reference |
|---|---|---|---|---|---|
| Forward(5’-3’), Reverse(5’-3’) | |||||
|
|
|||||
| Xa1 | 4 | 16PFXa1 | ACGGTTCTGAAGGTCGTCATTGCAAGAGCTCCGGTTTAAG | 201,155 | Shin et al.2006 |
| Xa1 | 4 | puXa1L | ATTTGGGGAGTTCGTCAGAGCCATTGGAGCGGATTGGTTTTG | 473,350 | Jeung et al.(unpublished) |
| Xa3 | 11 | BB-R | CCACAATGCCATGTCAGGTGGCATCCCTGCAAGGTGTTGGAGGATTGGCAT | 255 | Hur et al.2013 |
| xa3 | 11 | BB-S | CGGAGCGACACAGCTATCATCGTGAGGTTCCCTATGGCGATT | 743 | Hur et al.2013 |
| Xa3 | 11 | puXa3U1 | CAGTATGGATTTTCGTTGCGCCGTATAGCTGGTTAAACTGTAG | 383 | Jeung et al.(unpublished) |
| xa5 | 5 | 10603.T.10Dw | GCACTGCAACCATCAATGAATCCCTAGGAGAAACTAGCCGTCCA | 280 | Park et al.2013 |
| xa5 | 5 | puXa5U | CAAGAAGAGCAGAGCAGAGCTCCTTTAGCAAGGTGTGTACG | 496,300 | Jeung et al.(unpublished) |
| Xa21 | 11 | U1/I1 | CGATCGGTATAACAGCAAAACATAGCAACTGATTGCTTGG | 1,400 | Wang et al.1996 |
| R-gene |
No. of F2 plants |
Expected ratio | x2 | P-value | ||||
|---|---|---|---|---|---|---|---|---|
| AAz | AB | BB | Total | |||||
|
|
||||||||
| Xa1 | 40 | 107 | 52 | 199 | 1:2:1 | 2.578 | 0.276 | |
| Xa3 | 41 | 102 | 56 | 199 | 1:2:1 | 2.387 | 0.303 | |
| xa5 | 56 | 101 | 42 | 199 | 1:2:1 | 2.015 | 0.365 | |
| Xa21 | 160 | 39 | 199 | 3:1 | 3.097 | 0.078 | ||
| Gene combination |
Genotype |
No. of F2 plants |
Lesion length (cm) |
||||
|---|---|---|---|---|---|---|---|
| Xa1 | Xa3 | xa5 | Xa21 | K1 | K3a | ||
|
|
|||||||
| AAz | AA | AA | AA/AB | 4 | 0.1 | 0.3 | |
| Xa1+Xa3+xa5+Xa21 | AA | AB | AA | AA/AB | 2 | 0.1 | 0.6 |
| AB | AA | AA | AA/AB | 1 | 0.1 | 0.4 | |
| AB | AB | AA | AA/AB | 13 | 0.1 | 0.6 | |
| Xa1+Xa3+xa5 | AB | AB | AA | BB | 4 | 0.1 | 2.7 |
| AA | AA | AB | AA/AB | 2 | 0.2 | 2.6 | |
| AA | AA | BB | AA/AB | 2 | 0.1 | 1.1 | |
| AA | AB | AB | AA/AB | 7 | 0.2 | 1.9 | |
| Xa1+Xa3+Xa21 | AA | AB | BB | AA/AB | 6 | 0.1 | 1.5 |
| AB | AA | AB | AA/AB | 11 | 0.1 | 1.9 | |
| AB | AA | BB | AA/AB | 5 | 0.1 | 1.9 | |
| AB | AB | AB | AA/AB | 25 | 0.2 | 2.1 | |
| AB | AB | BB | AA/AB | 9 | 0.2 | 2.2 | |
| Xa1+xa5+Xa21 | AA | BB | AA | AA/AB | 4 | 0.1 | 0.6 |
| AB | BB | AA | AA/AB | 5 | 0.1 | 0.7 | |
| Xa3+xa5+Xa21 | BB | AA | AA | AA/AB | 6 | 1.2 | 0.6 |
| BB | AB | AA | AA/AB | 7 | 1.8 | 0.7 | |
| AA | AA | AB | BB | 1 | 0.2 | 8.7 | |
| AA | AB | AB | BB | 5 | 0.2 | 12.1 | |
| Xa1+Xa3 | AA | AB | BB | BB | 1 | 0.2 | 11.8 |
| AB | AA | BB | BB | 1 | 0.2 | 14.6 | |
| AB | AB | AB | BB | 5 | 0.2 | 13.7 | |
| AB | AB | BB | BB | 4 | 0.2 | 12.7 | |
| Xa1+xa5 | AB | BB | AA | BB | 2 | 0.1 | 2.6 |
| AA | BB | AB | AA/AB | 3 | 0.1 | 1.3 | |
| Xa1+Xa21 | AA | BB | BB | AA/AB | 1 | 0.2 | 2.5 |
| AB | BB | AB | AA/AB | 13 | 0.2 | 1.8 | |
| AB | BB | BB | AA/AB | 2 | 0.2 | 2.3 | |
| Xa3+xa5 | BB | AB | AA | BB | 2 | 1.5 | 2.9 |
| BB | AA | AB | AA/AB | 6 | 4.6 | 2.2 | |
| Xa3+Xa21 | BB | AA | BB | AA/AB | 2 | 3.5 | 2.2 |
| BB | AB | AB | AA/AB | 7 | 3.4 | 2.3 | |
| BB | AB | BB | AA/AB | 3 | 3.7 | 2.2 | |
| xa5+Xa21 | BB | BB | AA | AA/AB | 4 | 1.4 | 1.3 |
| AA | BB | AB | BB | 1 | 0.1 | 13.2 | |
| Xa1 | AA | BB | BB | BB | 1 | 0.3 | 11.2 |
| AB | BB | AB | BB | 5 | 0.3 | 13.0 | |
| AB | BB | BB | BB | 2 | 0.2 | 14.3 | |
| Xa3 | BB | AB | AB | BB | 2 | 4.1 | 11.3 |
| xa5 | BB | BB | AA | BB | 2 | 2.6 | 2.2 |
| Xa21 | BB | BB | BB | AA/AB | 3 | 15.9 | 1.9 |
| BB | BB | AB | AA/AB | 7 | 12.5 | 2.0 | |
| no gene | BB | BB | AB | BB | 1 | 20.5 | 18.5 |
| Total | 199 | ||||||
| Cross (gen.) | Anther cultured (no.) | Cali induced (no. and %) | Plant regeneration (no. and %)z | Green plants (no. and %)y | Albino (no. and %)x | Doubled haploid lines (no.)w |
|---|---|---|---|---|---|---|
|
|
||||||
| Ilmi/HR27814-B-47-1-1 (F2) | 7,700 | 180(2.3) | 21(11.7) | 16(76.2) | 5(23.8) | 8 |
zPercent plant regeneration is the number of plants regenerated over number of cali plated
yPercent green is the number of green plants regenerated over total plants regenerated
xPercent albino is the number of albino plants regenerated over total plants regenerated
wDoubled haploid lines are harvested plants having fertile grain
| Var./line | Cross | Gen. | R-genes |
Bacterial blight |
|||
|---|---|---|---|---|---|---|---|
| K1 | K2 | K3 | K3a | ||||
|
|
|||||||
| Nampyeong | Iri390/Milyang95 | - | unknown | Sz | S | S | S |
| Jinbaek | HR15204-38-3//Milyang165/Iksan438 | - | Xa3+xa5 | HR | HR | HR | R |
| Ilmi | Milyang96//Milyang95/Seomjin | - | Xa1 | HR | S | S | S |
| Saeilmi | Ilmi*5/Hwayeong | - | Xa1+Xa3 | HR | HR | HR | S |
| Iksan575 | Iksan493//Hopum/HR24670-9-2-1 | - | Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL1 (HB30348(F2)-AC1-1)y | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL2 (HB30348(F2)-AC2-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL3 (HB30348(F2)-AC3-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL4 (HB30348(F2)-AC4-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL5 (HB30348(F2)-AC5-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL6 (HB30348(F2)-AC6-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL7 (HB30348(F2)-AC7-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL1 (HB30348-24-17-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL2 (HB30348-172-1-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL3 (HB30348-172-2-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL4 (HB30348-172-4-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL5 (HB30348-172-6-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL6 (HB30348-172-7-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL7 (HB30348-172-9-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL8 (HB30348-172-10-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL9 (HB30348-172-11-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL10 (HB30348-178-10-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| Var./line |
Control |
K3a inoculation |
||||||
|---|---|---|---|---|---|---|---|---|
| Rough rice yield (g) | Brown rice yield (g) | Ratio of ripened grain (%) | Perfect kernel of brown rice (%) | Rough rice yield (g) | Brown rice yield (g) | Ratio of ripened grain (%) | Perfect kernel of brown rice (%) | |
|
|
||||||||
| Nampyeong | 621 | 475 | 94.3 | 88.4 | 542**z | 406** | 85.5** | 80.5** |
| Jinbaek | 562 | 434 | 96.3 | 93.0 | 550 ns | 424 ns | 96.1 ns | 93.2ns |
| Ilmi | 630 | 489 | 97 | 88.5 | 530** | 412** | 84.5** | 81.2** |
| Saeilmi | 602 | 473 | 96.8 | 89.2 | 500** | 386** | 83.2** | 81.4** |
| Iksan575 | 599 | 468 | 95.6 | 91.2 | 590ns | 460ns | 94.4ns | 90.5ns |
| RDL1 | 639 | 501 | 94.5 | 86.6 | 633ns | 500ns | 94ns | 85.3ns |
| RDL2 | 606 | 473 | 95.1 | 87.6 | 600ns | 469ns | 95ns | 86.2ns |
| RDL3 | 614 | 482 | 95.6 | 84.7 | 610ns | 478ns | 94.9ns | 82.8ns |
| RDL4 | 631 | 494 | 95.4 | 88.9 | 625ns | 485ns | 94.4ns | 86.5ns |
| RDL5 | 614 | 482 | 95.9 | 87.0 | 602ns | 471ns | 95.8ns | 86.4ns |
| RDL6 | 602 | 470 | 95.8 | 87.4 | 602ns | 468ns | 93.4ns | 85.3ns |
| RDL7 | 620 | 484 | 96.5 | 89.1 | 619ns | 483ns | 94.4ns | 88.2ns |
| RPL1 | 590 | 468 | 96.9 | 82.2 | 576ns | 452ns | 97.0ns | 81.4ns |
| RPL2 | 685 | 537 | 96.6 | 88.1 | 680ns | 529ns | 95.5ns | 87.9ns |
| RPL3 | 612 | 473 | 95.4 | 86.3 | 610ns | 470ns | 95.6ns | 86.6ns |
| RPL4 | 689 | 543 | 97.5 | 88.4 | 688ns | 542ns | 96.9ns | 88.2ns |
| RPL5 | 627 | 490 | 95.5 | 89.3 | 615ns | 478ns | 95.2ns | 89.0ns |
| RPL6 | 612 | 476 | 96.0 | 87.9 | 605ns | 470ns | 95.9ns | 88.1ns |
| RPL7 | 638 | 495 | 95.9 | 89.0 | 632ns | 492ns | 95.8ns | 88.9ns |
| RPL8 | 632 | 498 | 96.0 | 89.2 | 625ns | 497ns | 96.1ns | 88.8ns |
| RPL9 | 654 | 513 | 97.5 | 88.4 | 625ns | 508ns | 96.8ns | 86.8ns |
| RPL10 | 590 | 453 | 96.1 | 90.4 | 583ns | 448ns | 95.0ns | 89.7ns |
| Var./line | Heading date (DAS)z | Culm length (cm) | Panicle length (cm) | No. of panicles per hill | No. of spikelets per panicle | Ratio of ripened grain (%) | 1,000 grains weight of brwon rice (g) | Rough rice yield (kg/10a) | Brown/rough rice ratio (%) | Brown rice yield (kg/10a) | Index of brown rice yield (%)y |
|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|||||||||||
| Nampyeong | 103dCx | 71defA | 20ghB | 14aA | 96dB | 93.9eB | 21.2eC | 704cAB | 79.8eC | 562cAB | 100 |
| Jinbaek | 113aA | 63hC | 20hB | 13abA | 99dB | 96.2bA | 21.1efC | 637eC | 80.7cdB | 514eC | 91 |
| Ilmi | 102deC | 70efA | 21gB | 13bAB | 98dB | 96.5bA | 22.8bA | 695cAB | 81.3abcA | 565cAB | 101 |
| Saeilmi | 102deC | 68fgAB | 21gB | 13bAB | 95dB | 96.7bA | 22.4bcA | 673cdB | 81.2abcA | 547cdB | 97 |
| Iksan575 | 110bB | 65hBC | 21ghB | 13abA | 95dB | 95.0cdAB | 22.2cAB | 663cdeBC | 81.2abcA | 539cdeBC | 96 |
| RDL1 | 103d | 72deg | 23def | 13b | 105cd | 94.3de | 21.8cd | 714bc | 81.2abc | 581bc | 103 |
| RDL2 | 103d | 69fg | 22f | 13b | 99d | 95.1cd | 21.0f | 698c | 81.2abc | 567c | 101 |
| RDL3 | 103d | 71def | 23cdef | 12c | 106cd | 95.2cd | 21.3e | 682cd | 81.0abcd | 552cd | 98 |
| RDL4 | 103d | 73bcde | 23cde | 13b | 106cd | 95.4c | 21.3e | 697c | 81.2abc | 566c | 101 |
| RDL5 | 103d | 72def | 23ef | 13ab | 102d | 95.8bc | 21.7d | 701c | 81.4abc | 571c | 102 |
| RDL6 | 103d | 72def | 24cde | 13b | 107bcd | 94.6d | 21.4de | 699c | 81.0abcd | 566c | 101 |
| RDL7 | 103d | 72cde | 23cdef | 13ab | 96d | 95.4c | 21.6d | 677cd | 81.0abcd | 548cd | 98 |
| Mean of RDL | 103C | 71A | 23AB | 13A | 103B | 95.1AB | 21.4BC | 695AB | 81.2A | 564AB | 100 |
| C.V.(%) | 0.2 | 2.2 | 3.1 | 4.6 | 5.5 | 1.4 | 1.5 | 4.5 | 0.5 | 4.8 | |
| RPL1 | 95e | 66gh | 23cdef | 12c | 100d | 97.0a | 23.5a | 661cde | 81.6a | 539cde | 96 |
| RPL2 | 102de | 72def | 23cde | 13bc | 124a | 96.0b | 22.0cd | 744ab | 81.0abcd | 603ab | 107 |
| RPL3 | 102de | 74bcd | 24bc | 11d | 127a | 95.6bc | 22.1c | 680cd | 80.5d | 548cd | 97 |
| RPL4 | 103d | 77a | 25a | 12c | 121ab | 97.2a | 22.7b | 764a | 81.3abc | 621a | 110 |
| RPL5 | 102de | 73bcde | 24cd | 12c | 122a | 94.6d | 22.8b | 714bc | 81.0abcd | 579bc | 103 |
| RPL6 | 102de | 73bcde | 23cde | 12c | 107bcd | 95.7bc | 22.1c | 706c | 80.8bcd | 571c | 102 |
| RPL7 | 102de | 73bcd | 24cd | 12cd | 128a | 95.4c | 21.2e | 729b | 81.5ab | 594ab | 106 |
| RPL8 | 102de | 76ab | 25ab | 11d | 121ab | 96.6b | 22.2c | 719b | 81.2abc | 584b | 104 |
| RPL9 | 103d | 76abc | 24cde | 12cd | 120abc | 97.1a | 21.4de | 745ab | 81.4abc | 606ab | 108 |
| RPL10 | 106c | 65h | 21g | 13bc | 101d | 96.1b | 22.7b | 668cd | 81.1abcd | 542cd | 96 |
| Mean of RPL | 102C | 72A | 24A | 12B | 117A | 96.1A | 22.3AB | 713A | 81.1A | 579A | 103 |
| C.V.(%) | 2.9 | 5.8 | 5.1 | 6.7 | 10.9 | 1.1 | 3.3 | 6.3 | 0.5 | 6.1 | |
Gene-specific PCR primers and functional marker primers used for the identification of bacterial blight resistance genes.
| R-genes | Chr.No. | Marker name | Primer sequences |
Expected size (bp) | Reference |
|---|---|---|---|---|---|
| Forward(5’-3’), Reverse(5’-3’) | |||||
| Xa1 | 4 | 16PFXa1 | ACGGTTCTGAAGGTCGTCATTGCAAGAGCTCCGGTTTAAG | 201,155 | Shin et al.2006 |
| Xa1 | 4 | puXa1L | ATTTGGGGAGTTCGTCAGAGCCATTGGAGCGGATTGGTTTTG | 473,350 | Jeung et al.(unpublished) |
| Xa3 | 11 | BB-R | CCACAATGCCATGTCAGGTGGCATCCCTGCAAGGTGTTGGAGGATTGGCAT | 255 | Hur et al.2013 |
| xa3 | 11 | BB-S | CGGAGCGACACAGCTATCATCGTGAGGTTCCCTATGGCGATT | 743 | Hur et al.2013 |
| Xa3 | 11 | puXa3U1 | CAGTATGGATTTTCGTTGCGCCGTATAGCTGGTTAAACTGTAG | 383 | Jeung et al.(unpublished) |
| xa5 | 5 | 10603.T.10Dw | GCACTGCAACCATCAATGAATCCCTAGGAGAAACTAGCCGTCCA | 280 | Park et al.2013 |
| xa5 | 5 | puXa5U | CAAGAAGAGCAGAGCAGAGCTCCTTTAGCAAGGTGTGTACG | 496,300 | Jeung et al.(unpublished) |
| Xa21 | 11 | U1/I1 | CGATCGGTATAACAGCAAAACATAGCAACTGATTGCTTGG | 1,400 | Wang et al.1996 |
Segregation ratio of resistance genes in F2 population using gene-specific DNA markers.
| R-gene | No. of F2 plants |
Expected ratio | x2 | P-value | ||||
|---|---|---|---|---|---|---|---|---|
| AA |
AB | BB | Total | |||||
| Xa1 | 40 | 107 | 52 | 199 | 1:2:1 | 2.578 | 0.276 | |
| Xa3 | 41 | 102 | 56 | 199 | 1:2:1 | 2.387 | 0.303 | |
| xa5 | 56 | 101 | 42 | 199 | 1:2:1 | 2.015 | 0.365 | |
| Xa21 | 160 | 39 | 199 | 3:1 | 3.097 | 0.078 | ||
AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21
Average lesion length of F2 plants in resistance gene combinations after inoculation with K1 and K3a races.
| Gene combination | Genotype |
No. of F2 plants | Lesion length (cm) |
||||
|---|---|---|---|---|---|---|---|
| Xa1 | Xa3 | xa5 | Xa21 | K1 | K3a | ||
| AA |
AA | AA | AA/AB | 4 | 0.1 | 0.3 | |
| Xa1+Xa3+xa5+Xa21 | AA | AB | AA | AA/AB | 2 | 0.1 | 0.6 |
| AB | AA | AA | AA/AB | 1 | 0.1 | 0.4 | |
| AB | AB | AA | AA/AB | 13 | 0.1 | 0.6 | |
| Xa1+Xa3+xa5 | AB | AB | AA | BB | 4 | 0.1 | 2.7 |
| AA | AA | AB | AA/AB | 2 | 0.2 | 2.6 | |
| AA | AA | BB | AA/AB | 2 | 0.1 | 1.1 | |
| AA | AB | AB | AA/AB | 7 | 0.2 | 1.9 | |
| Xa1+Xa3+Xa21 | AA | AB | BB | AA/AB | 6 | 0.1 | 1.5 |
| AB | AA | AB | AA/AB | 11 | 0.1 | 1.9 | |
| AB | AA | BB | AA/AB | 5 | 0.1 | 1.9 | |
| AB | AB | AB | AA/AB | 25 | 0.2 | 2.1 | |
| AB | AB | BB | AA/AB | 9 | 0.2 | 2.2 | |
| Xa1+xa5+Xa21 | AA | BB | AA | AA/AB | 4 | 0.1 | 0.6 |
| AB | BB | AA | AA/AB | 5 | 0.1 | 0.7 | |
| Xa3+xa5+Xa21 | BB | AA | AA | AA/AB | 6 | 1.2 | 0.6 |
| BB | AB | AA | AA/AB | 7 | 1.8 | 0.7 | |
| AA | AA | AB | BB | 1 | 0.2 | 8.7 | |
| AA | AB | AB | BB | 5 | 0.2 | 12.1 | |
| Xa1+Xa3 | AA | AB | BB | BB | 1 | 0.2 | 11.8 |
| AB | AA | BB | BB | 1 | 0.2 | 14.6 | |
| AB | AB | AB | BB | 5 | 0.2 | 13.7 | |
| AB | AB | BB | BB | 4 | 0.2 | 12.7 | |
| Xa1+xa5 | AB | BB | AA | BB | 2 | 0.1 | 2.6 |
| AA | BB | AB | AA/AB | 3 | 0.1 | 1.3 | |
| Xa1+Xa21 | AA | BB | BB | AA/AB | 1 | 0.2 | 2.5 |
| AB | BB | AB | AA/AB | 13 | 0.2 | 1.8 | |
| AB | BB | BB | AA/AB | 2 | 0.2 | 2.3 | |
| Xa3+xa5 | BB | AB | AA | BB | 2 | 1.5 | 2.9 |
| BB | AA | AB | AA/AB | 6 | 4.6 | 2.2 | |
| Xa3+Xa21 | BB | AA | BB | AA/AB | 2 | 3.5 | 2.2 |
| BB | AB | AB | AA/AB | 7 | 3.4 | 2.3 | |
| BB | AB | BB | AA/AB | 3 | 3.7 | 2.2 | |
| xa5+Xa21 | BB | BB | AA | AA/AB | 4 | 1.4 | 1.3 |
| AA | BB | AB | BB | 1 | 0.1 | 13.2 | |
| Xa1 | AA | BB | BB | BB | 1 | 0.3 | 11.2 |
| AB | BB | AB | BB | 5 | 0.3 | 13.0 | |
| AB | BB | BB | BB | 2 | 0.2 | 14.3 | |
| Xa3 | BB | AB | AB | BB | 2 | 4.1 | 11.3 |
| xa5 | BB | BB | AA | BB | 2 | 2.6 | 2.2 |
| Xa21 | BB | BB | BB | AA/AB | 3 | 15.9 | 1.9 |
| BB | BB | AB | AA/AB | 7 | 12.5 | 2.0 | |
| no gene | BB | BB | AB | BB | 1 | 20.5 | 18.5 |
| Total | 199 | ||||||
AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21
Anther culture ability and doubled haploid lines derived from the cross of Ilmi/HR27814-B-47-1-1.
| Cross (gen.) | Anther cultured (no.) | Cali induced (no. and %) | Plant regeneration (no. and %) |
Green plants (no. and %) |
Albino (no. and %) |
Doubled haploid lines (no.) |
|---|---|---|---|---|---|---|
| Ilmi/HR27814-B-47-1-1 (F2) | 7,700 | 180(2.3) | 21(11.7) | 16(76.2) | 5(23.8) | 8 |
Percent plant regeneration is the number of plants regenerated over number of cali plated
Percent green is the number of green plants regenerated over total plants regenerated
Percent albino is the number of albino plants regenerated over total plants regenerated
Doubled haploid lines are harvested plants having fertile grain
Resistance reaction of monogenic lines, parents for genes pyramiding, and doubled haploid lines carrying four resistance genes against each of 16 Korean Xanthomonas oryzae pv. oryzae isolates.
| Isolate | IR24 |
IRBB1 |
IRBB3 |
IRBB5 |
IRBB21 |
Ilmi |
Iksan575 |
DH lines average |
HB30348 (F2)-AC1 |
HB30348 (F2)-AC2 |
HB30348( F2)-AC3 |
HB30348 (F2)-AC4 |
HB30348 (F2)-AC5 |
HB30348 (F2)-AC6 |
HB30348(F2)-AC7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Xa18 | Xa1 | Xa3 | xa5 | Xa21 | Xa1 | Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | Xa1+Xa3+xa5+Xa21 | |
| HB1009 | 16.0(S) | 16.3(S) | 17.7(S) | 1.5(R) | 2.2(R) | 13.0(S) | 0.9(HR) | 0.4(HR) | 0.2(HR) | 0.4(HR) | 0.6(HR) | 0.4(HR)(HR) | 0.4(HR) | 0.6(HR) | 0.5(HR) |
| HB1014 | 15.3(S) | 14.0(S) | 7.3(MR) | 1.2(R) | 1.8(R) | 20.0(S) | 0.4(HR) | 0.2(HR) | 0.1(HR) | 0.2(HR) | 0.4(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) |
| HB1015 | 16.7(S) | 13.7(S) | 9.7(MR) | 1.2(R) | 1.2(R) | 16.3(S) | 0.3(HR) | 0.2(HR) | 0.1(HR) | 0.1(HR) | 0.3(HR) | 0.1(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) |
| HB2010 | 16.0(S) | 0.2(HR) | 7.0(MR) | 1.1(R) | 10.7(S) | 0.2(HR) | 0.8(HR) | 0.1(HR) | 0.2(HR) | 0.1(HR) | 0.2(HR) | 0.1(HR) | 0.1(HR) | 0.1(HR) | 0.1(HR) |
| HB2024 | 16.3(S) | 17.0(S) | 15.7(S) | 1.2(R) | 1.5(R) | 17.7(S) | 0.3(HR) | 0.3(HR) | 0.3(HR) | 0.4(HR) | 0.2(HR) | 0.4(HR) | 0.3(HR) | 0.5(HR) | 0.4(HR) |
| HB2038 | 16.0(S) | 14.7(S) | 15.7(MR) | 0.8(HR) | 0.2(HR) | 15.3(S) | 0.3(HR) | 0.2(HR) | 0.1(HR) | 0.2(HR) | 0.1(HR) | 0.1(HR) | 0.1(HR) | 0.1(HR) | 0.4(HR) |
| HB3011 | 15.0(S) | 0.3(HR) | 8.3(S) | 1.5(R) | 17.3(S) | 0.2(HR) | 1.2(R) | 0.2(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) | 0.1(HR) | 0.1(HR) |
| HB3055 | 19.3(S) | 17.7(S) | 18.7(S) | 1.8(R) | 4.2(R) | 22.7(S) | 0.8(HR) | 0.6(HR) | 0.4(HR) | 0.6(HR) | 0.6(HR) | 0.6(HR) | 0.5(HR) | 0.7(HR) | 0.7(HR) |
| HB3079 | 15.0(S) | 18.3(S) | 18.3(S) | 0.6(HR) | 2.0(R) | 19.0(S) | 0.4(HR) | 0.3(HR) | 0.2(HR) | 0.4(HR) | 0.3(HR) | 0.4(HR) | 0.3(HR) | 0.4(HR) | 0.4(HR) |
| HB4024 | 14.3(S) | 15.0(S) | 16.3(S) | 2.3(R) | 2.5(R) | 14.0(S) | 0.8(HR) | 0.5(HR) | 0.3(HR) | 0.3(HR) | 0.5(HR) | 0.5(HR) | 0.4(HR) | 0.5(HR) | 0.9(HR) |
| HB4027 | 15.3(S) | 0.3(HR) | 9.7(MR) | 1.3(R) | 10.2(S) | 0.3(HR) | 1.1(R) | 0.3(HR) | 0.5(HR) | 0.2(HR) | 0.2(HR) | 0.4(HR) | 0.2(HR) | 0.2(HR) | 0.2(HR) |
| HB4040 | 17.7(S) | 19.0(S) | 19.0(S) | 4.2(R) | 5.3(R) | 20.7(S) | 0.8(HR) | 0.6(HR) | 0.4(HR) | 0.6(HR) | 0.6(HR) | 0.8(HR) | 0.5(HR) | 0.9(HR) | 0.6(HR) |
| HB4044 | 18.0(S) | 17.7(S) | 18.0(S) | 3.2(R) | 3.7(R) | 19.7(S) | 0.8(HR) | 0.6(HR) | 0.4(HR) | 0.5(HR) | 0.6(HR) | 0.7(HR) | 0.5(HR) | 0.8(HR) | 0.7(HR) |
| HB4079 | 18.0(S) | 16.3(S) | 15.3(S) | 2.7(R) | 2.3(R) | 19.0(S) | 0.7(HR) | 0.6(HR) | 0.4(HR) | 0.4(HR) | 0.7(HR) | 0.7(HR) | 0.4(HR) | 0.8(HR) | 0.6(HR) |
| HB6142 | 18.7(S) | 17.7(S) | 17.7(S) | 2.2(R) | 3.0(R) | 20.0(S) | 1.1(R) | 0.7(HR) | 0.5(HR) | 0.7(HR) | 0.7(HR) | 0.7(HR) | 0.7(HR) | 0.9(HR) | 0.8(HR) |
| HB6159 | 17.7(S) | 19.0(S) | 15.7(S) | 1.5(R) | 3.3(R) | 19.0(S) | 2.0(R) | 0.6(HR) | 0.4(HR) | 0.6(HR) | 0.6(HR) | 0.7(HR) | 0.6(HR) | 0.9(HR) | 0.6(HR) |
| Mean ± SD | 16.6±1.47 | 13.5±6.85 | 14.4±4.36 | 1.8±0.94 | 4.5±4.52 | 14.8±7.68 | 0.8±0.43 | 0.4±0.20 | 0.3±0.13 | 0.4±0.18 | 0.4±0.21 | 0.4±0.24 | 0.4±0.19 | 0.5±0.0.11 | 0.5±0.0.25 |
| C.V. (%) | 8.9 | 50.6 | 30.3 | 53.9 | 101.3 | 51.9 | 54.8 | 50.4 | 44.3 | 48.2 | 51.4 | 55.1 | 53.4 | 67.0 | 54.6 |
Average lesion length was measured using 3 leaves severely infected
HR: Highly resistant (< 1 cm lesion length) R: Resistant (1-5 cm), MR: Moderately resistant (5-10 cm), S: Susceptible (> 10 cm)
History of selection of four breeding families in the F3 and F4 generations.
| Breeding family | F3 |
F4 |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Marker-assisted selection |
Marker-assisted selection |
Phenotypic selection to |
||||||||
| K3a inoculation |
Agronomic traits |
Yield and quality |
||||||||
| No. of plants | Selected plants | No. of lines | Selected lines | No. of lines | Selected lines | No. of lines | Selected lines | No. of lines | Selected lines | |
| HR30348-24 | 20 | 15 | 15 | 15 | 15 | 3 | 3 | 2 | 2 | 1 |
| HR30348-164 | 20 | 18 | 18 | 18 | 18 | 6 | 6 | 2 | 2 | 0 |
| HR30348-172 | 20 | 20 | 20 | 20 | 20 | 20 | 20 | 11 | 11 | 8 |
| HR30348-178 | 20 | 20 | 20 | 20 | 20 | 20 | 20 | 5 | 5 | 1 |
| Total | 80 | 73 | 73 | 73 | 73 | 49 | 49 | 20 | 20 | 10 |
Pedigree and resistance genes of varieties and breeding lines and their resistance reaction to bacterial blight.
| Var./line | Cross | Gen. | R-genes | Bacterial blight |
|||
|---|---|---|---|---|---|---|---|
| K1 | K2 | K3 | K3a | ||||
| Nampyeong | Iri390/Milyang95 | - | unknown | S |
S | S | S |
| Jinbaek | HR15204-38-3//Milyang165/Iksan438 | - | Xa3+xa5 | HR | HR | HR | R |
| Ilmi | Milyang96//Milyang95/Seomjin | - | Xa1 | HR | S | S | S |
| Saeilmi | Ilmi*5/Hwayeong | - | Xa1+Xa3 | HR | HR | HR | S |
| Iksan575 | Iksan493//Hopum/HR24670-9-2-1 | - | Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL1 (HB30348(F2)-AC1-1) |
Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL2 (HB30348(F2)-AC2-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL3 (HB30348(F2)-AC3-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL4 (HB30348(F2)-AC4-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL5 (HB30348(F2)-AC5-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL6 (HB30348(F2)-AC6-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RDL7 (HB30348(F2)-AC7-1) | Ilmi/HR27814-B-47-1-1 | AC2 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL1 (HB30348-24-17-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL2 (HB30348-172-1-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL3 (HB30348-172-2-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL4 (HB30348-172-4-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL5 (HB30348-172-6-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL6 (HB30348-172-7-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL7 (HB30348-172-9-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL8 (HB30348-172-10-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL9 (HB30348-172-11-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
| RPL10 (HB30348-178-10-3-1) | Ilmi/HR27814-B-47-1-1 | F6 | Xa1+Xa3+xa5+Xa21 | HR | HR | HR | HR |
HR, R, and S mean highly resistant, resistant, and susceptible to bacterial blight, respectively
RDL and RPL mean resistant lines by doubled haploid and pedigree method, respectively
Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice.
| Var./line | Control |
K3a inoculation |
||||||
|---|---|---|---|---|---|---|---|---|
| Rough rice yield (g) | Brown rice yield (g) | Ratio of ripened grain (%) | Perfect kernel of brown rice (%) | Rough rice yield (g) | Brown rice yield (g) | Ratio of ripened grain (%) | Perfect kernel of brown rice (%) | |
| Nampyeong | 621 | 475 | 94.3 | 88.4 | 542 |
406 |
85.5 |
80.5 |
| Jinbaek | 562 | 434 | 96.3 | 93.0 | 550 ns | 424 ns | 96.1 ns | 93.2ns |
| Ilmi | 630 | 489 | 97 | 88.5 | 530 |
412 |
84.5 |
81.2 |
| Saeilmi | 602 | 473 | 96.8 | 89.2 | 500 |
386 |
83.2 |
81.4 |
| Iksan575 | 599 | 468 | 95.6 | 91.2 | 590ns | 460ns | 94.4ns | 90.5ns |
| RDL1 | 639 | 501 | 94.5 | 86.6 | 633ns | 500ns | 94ns | 85.3ns |
| RDL2 | 606 | 473 | 95.1 | 87.6 | 600ns | 469ns | 95ns | 86.2ns |
| RDL3 | 614 | 482 | 95.6 | 84.7 | 610ns | 478ns | 94.9ns | 82.8ns |
| RDL4 | 631 | 494 | 95.4 | 88.9 | 625ns | 485ns | 94.4ns | 86.5ns |
| RDL5 | 614 | 482 | 95.9 | 87.0 | 602ns | 471ns | 95.8ns | 86.4ns |
| RDL6 | 602 | 470 | 95.8 | 87.4 | 602ns | 468ns | 93.4ns | 85.3ns |
| RDL7 | 620 | 484 | 96.5 | 89.1 | 619ns | 483ns | 94.4ns | 88.2ns |
| RPL1 | 590 | 468 | 96.9 | 82.2 | 576ns | 452ns | 97.0ns | 81.4ns |
| RPL2 | 685 | 537 | 96.6 | 88.1 | 680ns | 529ns | 95.5ns | 87.9ns |
| RPL3 | 612 | 473 | 95.4 | 86.3 | 610ns | 470ns | 95.6ns | 86.6ns |
| RPL4 | 689 | 543 | 97.5 | 88.4 | 688ns | 542ns | 96.9ns | 88.2ns |
| RPL5 | 627 | 490 | 95.5 | 89.3 | 615ns | 478ns | 95.2ns | 89.0ns |
| RPL6 | 612 | 476 | 96.0 | 87.9 | 605ns | 470ns | 95.9ns | 88.1ns |
| RPL7 | 638 | 495 | 95.9 | 89.0 | 632ns | 492ns | 95.8ns | 88.9ns |
| RPL8 | 632 | 498 | 96.0 | 89.2 | 625ns | 497ns | 96.1ns | 88.8ns |
| RPL9 | 654 | 513 | 97.5 | 88.4 | 625ns | 508ns | 96.8ns | 86.8ns |
| RPL10 | 590 | 453 | 96.1 | 90.4 | 583ns | 448ns | 95.0ns | 89.7ns |
ns
mean no significant, significant at p < 0.01 by t-test, respectively
Yield-related traits of rice varieties and breeding lines at yield trial.
| Var./line | Heading date (DAS) |
Culm length (cm) | Panicle length (cm) | No. of panicles per hill | No. of spikelets per panicle | Ratio of ripened grain (%) | 1,000 grains weight of brwon rice (g) | Rough rice yield (kg/10a) | Brown/rough rice ratio (%) | Brown rice yield (kg/10a) | Index of brown rice yield (%) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Nampyeong | 103dC |
71defA | 20ghB | 14aA | 96dB | 93.9eB | 21.2eC | 704cAB | 79.8eC | 562cAB | 100 |
| Jinbaek | 113aA | 63hC | 20hB | 13abA | 99dB | 96.2bA | 21.1efC | 637eC | 80.7cdB | 514eC | 91 |
| Ilmi | 102deC | 70efA | 21gB | 13bAB | 98dB | 96.5bA | 22.8bA | 695cAB | 81.3abcA | 565cAB | 101 |
| Saeilmi | 102deC | 68fgAB | 21gB | 13bAB | 95dB | 96.7bA | 22.4bcA | 673cdB | 81.2abcA | 547cdB | 97 |
| Iksan575 | 110bB | 65hBC | 21ghB | 13abA | 95dB | 95.0cdAB | 22.2cAB | 663cdeBC | 81.2abcA | 539cdeBC | 96 |
| RDL1 | 103d | 72deg | 23def | 13b | 105cd | 94.3de | 21.8cd | 714bc | 81.2abc | 581bc | 103 |
| RDL2 | 103d | 69fg | 22f | 13b | 99d | 95.1cd | 21.0f | 698c | 81.2abc | 567c | 101 |
| RDL3 | 103d | 71def | 23cdef | 12c | 106cd | 95.2cd | 21.3e | 682cd | 81.0abcd | 552cd | 98 |
| RDL4 | 103d | 73bcde | 23cde | 13b | 106cd | 95.4c | 21.3e | 697c | 81.2abc | 566c | 101 |
| RDL5 | 103d | 72def | 23ef | 13ab | 102d | 95.8bc | 21.7d | 701c | 81.4abc | 571c | 102 |
| RDL6 | 103d | 72def | 24cde | 13b | 107bcd | 94.6d | 21.4de | 699c | 81.0abcd | 566c | 101 |
| RDL7 | 103d | 72cde | 23cdef | 13ab | 96d | 95.4c | 21.6d | 677cd | 81.0abcd | 548cd | 98 |
| Mean of RDL | 103C | 71A | 23AB | 13A | 103B | 95.1AB | 21.4BC | 695AB | 81.2A | 564AB | 100 |
| C.V.(%) | 0.2 | 2.2 | 3.1 | 4.6 | 5.5 | 1.4 | 1.5 | 4.5 | 0.5 | 4.8 | |
| RPL1 | 95e | 66gh | 23cdef | 12c | 100d | 97.0a | 23.5a | 661cde | 81.6a | 539cde | 96 |
| RPL2 | 102de | 72def | 23cde | 13bc | 124a | 96.0b | 22.0cd | 744ab | 81.0abcd | 603ab | 107 |
| RPL3 | 102de | 74bcd | 24bc | 11d | 127a | 95.6bc | 22.1c | 680cd | 80.5d | 548cd | 97 |
| RPL4 | 103d | 77a | 25a | 12c | 121ab | 97.2a | 22.7b | 764a | 81.3abc | 621a | 110 |
| RPL5 | 102de | 73bcde | 24cd | 12c | 122a | 94.6d | 22.8b | 714bc | 81.0abcd | 579bc | 103 |
| RPL6 | 102de | 73bcde | 23cde | 12c | 107bcd | 95.7bc | 22.1c | 706c | 80.8bcd | 571c | 102 |
| RPL7 | 102de | 73bcd | 24cd | 12cd | 128a | 95.4c | 21.2e | 729b | 81.5ab | 594ab | 106 |
| RPL8 | 102de | 76ab | 25ab | 11d | 121ab | 96.6b | 22.2c | 719b | 81.2abc | 584b | 104 |
| RPL9 | 103d | 76abc | 24cde | 12cd | 120abc | 97.1a | 21.4de | 745ab | 81.4abc | 606ab | 108 |
| RPL10 | 106c | 65h | 21g | 13bc | 101d | 96.1b | 22.7b | 668cd | 81.1abcd | 542cd | 96 |
| Mean of RPL | 102C | 72A | 24A | 12B | 117A | 96.1A | 22.3AB | 713A | 81.1A | 579A | 103 |
| C.V.(%) | 2.9 | 5.8 | 5.1 | 6.7 | 10.9 | 1.1 | 3.3 | 6.3 | 0.5 | 6.1 | |
Days after seeding
Brown rice yield of Nampyeong as a standard
Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.
Quality-related traits of milled rice of varieties and breeding lines at yield trial.
| Var./line | Head rice (%) | Opaque rice (%) | Damaged rice (%) | Broken rice (%) | Colored rice (%) | Protein content (%) | Amylose content (%) | Glossiness (TOYO value) |
|---|---|---|---|---|---|---|---|---|
| Nampyeong | 97.0aA | 0.4dAB | 0.5cBC | 2.0fBC | 0.1cA | 5.9bA | 18.5hE | 89.5abAB |
| Jinbaek | 96.9aA | 0.5cdAB | 0.9bA | 1.5gC | 0.1cA | 5.4dD | 20.7aA | 91.4aA |
| Ilmi | 95.7bAB | 0.4dAB | 0.3dC | 3.5cA | 0.1cA | 5.7bcB | 18.9gD | 87.2bcAB |
| Saeilmi | 96.3abAB | 0.4dAB | 0.3dC | 2.9dAB | 0.1cA | 5.7bcB | 19.0fgD | 85.9cB |
| Iksan575 | 94.6cdB | 0.2dB | 0.6cB | 4.3bA | 0.2bA | 5.7bcBC | 20.2cB | 87.3bcAB |
| RDL1 | 93.6e | 0.8cd | 1.2a | 4.4b | 0.1c | 5.5cd | 20.2bc | 79.9de |
| RDL2 | 95.4b | 0.4d | 1.1a | 3.0d | 0.1c | 5.5cd | 20.5ab | 88.9ab |
| RDL3 | 93.3e | 0.5cd | 1.0ab | 5.1a | 0.2b | 5.5cd | 20.2bc | 83.6cd |
| RDL4 | 94.8c | 0.5cd | 1.0ab | 3.6c | 0.1c | 5.5cd | 20.2bc | 86.8bc |
| RDL5 | 94.8c | 0.5cd | 1.0ab | 3.7c | 0.1c | 5.6c | 20.4abc | 86.7bc |
| RDL6 | 95.5b | 0.4d | 0.8b | 3.2cd | 0.1bc | 5.5cd | 20.1c | 87.0bc |
| RDL7 | 95.5b | 0.3d | 1.0ab | 3.2cd | 0.1c | 5.6c | 20.3bc | 82.0d |
| Mean of RDL | 94.7B | 0.5AB | 1.0A | 3.7A | 0.1A | 5.5CD | 20.3B | 85.0B |
| C.V. (%) | 1.2 | 40.0 | 30.0 | 24.3 | 100.0 | 2.0 | 1.0 | 4.8 |
| RPL1 | 94.6cd | 0.5cd | 0.4cd | 4.4b | 0.2ab | 6.2a | 18.7gh | 77.7e |
| RPL2 | 95.5b | 1.6b | 0.5c | 2.5e | 0.0d | 5.7bc | 19.3ef | 84.0cd |
| RPL3 | 94.6cd | 1.6b | 0.6c | 3.2cd | 0.1c | 5.7bc | 19.0fg | 78.0e |
| RPL4 | 92.9f | 2.9a | 0.4cd | 3.6c | 0.1c | 5.7bc | 19.5de | 84.4cd |
| RPL5 | 95.3b | 0.8cd | 0.7bc | 3.0d | 0.2b | 5.7bc | 19.5de | 83.2cd |
| RPL6 | 95.8b | 1.1bc | 0.6c | 2.5e | 0.1c | 5.9b | 19.4de | 76.2f |
| RPL7 | 96.4ab | 0.7cd | 0.6c | 2.2f | 0.1cd | 5.8b | 19.3de | 78.6e |
| RPL8 | 95.2b | 1.7b | 0.5c | 2.6e | 0.1c | 5.8b | 19.3de | 79.7de |
| RPL9 | 94.7c | 0.7cd | 0.7bc | 3.7c | 0.2b | 5.8b | 19.6d | 79.3de |
| RPL10 | 94.1d | 0.2d | 0.5c | 4.9ab | 0.3a | 5.8b | 20.1c | 88.0abc |
| Mean of RPL | 94.9B | 1.2A | 0.5CB | 3.3AB | 0.1A | 5.8AB | 19.4C | 80.9C |
| C.V. (%) | 1.6 | 75.0 | 40.0 | 39.4 | 100.0 | 3.8 | 2.2 | 6.9 |
Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.
AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21
AA: homozygote for resistance gene, AB: heterozygote, BB: homozygote for susceptible gene, AA/AB: homo for resistance or heterozygote for Xa21
Percent plant regeneration is the number of plants regenerated over number of cali plated
Percent green is the number of green plants regenerated over total plants regenerated
Percent albino is the number of albino plants regenerated over total plants regenerated
Doubled haploid lines are harvested plants having fertile grain
Average lesion length was measured using 3 leaves severely infected
HR: Highly resistant (< 1 cm lesion length) R: Resistant (1-5 cm), MR: Moderately resistant (5-10 cm), S: Susceptible (> 10 cm)
HR, R, and S mean highly resistant, resistant, and susceptible to bacterial blight, respectively
RDL and RPL mean resistant lines by doubled haploid and pedigree method, respectively
ns
mean no significant, significant at p < 0.01 by t-test, respectively
Days after seeding
Brown rice yield of Nampyeong as a standard
Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.
Means with the same letters in a column are not significantly different at p < 0.05 (ANOVA followed by DMRT). Small and capital letters indicate statistic difference between lines and breeding methods, respectively.